Production and Titration of Lentiviral Vectors

Isabelle Barde1, Patrick Salmon2, Didier Trono1

1 School of Life Sciences, École Polytechnique Fédérale de Lausanne and “Frontiers in Genetics,” National Center of Competence in Research, Lausanne, Switzerland, 2 Department of Neuroscience. Faculty of Medicine, University of Geneva, Geneva, Switzerland
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 4.21
DOI:  10.1002/0471142301.ns0421s53
Online Posting Date:  October, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Lentiviral vectors have emerged over the last decade as powerful, reliable, and safe tools for stable gene transfer in a wide variety of mammalian cells. Unlike other vectors derived from oncoretroviruses, they allow for stable gene delivery into most nondividing primary cells, including neurons. This is why lentivectors (LVs) are becoming the most useful and promising tools in the field of neuroscience, not only for research, but also for future gene and cell therapy approaches. LVs derived from HIV‐1 have gradually evolved to display many desirable features aimed at increasing both their safety and their versatility. These latest designs are reviewed in this unit. This unit also describes protocols for production and titration of LVs that can be implemented in a research laboratory setting, with an emphasis on standardization to improve transposability of results between laboratories. Curr. Protoc. Neurosci. 53:4.21.1‐4.21.23. © 2010 by John Wiley & Sons, Inc.

Keywords: lentivirus vector; lentivector; gene transfer; molecular biology; gene expression; protein expression; neuroscience; molecular neurobiology; RNA; viral RNAs

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Production of High‐Titer HIV‐1‐Based Vector Stocks by Transient Transfection of 293T Cells
  • Support Protocol 1: Determination of Total Vector Concentration Using Anti‐P24 Immunoassay
  • Support Protocol 2: Biological Titration of Lentivectors Using Flow Cytometry
  • Support Protocol 3: Biological Titration of Lentivectors by Quantitative PCR (qPCR)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Production of High‐Titer HIV‐1‐Based Vector Stocks by Transient Transfection of 293T Cells

  Materials
  • 293T/17 cells (ATCC, cat. no. SD‐3515)
  • Dulbecco's modified Eagle medium/10% FBS (DMEM‐10; appendix 2A)
  • 0.05% trypsin/EDTA (e.g., Invitrogen)
  • Plasmids (available from Addgene, http://www.addgene.org):
    • pMD2G (encoding the VSV G envelope protein)
    • pRRLSIN.cPPT.PGK‐GFP.WPRE (third‐generation transfer vector, abbreviated “pRRL”)
    • pCMVR8.74 (encoding HIV‐1 Gag, Pol, Tat and Rev proteins)
  • TE buffer, pH 8.0 ( appendix 2A)
  • Sterile water
  • 2.5 M CaCl 2 (see recipe)
  • 2× HeBS (see recipe or use the commercial kit CalPhos Mammalian Transfection/Clontech, cat. no. 631312)
  • 75% (v/v) ethanol in spray bottle
  • Phosphate‐buffered saline (PBS; appendix 2A), 37°C
  • Episerf medium (Invitrogen, cat. no. 10732022; optional, if subsequent experiments require absence of serum)
  • Phosphate‐buffered saline containing Ca2+ and Mg2+ (e.g., Invitrogen; optional, if subsequent experiments require absence of protein)
  • 15‐cm tissue culture dishes (Falcon)
  • 0.45‐µm pore size Stericup, 500 ml HV sterile (Millipore, cat. no. SCHVU05RE)
  • 15‐ and 50‐ml conical centrifuge tubes, sterile
  • 0.22‐µm pore size filters units, 250 ml PES sterile (TPP, cat. no. TPP‐99250)
  • 38.5‐ml 25 × 89–mm Beckman ultraclear ultracentrifuge tubes (Beckman Coulter, cat. no. 344058)
  • Ultracentrifuge with SW 28 rotor (Beckman Coulter or equivalent)
  • Additional reagents and equipment for tissue culture ( appendix 3B) and quantitation of DNA by absorption spectroscopy ( appendix 3K)
CAUTION: Biosafety Level 2 (BSL‐2) practices require that open tubes always be handled in the laminar flow hood. Tubes can be taken out of the laminar flow only when they are closed, and they should be sprayed with 75% ethanol. All solid waste and plasticware must be discarded in a trash bin in the laminar flow hoods and all liquids must be aspirated into a liquid waste bottle containing fresh concentrated bleach. Refill the liquid waste bottle with fresh bleach when the color of the liquid is no longer yellow. Full bags are closed inside the laminar flow hood and then autoclaved. When full, and at least 10 min after neutralization with fresh bleach, the liquid waste bottle can be emptied into a regular sink. In case of a major spill of vector‐containing liquid, absorb liquid with paper towels and neutralize with fresh concentrated bleach prior to disposal. In case there is a leak in the SW 28 buckets centrifuge rotors, remove the tubes in the hood, fill the buckets with 75% ethanol, and invert them several times. Leave under the hood for ≥20 min. Discard the 75% ethanol under the hood.NOTE: All solutions and equipment coming into contact with living cells must be sterile, and proper aseptic technique should be used accordingly.NOTE: All culture incubations should be performed in a humidified, 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 1: Determination of Total Vector Concentration Using Anti‐P24 Immunoassay

