Identification of Neural Programmed Cell Death Through the Detection of DNA Fragmentation In Situ and by PCR

Yun C. Yung1, Grace Kennedy2, Jerold Chun2

1 University of California, San Diego School of Medicine, San Diego, California, 2 Helen L. Dorris Child and Adolescent Neuropsychiatric Disorder Institute, The Scripps Research Institute, La Jolla, California
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 3.8
DOI:  10.1002/0471142301.ns0308s48
Online Posting Date:  July, 2009
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Programmed cell death is a fundamental process for the development and somatic maintenance of organisms. This unit describes methods for visualizing both dying cells in situ and for detection of nucleosomal ladders. A description of various current detection strategies is provided, as well as support protocols for preparing positive and negative controls and for preparing genomic DNA. Curr. Protoc. Neurosci. 48:3.8.1‐3.8.24. © 2009 by John Wiley & Sons, Inc.

Keywords: cell death; apoptosis; ISEL; TUNEL; nucleosomal ladder

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Detection of Programmed Cell Death by In Situ End‐Labeling Plus (ISEL+)
  • Support Protocol 1: Preparation of Thymocyte Cell Cultures for ISEL+
  • Basic Protocol 2: Detection of Nucleosomal Ladders Associated with Programmed Cell Death by Ligation‐Mediated Polymerase Chain Reaction (LMPCR)
  • Support Protocol 2: Isolation of Genomic DNA from Tissues and Cultures
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Detection of Programmed Cell Death by In Situ End‐Labeling Plus (ISEL+)

  Materials
  • Pregnant mice or tissue culture cells grown on 12‐mm glass coverslips coated with an appropriate adhesive (e.g., poly‐L‐lysine, appendix 2A, or Cell‐Tak from Becton Dickinson)
  • DMEM or other dissection medium, 4°C
  • OCT compound (e.g., Tissue‐Tek II from Sakura) or other water‐soluble embedding medium, 4°C
  • Appropriate controls (see step 1 annotation)
  • Liquefied Histo‐Freeze (Fisher Sci), CryoKwik (Damon), or liquid nitrogen
  • Dry ice, finely crushed (optional)
  • Fixative (see recipe)
  • 2× SSPE ( appendix 2A)
  • 2× SSPE/0.6% Triton X‐100 (see recipe)
  • 0.1 M triethanolamine (TEA; see recipe)
  • Acetic anhydride (Sigma, cat. no. 91204)
  • DNase‐free water
  • 30%, 50%, 70%, 95%, and 100% ethanol, prepared with DNase‐free water
  • ISEL+ TdT solution (see recipe)
  • Parafilm
  • MABS buffer (see recipe)
  • Blocking buffer (see recipe)
  • AP‐conjugated sheep anti‐DIG antibody (Roche, cat. no. 11093274910)
  • Alkaline phosphate buffer (see recipe)
  • Alkaline phosphatase color substrate buffer (see recipe)
  • Nuclear fast red solution (see recipe)
  • Permanent mounting medium (e.g., Crystal Mount from Biomeda and DPX from Fluka)
  • Unconjugated sheep anti‐DIG antibody (Roche, cat. no. 11333089001)
  • Phosphate‐buffered saline ( appendix 2A)
  • Fluorescent tagged anti‐sheep antibody (e.g., AlexaFluor 488 tagged; Invitrogen, cat. no. A‐11015)
  • 4′,6‐diamidino‐2‐phenylindole (DAPI; Sigma, cat. no. D9542)
  • Fluorescence mounting medium (e.g., Vectashield from Vector Labs)
  • Dissecting instruments including:
    • Fine forceps
    • Fine scissors
    • Blunt forceps and spatula
  • Freezing molds (Fisher Scientific, optional)
  • Cryostat
  • Superfrost Plus glass slides (Fisher Scientific)
  • Slide‐warmer (Barnstead Thermolyne), 50°C
  • Slide‐processing holders and vessels
  • 80°C vacuum oven with house vacuum/pump
  • 24‐well microtiter plates (if using coverslip‐mounted cells as controls)
  • Airtight containers for slide storage with desiccant (Tupperware)
  • Humidified chamber for microscope slides
  • Coverslips
  • Microscope, preferably equipped for brightfield, DIC, and/or fluorescence
CAUTION: Paraformaldehyde, triethanolamine, acetic anhydride, and potassium cacodylate (in the TdT buffer) are toxic and must be used in accordance with safety standards.

