Gene Transfer into Neural Cells In Vitro Using Adenoviral Vectors

Thomas Southgate1, Kurt M. Kroeger1, Chunyan Liu1, Pedro R. Lowenstein1, Maria G. Castro1

1 Gene Therapeutics Research Institute, Cedars‐Sinai Medical Center and Departments of Medicine and Molecular and Medical Pharmacology, University of California at Los Angeles, Los Angeles, California
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 4.23
DOI:  10.1002/0471142301.ns0423s45
Online Posting Date:  October, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Adenoviral vectors are excellent vehicles to transfer genes into the nervous system due to their ability to transduce dividing and nondividing cells, their ability to be grown to very high titers, and their relatively large insert capacity. Also, adenoviral vectors can sustain very long‐term transgene expression in the CNS of rodents and in neurons and glial cells in culture. Successful gene transfer into the nervous system is dependent on the development, production, and quality control of vector preparations, which need to be of the highest quality. This unit provides protocols to clone, rescue, amplify, and purify first‐generation adenoviral vectors. Detailed quality control assays are provided to ensure that vector preparations are devoid of contamination from replication‐competent adenovirus and lipopolysaccharides. Also included are methodologies related to adenoviral‐mediated gene transfer into neurons and glial cells in culture, and the analysis of transgene expression using immunocytochemistry, enzymatic assays, and fluorescence‐activated cell sorting (FACS) analysis. Curr. Protoc. Neurosci. 45:4.23.1‐4.23.43. © 2008 by John Wiley & Sons, Inc.

Keywords: adenovirus vectors; purification; gene transfer; neurons; glial cells; immunocytochemistry; fluorescence‐activated cell sorting (FACS)

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of Recombinant Adenovirus Vectors by Homologous Recombination
  • Support Protocol 1: Characterization of Recombinant Adenovirus Vectors
  • Support Protocol 2: PCR Analysis of Recombinant Adenoviral DNA
  • Support Protocol 3: Quality Control of Recombinant Adenovirus Vectors: Assays for (1) Lipopolysaccharide Contamination, (2) Replication‐Competent Virus, and (3) Determination of Purity
  • Basic Protocol 2: Infection of Neuronal and Glial Cells in Primary Culture
  • Support Protocol 4: Preparation of Low‐Density Primary Neocortical Neuronal Cultures
  • Support Protocol 5: Preparation of Low‐Density Primary Ventral‐Mesencephalic Cultures
  • Support Protocol 6: Preparation of Neocortical Glial Cultures
  • Support Protocol 7: Three Assays to Detect Transgene Expression Within Infected Neuronal and Glial Cells in Primary Culture: (1) Xgal Staining, (2) Fluorescence Immunocytochemical Staining, and (3) FACS Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of Recombinant Adenovirus Vectors by Homologous Recombination

  Materials
  • Adenoviral transfection plasmid, e.g., pJM17 or pBHG10 (Microbix Biosystems), and shuttle plasmid pMV60 or pAL120 (constructed from plasmid pXCX2; Spessot et al., ; Löwenstein et al., )
  • Plasmid purification system (e.g., Maxi‐prep, QIAGEN)
  • 293 cells (ATCC #1573; ECACC #85120602)
  • 293 cell medium (see recipe), prewarmed to 37°C
  • Low‐Tris/EDTA buffer (LTE; see recipe)
  • 2 M CaCl 2
  • 2× HEPES‐buffered saline (HBS; see recipe)
  • Dulbecco's phosphate‐buffered saline (D‐PBS; CellGro, VWR cat. no. 45000‐082), prewarmed to 37°C
  • Serum‐free MEM, prewarmed
  • TransIT‐293 transfection reagent (Mirus Bio, cat no. MIR2700)
  • 1% Virkon solution (Anachem)
  • Liquid nitrogen
  • Tris·Cl, pH 8.0 ( appendix 2A)
  • 5% (w/v) sodium deoxycholate
  • 2 M MgCl 2
  • 10 mg/ml RNase I
  • DNase I (see recipe)
  • 1.33 and 1.45 g/ml cesium chloride (CsCl) solution (see recipe)
  • 10% (v/v) glycerol
  • 25‐cm2 and 175‐cm2 plastic tissue culture flasks (Corning)
  • 15‐ml and 50‐ml sterile polypropylene conical tubes (Greiner)
  • Sterile flame‐polished Pasteur pipets
  • Automatic pipettor
  • 1.5‐ml screw‐cap microcentrifuge tubes
  • 37°C water bath
  • 24‐well and 96‐well tissue culture plates (Corning)
  • 200‐µl pipet tips
  • 60‐mm tissue culture dish
  • 15‐cm dish
  • 500‐ml sterile polypropylene conical bottle
  • Beckman 14‐ml Ultra‐Clear centrifuge tubes (cat. no. 344060)
  • Serological pipets
  • 5‐ml syringes
  • Wide‐bore needles (18‐G spinal needles; Sherwood Medical)
  • Black permanent marker
  • Beckman ultracentrifuge and SW‐40 rotor
  • Slide‐A‐Lyzer Dialysis Cassette (extra strength; Pierce, cat. no. 66380)
  • Additional reagents and equipment for counting cells using a hemacytometer and culture of mammalian cells ( appendix 3B), characterization of recombinant adenovirus vectors (see protocol 2), and dialysis (CPMB APPENDIX and appendix 1A in this manual)
CAUTION: The following procedures should be carried out in a Class 2 (BCL‐2) tissue culture suite in a Class 2 laminar flow cabinet. All media used should be discarded into a solution of 1% Virkon and all plasticware which has been in contact with the recombinant adenovirus should be washed in a solution of 1% Virkon prior to autoclaving and incineration.