  • Lentiviral vector sample for titration (see protocol 1) and positive control (provided with p24 ELISA kit)
  • p24 ELISA kit (Perkin‐Elmer, cat. no. NEK050B001KT) including:
    • 5% Triton‐X solution
    • p24 wash buffer
    • OPD tablets
    • Substrate diluent
    • Stop solution
  • 1.5‐ml microcentrifuge tubes
  • ELISA plate reader with 492‐nm filter

Support Protocol 2: Biological Titration of Lentivectors Using Flow Cytometry

  Materials
  • HCT 116 cells (ATCC, cat. no. CCL‐247)
  • Dulbecco's modified Eagle medium/10% FBS (DMEM‐10; appendix 2A)
  • Lentiviral vector sample for titration, carrying GFP transgene (see the protocol 1)
  • Phosphate‐buffered saline (PBS), pH 7.4 ( appendix 2A)
  • 0.05% trypsin/EDTA (e.g., Invitrogen)
  • 1% (w/v) formaldehyde: dilute 1 ml of 37% formaldehyde (Sigma) in 36 ml PBS ( appendix 2A); store at 4°C
  • 12‐well tissue culture plates (e.g., BD Biosciences)
  • Fluorescence‐activated cell sorter (FACS, Becton Dickinson; with 488‐nm excitation laser and green filter) or equivalent flow cytometer, and appropriate tubes
  • Centrifuge
NOTE: HCT116 are human cells and are commonly used, as they are highly permissive to lentiviral vector‐mediated transduction. Furthermore, their genome is more stable than that of HeLa cells, allowing a more accurate titration by qPCR (see protocol 4).NOTE: All solutions and equipment coming into contact with living cells must be sterile, and aseptic technique should be used accordingly.NOTE: All culture incubations should be performed in a humidified, 37°C, 5% CO 2 incubator unless otherwise specified.

Support Protocol 3: Biological Titration of Lentivectors by Quantitative PCR (qPCR)

  • HCT116 cells (ATCC, cat. no. CCL‐247)
  • Lentiviral vector (LV) sample for titration (see protocol 1) and DNA from positive and negative control cells (see annotation to step 1)
  • pAlb (available from Addgene, http://www.addgene.org), a pRRL vector in which the target sequence of the albumin primers used for normalization has been cloned (this plasmid allows to perform a standard curve)
  • DNAeasy Genomic DNA Extraction Kit (Qiagen)
  • Kit for preparing qPCR master mix (Taqman universal PCR master mix, no AmpErase UNG, Applied Biosystems, cat. no. 4324020), including 2× reaction buffer
  • Primers and probe for Gag, WPRE, and albumin detection (see Table 4.21.1)
  • MicroAmp 96‐well optical reaction plate (Applied Biosystems)
  • Optical adhesive film (Applied Biosystems)
  • Centrifuge with microtiter plate carrier
  • Real‐time PCR machine (e.g., 7900HT Sequence Detector, Applied Biosystems)
  • Computer running SDS7900HT software (Applied Biosystems) and Microsoft Excel
  • Additional reagents and equipment for transducing HCT116 cells with lentivectors ( protocol 3)
    Table 4.1.1   Additional Materials (also see protocol 3)   Additional MaterialsPrimers and Probes for Lentivectors' Titration by qPCR

    Sequence detected Primer/probe name Primer/probe sequence Probe fluorophores
    Gag Gag_forward GGAGCTAGAACGATTCGCAGTTA
    Gag_reverse GGTGTAGCTGTCCCAGTATTTGTC
    Gag_probe ACAGCCTTCTGATGTTTCTAACAGGCCAGG FAM‐BHQ
    WPRE WPRE_forward GGCACTGACAATTCCGTGGT
    WPRE_reverse AGGGACGTAGCAGAAGGACG
    WPRE_probe ACGTCCTTTCCATGGCTGCTCGC FAM‐BHQ
    Albumin Alb_forward GCTGTCATCTCTTGTGGGCTGT
    Alb_reverse ACTCATGGGAGCTGCTGGTTC
    Alb_probe CCTGTCATGCCCACACAAATCTCTCC FAM‐BHQ