Support Protocol 1: Preparation of Thymocyte Cell Cultures for ISEL+

  Materials
  • 4‐week‐old mice
  • DMEM/F‐12 ( appendix 2A), containing 0.0025% trypsin
  • DMEM/F‐12/5% FBS ( appendix 2A)
  • 12‐mm diameter round glass coverslips coated with poly‐L‐lysine ( appendix 2A) or Cell‐Tak (Collaborative Research)
  • Dexamethasone stock solution: 2 mM dexamethasone in 100% ethanol
  • Long‐nose Pasteur pipet, flame polished
  • 24‐well microtiter dishes
  • Additional reagents and equipment for tissue culture (for cultured cells; see appendix 3B)

Basic Protocol 2: Detection of Nucleosomal Ladders Associated with Programmed Cell Death by Ligation‐Mediated Polymerase Chain Reaction (LMPCR)

  Materials
  • Isolated and quantified genomic DNA (see protocol 4)
  • Oligonucleotides for ligation, unphosphorylated:
    • 12‐bp: 5′‐TGCGGTGAGAGG‐3′
    • 24‐bp: 5′‐AGCACTCTCGAGCCTCTCACCGCA‐3′
  • 10× T4 DNA ligase buffer (prepared fresh; see recipe)
  • T4 DNA ligase (Roche; store up to 1 month at −20°C)
  • DNase‐free water
  • PCR buffer (see recipe)
  • Oligonucleotides for single‐copy‐gene PCR controls: e.g., for mouse engrailed:
    • 5′‐AGGACAAGCGGCCTCGCACA‐3′
    • 5′‐CGGTGTCCGACTTGCCCTC‐3′
  • Taq DNA polymerase
  • Agarose gels, analytical grade (see appendix 1N), prepared in TBE buffer ( appendix 2A)
  • Ethidium bromide staining solution ( appendix 2A)
  • 0.5‐ml microcentrifuge tubes
  • Thermal cycler
  • Gel photographic setup
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N)
CAUTION: Ethidium bromide is a mutagen and should be handled, stored, and disposed of with appropriate care.

