Directed Mutagenesis Using the Polymerase Chain Reaction

Brendan Cormack1

1 Johns Hopkins University School of Medicine, Baltimore, Maryland
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 4.11
DOI:  10.1002/0471142301.ns0411s03
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The polymerase chain reaction (PCR) is most often used for the enzymatic amplification and direct sequencing of small quantities of nucleic acids. This technology can also be used as a quick and efficient method for introducing any desired sequence change into the DNA of interest. This unit contains two basic protocols for introducing base changes into specific DNA sequences. The first describes the incorporation of a restriction site and the second details the generation of specific point mutations. An alternate protocol describes generating point mutations by sequential PCR steps. Although the general procedure is the same in all three protocols, there are differences in the design of the synthetic oligonucleotide primers and in the subsequent cloning and analyses of the amplified fragments.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Introduction of Restriction Endonuclease Sites by PCR
  • Basic Protocol 2: Introduction of Points Mutations by PCR
  • Alternate Protocol 1: Introduction of a Point Mutations by Sequential PCR Steps
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Introduction of Restriction Endonuclease Sites by PCR

  Materials
  • DNA sample to be mutagenized
  • pUC19 plasmid vector (Figure ) or similar high‐copy‐number plasmid having M13 flanking primer sequences
  • TE buffer ( appendix 2A)
  • 10× MgCl 2‐free PCR amplification buffer (see recipe) supplemented with MgCl 2 as appropriate (see step )
  • 2 mM 4dNTP mix (see recipe)
  • 500 ng/µl (100 pmol/µl) M13 forward and reverse flanking sequence primers (New England Biolabs)
  • 5 U/µl Taq DNA polymerase
  • Mineral oil
  • Chloroform
  • Buffered phenol ( appendix 2A)
  • 100% ethanol
  • Appropriate restriction endonucleases (Table 4.11.1)
  • Additional reagents and equipment for subcloning and DNA ligation (see CPMB UNIT and appendix 1A in this manual), plasmid DNA miniprep (CPMB UNIT ), synthesis and purification of oligonucleotides (CPMB UNITS & ), PCR amplification (CPMB UNIT ), DNA extraction and precipitation (CPMB UNIT ), quantitation of DNA by absorbance spectrometry (CPMB APPENDIX ), restriction endonuclease digestion (CPMB UNIT ), agarose and polyacrylamide gel electrophoresis of DNA (CPMB UNITS & ), purification of DNA from low gelling/melting agarose gels (CPMB UNIT ), transformation of E. coli (CPMB UNIT ), and DNA sequence analysis (CPMB UNIT )
    Table 4.1.1   Materials   Relative Efficiencies of Restriction Enzyme Cleavage When Restriction Site is Near End of DNA Fragment a   Relative Efficiencies of Restriction Enzyme Cleavage When Restriction Site is Near End of DNA Fragment

    Enzyme Oligonucleotide sequence   % cleavage
    2 hr 20 hr
    AflIII CCACATGTGG >90 >90
    AscI GGCGCGCC >90 >90
    AvaI CCCCCGGGGG >90 >90
    BamHI CGGGATCCCG >90 >90
    BglII GAAGATCTTC 75 >90
    BssHII TTGGCGCGCCAA 50 >90
    BstEII GGGT(A/T)ACCC 0 10
    BstXI CTGCAGAACCAATGCATTGGATGCAT 25 >90
    ClaI CCATCGATGG >90 >90
    EcoRI GGAATTCC >90 >90
    HaeIII GGGGCCCC >90 >90
    HindIII CCCAAGCTTGGG 10 75
    KpnI GGGGTACCCC >90 >90
    MluI CGACGCGTCG 25 50
    NcoI CATGCCATGGCATG 50 75
    NdeI GGAATTCCATATGGAATTCC 75 90
    NheI CTAGCTAGCTAG 10 50
    NotI AAGGAAAAAAGCGGCCGCAAAAGGAAAA 25 >90
    NsiI CCAATGCATTGGTTCTGCAGTT >90 >90
    PacI CCTTAATTAAGG 0 >90
    PmeI AGCTTTGTTTAAACGGCGCGCCGG 75 >90
    PstI AAAACTGCAGCCAATGCATTGGAA >90 >90
    PvuI ATCGATCGAT 10 25
    SacI CGAGCTCG 10 10
    SacII TCCCCGCGGGGA 50 90
    SalI ACGCGTCGACGTCGGCCATAGCGGCCGCGGAA 10 75
    ScaI AAAAGTACTTTT 75 75
    SmaI TCCCCCGGGGGA >90 >90
    SpeI GACTAGTC 10 >90
    SphI ACATGCATGCATGT 10 50
    StuI AAGGCCTT >90 >90
    XbaI GCTCTAGAGC >90 >90
    XhoI CCGCTCGAGCGG 10 75
    XmaI TCCCCCCGGGGGGA >90 >90

     aReprinted with permission from New England Biolabs.

Basic Protocol 2: Introduction of Points Mutations by PCR

  Materials
  • DNA sample to be mutagenized
  • Klenow fragment of E. coli DNA polymerase I
  • Appropriate restriction endonuclease (Table 4.11.1)
  • Additional reagents and equipment for synthesis and purification of oligonucleotides (CPMB UNIT & ), phosphorylation of oligonucleotides (CPMB UNIT ), electrophoresis of DNA on nondenaturing agarose and low gelling/melting agarose gels (CPMB UNIT & ), restriction endonuclease digestion (CPMB UNIT ), ligation of DNA fragments (CPMB UNIT ), transformation of E. coli (CPMB UNIT ), plasmid DNA miniprep (CPMB UNIT ), and DNA sequence analysis (CPMB UNIT also see appendix 1A in this manual).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B., and Erlich, H.A. 1988. P1rimer‐directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487‐491.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library