NOTE: Gag oligos are used for amplification of HIV‐1‐derived vector sequences and are specific for the 5′ end of the gag gene. This sequence is present in all HIV‐1 vectors, as it is part of the extended packaging signal. WPRE oligos amplify the WPRE sequence present in almost all later‐generation LV vectors (see the section). Alb oligos are used to normalize for the amount of genomic DNA and are specific for the human albumin gene.NOTE: Stocks of probes and primers usually come lyophilized and are diluted to 10 µM in water.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bieniasz, P.D. 2004. Intrinsic immunity: A front‐line defense against viral attack. Nat. Immunol. 5:1109‐1115.
   Bovia, F., Salmon, P., Matthes, T., Kvell, K., Nguyen, T.H., Werner‐Favre, C., Barnet, M., Nagy, M., Leuba, F., Arrighi, J.F., Piguet, V., Trono, D., and Zubler, R.H. 2003. Efficient transduction of primary human B lymphocytes and nondividing myeloma B cells with HIV‐1‐derived lentiviral vectors. Blood 101:1727‐1733.
   Dull, T., Zufferey, R., Kelly, M., Mandel, R.J., Nguyen, M., Trono, D., and Naldini, L. 1998. A third‐generation lentivirus vector with a conditional packaging system. J. Virol. 72:8463‐8471.
   Escarpe, P., Zayek, N., Chin, P., Borellini, F., Zufferey, R., Veres, G., and Kiermer, V. 2003. Development of a sensitive assay for detection of replication‐competent recombinant lentivirus in large‐scale HIV‐based vector preparations. Mol. Ther. 8:332‐341.
   Follenzi, A., Ailles, L.E., Bakovic, S., Geuna, M., and Naldini, L. 2000. Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV‐1 pol sequences. Nat. Genet. 25:217‐222.
   Kostic, C., Chiodini, F., Salmon, P., Wiznerowicz, M., Deglon, N., Hornfeld, D., Trono, D., Aebischer, P., Schorderet, D.F., Munier, F.L., and Arsenijevic, Y. 2003. Activity analysis of housekeeping promoters using self‐inactivating lentiviral vector delivery into the mouse retina. Gene Ther. 10:818‐821.
   Lois, C., Hong, E.J., Pease, S., Brown, E.J., and Baltimore, D. 2002. Germline transmission and tissue‐specific expression of transgenes delivered by lentiviral vectors. Science 295:868‐872.
   Mangeat, B. and Trono, D. 2005. Lentiviral vectors and antiretroviral intrinsic immunity. Hum. Gene Ther. 16:913‐920.
   Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M., and Trono, D. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263‐267.
   Recillas‐Targa, F., Pikaart, M.J., Burgess‐Beusse, B., Bell, A.C., Litt, M.D., West, A.G., Gaszner, M., and Felsenfeld, G. 2002. Position‐effect protection and enhancer blocking by the chicken beta‐globin insulator are separable activities. Proc. Natl. Acad. Sci. U.S.A. 99:6883‐6888.
   Salmon, P., Kindler, V., Ducrey, O., Chapuis, B., Zubler, R.H., and Trono, D. 2000a. High‐level transgene expression in human hematopoietic progenitors and differentiated blood lineages after transduction with improved lentiviral vectors. Blood 96:3392‐3398.
   Salmon, P., Oberholzer, J., Occhiodoro, T., Morel, P., Lou, J., and Trono, D. 2000b. Reversible immortalization of human primary cells by lentivector‐mediated transfer of specific genes. Mol. Ther. 2:404‐414.
   Wiznerowicz, M. and Trono, D. 2003. Conditional suppression of cellular genes: Lentivirus vector‐mediated drug‐inducible RNA interference. J. Virol. 77:8957‐8961.
   Zennou, V., Petit, C., Guetard, D., Nerhbass, U., Montagnier, L., and Charneau, P. 2000. HIV‐1 genome nuclear import is mediated by a central DNA flap. Cell 101:173‐185.
   Zufferey, R., Nagy, D., Mandel, R.J., Naldini, L., and Trono, D. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotechnol. 15:871‐875.
   Zufferey, R., Dull, T., Mandel, R.J., Bukovsky, A., Quiroz, D., Naldini, L., and Trono, D. 1998. Self‐inactivating lentivirus vector for safe and efficient in vivo gene delivery. J. Virol. 72:9873‐9880.
   Zufferey, R., Donello, J.E., Trono, D., and Hope, T.J. 1999. Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J. Virol. 73:2886‐2892.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library