Support Protocol 2: Isolation of Genomic DNA from Tissues and Cultures

  Materials
  • Mice or tissue culture cells (see appendix 3B) grown on 12‐mm glass coverslips coated with an appropriate adhesive (e.g., poly‐L‐lysine, appendix 2A, or Cell‐Tak, Collaborative Research)
  • Sodium dodecyl sulfate (SDS)/proteinase K buffer (see recipe)
  • Molecular biology–grade 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol equilibrated with Tris⋅Cl, pH 8.0 ( appendix 2A)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 3 M sodium acetate, pH 5.0 ( appendix 2A)
  • 100% ethanol, −20°C
  • 70% ethanol
  • TE buffer, pH 8.0 ( appendix 2A)
  • RNase A solution, DNase‐free ( appendix 2A; optional)
  • Ceramic mortar and pestle, precooled with liquid nitrogen
  • 15‐ and 50‐ml polypropylene tubes with caps
  • 50°C oven with rocker platform
  • Fluorometer or spectrophotometer
  • Additional reagents and equipment for DNA quantitation using a spectrophotometer (see appendix 1K)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Arbour, N., Vanderluit, J.L., Le Grand, J.N., Jahani‐Asl, A., Ruzhynsky, V.A., Cheung, E.C., Kelly, M.A., MacKenzie, A.E., Park, D.S., Opferman, J.T., and Slack, R.S. 2008. Mcl‐1 is a key regulator of apoptosis during CNS development and after DNA damage. J. Neurosci. 28:6068‐6078.
   Blaschke, A.J., Staley, K., and Chun, J. 1996. Widespread programmed cell death in proliferative and post‐mitotic regions of the fetal cerebral cortex. Development 122:1165‐1174.
   Blaschke, A.J., Weiner, J.A., and Chun, J. 1998. Programmed cell death is a universal feature of embryonic and postnatal neuroproliferative regions throughout the central nervous system. J. Comp. Neurol. 396:39‐50.
   Buchman, V.L. and Davies, A.M. 1993. Different neurotrophins are expressed and act in a developmental sequence to promote the survival of embryonic sensory neurons. Development 118:989‐1001.
   Bursch, W., Hochegger, K., Torok, L., Marian, B., Ellinger, A., and Hermann, R.S. 2000. Autophagic and apoptotic types of programmed cell death exhibit different fates of cytoskeletal filaments. J. Cell Sci. 113:1189‐1198.
   Caelles, C., Helmberg, A., and Karin, M. 1994. p53‐dependent apoptosis in the absence of transcriptional activation of p53‐target genes. Nature 370:220‐223.
   Cecconi, F., Alvarez‐Bolado, G., Meyer, B.I., Roth, K.A., and Gruss, P. 1998. Apaf1 (CED‐4 homolog) regulates programmed cell death in mammalian development. Cell 94:727‐737.
   Chao, C., Herr, D., Chun, J., and Xu, Y. 2006. Ser18 and 23 phosphorylation is required for p53‐dependent apoptosis and tumor suppression. EMBO J. 25:2615‐2622.
   Contos, J.J., Fukushima, N., Weiner, J.A., Kaushal, D., and Chun, J. 2000. Requirement for the lpA1 lysophosphatidic acid receptor gene in normal suckling behavior. Proc. Natl. Acad. Sci. U.S.A. 97:13384‐13389.
   Crespo, D., O'Leary, D.D.M., and Cowan, W.M. 1985. Changes in the numbers of optic nerve fibers during late prenatal and postnatal development in the albino rat. Dev. Brain Res. 19:129‐134.
   Davies, A. and Lumsden, A. 1984. Relation of target encounter and neuronal death to nerve growth factor responsiveness in the developing mouse trigeminal ganglion. J. Comp. Neurol. 223:124‐137.
   Depaepe, V., Suarez‐Gonzalez, N., Dufour, A., Passante, L., Gorski, J.A., Jones, K.R., Ledent, C., and Vanderhaeghen, P. 2005. Ephrin signalling controls brain size by regulating apoptosis of neural progenitors. Nature 435:1244‐1250.
   Egerton, M., Scollay, R., and Shortman, K. 1990. Kinetics of mature T‐cell development in the thymus. Proc. Natl. Acad. Sci. U.S.A. 87:2579‐2582.
   Ellis, H.M. and Horvitz, H.R. 1986. Genetic control of programmed cell death in the nematode C. elegans. Cell 44:817‐829.
   Flanagan, A.E.H. 1969. Differentiation and degeneration in the motor column of foetal mouse. J. Morphol. 129:281‐305.
   Gavrieli, Y., Sherman, Y., and Ben‐Sasson, S.A. 1992. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119:493‐501.
   Groszer, M., Erickson, R., Scripture‐Adams, D.D., Lesche, R., Trumpp, A., Zack, J.A., Kornblum, H.I., Liu, X., and Wu, H. 2001. Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo. Science 294:2186‐2189.
   Gu, Y., Sekiguchi, J., Gao, Y., Dikkes, P., Frank, K., Ferguson, D., Hasty, P., Chun, J., and Alt, F.W. 2000. Defective embryonic neurogenesis in Ku‐deficient but not DNA‐dependent protein kinase catalytic subunit‐deficient mice. Proc. Natl. Acad. Sci. U.S.A. 97:2668‐2673.
   Jiang, Y., de Bruin, A., Caldas, H., Fangusaro, J., Hayes, J., Conway, E.M., Robinson, M.L., and Altura, R.A. 2005. Essential role for survivin in early brain development. J. Neurosci. 25:6962‐6970.
   Kerr, J.F.R., Wyllie, A.H., and Currie, A.R. 1972. Apoptosis: A basic biological phenomenon with wide‐ranging implications in tissue kinetics. Br. J. Cancer 26:239‐257.
   Kerr, J.F., Winterford, C.M., and Harmon, B.V. 1994. Apoptosis. Its significance in cancer and cancer therapy. Cancer 73:2013‐2026.
   Kingsbury, M.A., Rehen, S.K., Contos, J.J., Higgins, C.M., and Chun, J. 2003. Non‐proliferative effects of lysophosphatidic acid enhance cortical growth and folding. Nat. Neurosci. 6:1292‐1299.
   Kuida, K., Zheng, T.S., Na, S., Kuan, C., Yang, D., Karasuyama, H., Rakic, P., and Flavell, R.A. 1996. Decreased apoptosis in the brain and premature lethality in CPP32‐deficient mice. Nature 384:368‐372.
   Kuida, K., Haydar, T.F., Kuan, C.Y., Gu, Y., Taya, C., Karasuyama, H., Su, M.S., Rakic, P., and Flavell, R.A. 1998. Reduced apoptosis and cytochrome c‐mediated caspase activation in mice lacking caspase 9. Cell 94:325‐337.
   Lance‐Jones, C. 1982. Motoneuron cell death in the developing lumbar spinal cord of the mouse. Dev. Brain Res. 4:473‐479.
   Liang, Q., Li, W., and Zhou, B. 2008. Caspase‐independent apoptosis in yeast. Biochim. Biophys. Acta 1783:1311‐1319.
   Lindsten, T., Golden, J.A., Zong, W.X., Minarcik, J., Harris, M.H., and Thompson, C.B. 2003. The proapoptotic activities of Bax and Bak limit the size of the neural stem cell pool. J. Neurosci. 23:11112‐11119.
   McConnell, M.J., Kaushal, D., Yang, A.H., Kingsbury, M.A., Rehen, S.K., Treuner, K., Helton, R., Annas, E.G., Chun, J., and Barlow, C. 2004. Failed clearance of aneuploid embryonic neural progenitor cells leads to excess aneuploidy in the Atm‐deficient but not the Trp53‐deficient adult cerebral cortex. J. Neurosci. 24:8090‐8096.
   Morris, R.G., Hargreaves, A.D., Duvall, E., and Wyllie, A.H. 1984. Hormone‐induced cell death. 2. Surface changes in thymocytes undergoing apoptosis. Am. J. Pathol. 115:426‐436.
   Motoyama, N., Wang, F., Roth, K.A., Sawa, H., Nakayama, K., Nakayama, K., Negishi, I., Senju, S., Zhang, Q., Fujii, S., and Loh, D.Y. 1995. Massive cell death of immature hematopoietic cells and neurons in Bcl‐x‐deficient mice. Science 267:1506‐1510.
   Negoescu, A., Lorimier, P., Labat‐Moleur, F., Drouet, C., Robert, C., Guillermet, C., Brambilla, C., and Brambilla, E. 1996. In situ apoptotic cell labeling by the TUNEL method: Improvement and evaluation on cell preparations. J. Histochem. Cytochem. 44:959‐968.
   Oppenheim, R.W. 1985. Naturally occurring cell death during neural development. Trends Neurosci. 8:487‐493.
   Oppenheim, R.W. 1989. The neurotrophic theory and naturally occurring motoneuron death. Trends Neurosci. 12:252‐255.
   Pompeiano, M., Hvala, M., and Chun, J. 1998. Onset of apoptotic DNA fragmentation can precede cell elimination by days in the small intestinal villus. Cell Death Differ. 5:702‐709.
   Pompeiano, M., Blaschke, A.J., Flavell, R.A., Srinivasan, A., and Chun, J. 2000. Decreased apoptosis in proliferative and postmitotic regions of the Caspase 3‐deficient embryonic central nervous system. J. Comp. Neurol. 423:1‐12.
   Raff, M.C., Barres, B.A., Burne, J.F., Coles, H.S., Ishizaki, Y., and Jacobson, M.D. 1993. Programmed cell death and the control of cell survival: lessons from the nervous system. Science 262:695‐700.
   Rehen, S.K., Kingsbury, M.A., Almeida, B.S., Herr, D.R., Peterson, S., and Chun, J. 2006. A new method of embryonic culture for assessing global changes in brain organization. J. Neurosci. Methods 158:100‐108.
   Sengelaub, D.R., Dolan, R.P., and Finlay, B.L. 1986. Cell generation, death, and retinal growth in the development of the hamster retinal ganglion cell layer. J. Comp. Neurol. 246:527‐543.
   Shortman, K., Egerton, M., Spangrude, G.J., and Scollay, R. 1990. The generation and fate of thymocytes. Sem. Immunol. 2:3‐12.
   Staley, K., Blaschke, A.J., and Chun, J. 1997. Apoptotic DNA fragmentation is detected by a semi‐quantitative ligation‐mediated PCR of blunt DNA ends. Cell Death Differ. 4:66‐75.
   Strater, J., Gunthert, A.R., Bruderlein, S., and Moller, P. 1995. Microwave irradiation of paraffin‐embedded tissue sensitizes the TUNEL method for in situ detection of apoptotic cells. Histochem. Cell Biol. 103:157‐160.
   Surh, C.D. and Sprent, J. 1994. T‐cell apoptosis detected in situ during positive and negative selection in the thymus. Nature 372:100‐103.
   Thomas, L.B., Gates, D.J., Richfield, E.K., O'Brien, T.F., Schweitzer, J.B., and Steindler, D.A. 1995. DNA end labeling (TUNEL) in Huntington's disease and other neuropathological conditions. Exp. Neurol. 133:265‐272.
   Ucker, D.S. 1991. Death by suicide: One way to go in mammalian cellular development? New Biol. 3:103‐109.
   Vaccarino, F.M., Schwartz, M.L., Raballo, R., Nilsen, J., Rhee, J., Zhou, M., Doetschman, T., Coffin, J.D., Wyland, J.J., and Hung, Y.T. 1999. Changes in cerebral cortex size are governed by fibroblast growth factor during embryogenesis. Nat. Neurosci. 2:848.
   Weiner, J.A. and Chun, J. 1999. Schwann cell survival mediated by the signaling phospholipid lysophosphatidic acid. Proc. Natl. Acad. Sci. U.S.A. 96:5233‐5238.
   Weiner, J.A., Hecht, J.H., and Chun, J. 1998. Lysophosphatidic acid receptor gene vzg‐1/lpA1/edg‐2 is expressed by mature oligodendrocytes during myelination in the postnatal murine brain. J. Comp. Neurol. 398:587‐598.
   White, K., Grether, M.E., Abrams, J.M., Young, L., Farrell, K., and Steller, H. 1994. Genetic control of programmed cell death in Drosophila. Science 264:677‐683.
   Wijsman, J.H., Jonker, R.R., Keijzer, R., Van De Velde, C.J.H., Cornelisse, C.J., and Van Dierendonck, J.H. 1993. A New Method to Detect Apoptosis in Paraffin Sections: In Situ End‐labeling of Fragmented DNA. J. Histochem. Cytochem. 41:7‐12.
   Wilkie, A.L., Jordan, S.A., Sharpe, J.A., Price, D.J., and Jackson, I.J. 2004. Widespread tangential dispersion and extensive cell death during early neurogenesis in the mouse neocortex. Dev. Biol. 267:109‐118.
   Wood, K.A., Dipasquale, B., and Youle, R.J. 1993. In situ labeling of granule cells for apoptosis‐associated DNA fragmentation reveals different mechanisms of cell loss in developing cerebellum. Neuron 11:621‐632.
   Wyllie, A.H. 1981. Cell death: A new classification separating apoptosis from necrosis. In Cell Death in Biology and Pathology (I.D. Bowen and R.A. Lockshin, eds.) pp. 9‐34. Chapman and Hall, London.
   Yan, L., Herrmann, V., Hofer, J.K., and Insel, P.A. 2000. β‐Adrenergic receptor/cAMP‐mediated signaling and apoptosis of S49 lymphoma cells. Am. J. Physiol.‐Cell Physiol. 279:C1665‐1674.
   Yoshida, H., Kong, Y.Y., Yoshida, R., Elia, A.J., Hakem, A., Hakem, R., Penninger, J.M., and Mak, T.W. 1998. Apaf1 is required for mitochondrial pathways of apoptosis and brain development. Cell 94:739‐750.
   Young, R.W. 1984. Cell death during differentiation of the retina in the mouse. J. Comp. Neurol. 229:362‐373.
   Zaidi, A.U., D'Sa‐Eipper, C., Brenner, J., Kuida, K., Zheng, T.S., Flavell, R.A., Rakic, P., and Roth, K.A. 2001. Bcl‐X(L)‐caspase‐9 interactions in the developing nervous system: Evidence for multiple death pathways. J. Neurosci. 21:169‐175.
Key References
   Blaschke et al., 1996. See above.
  First use of ISEL+ and the detection of programmed cell death in the embryonic cortex.
   Gavrieli et al., 1992. See above.
  First technique to utilize labeling of DNA ends to detect programmed cell death.
   Raff et al., 1993. See above.
  An informative discussion of nervous system programmed cell death.
   Staley et al., 1997. See above.
  First use of ligation‐mediated PCR to demonstrate apoptotic ladders in normal tissues.
   Wyllie, 1981. See above.
  First demonstration of nucleosomal ladders associated with apoptosis.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library