Support Protocol 1: Characterization of Recombinant Adenovirus Vectors

  Materials
  • 293 cells (ATCC #1573, ECACC # 85120602)
  • Recombinant adenovirus (e.g., protocol 1)
  • 293 cell medium (see recipe)
  • Dulbecco's phosphate‐buffered saline (D‐PBS; CellGro, cat. no. 21‐031‐CV), prewarmed to 37°C
  • Virion lysis buffer (see recipe)
  • 5 M NaCl
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol ( appendix 2A)
  • 100% and 70% ethanol
  • Sterilized distilled water
  • RNase Type I‐A (Sigma)
  • Dig DNA labeling and detection kit (Roche)
  • Restriction enzymes appropriate for digesting plasmids of interest
  • Shuttle plasmid containing transgene
  • 1% agarose gel containing ethidium bromide ( appendix 1N)
  • 1‐kb DNA step ladder (Promega)
  • 0.25 M HCl
  • 0.4 M NaOH
  • 0.5× SSC (prepare from 20× stock; appendix 2A)
  • Prehybridization solution (see recipe)
  • Hybridization solution (prehybridization solution containing 5 µl denatured Dig DNA probe for every ml solution), prepare fresh just before use
  • 0.2× SSC (prepare from 20× stock; appendix 2A) containing 0.1% (w/v) SDS
  • 0.02× SSC (prepare from 20× stock; appendix 2A) containing 0.1% (w/v) SDS
  • 0.01× SSC (prepare from 20× stock; appendix 2A) containing 0.1% (w/v) SDS
  • Color buffers 1, 2, 3, and 4 (see reciperecipes)
  • 25‐cm2 tissue culture flasks
  • Screw‐cap microcentrifuge tubes
  • Styrofoam box
  • Nytran nucleic acid and protein transfer membrane, pore size 0.45 µm (Schleicher & Schuell)
  • Plastic bags for hybridization
  • Hybridization oven
  • 95°C water bath or heating block
  • Additional reagents and equipment for DNA extraction ( appendix 1G) and agarose gel electrophoresis ( appendix 1N)
NOTE: This protocol is a modified Hirt procedure (Gluzman and Van Doren, ). For steps 1 to 4, make sure that all solutions are disposed of in 1% Virkon and that all plasticware is autoclaved before disposal.

Support Protocol 2: PCR Analysis of Recombinant Adenoviral DNA

  Materials
  • Primers for IVa2:
    • Forward: 5′‐AAGCAAGTGTCTTGCTGTCT‐3′
    • Reverse: 5′‐GGATGGAACCATTATACCGC‐3′
  • Primers for E1B:
    • Forward: 5′‐CAAGAATCGCCTGCTACTGTTGTC‐3′
    • Reverse: 5′‐CCTATCCTCCGTATCTATCTCCACC‐3′
  • 2% agarose gel ( appendix 1N)
  • Additional reagents and equipment for PCR and agarose gel electrophoresis ( appendix 1N)
NOTE: With all PCR experiments, it is essential that samples and reagents be kept as clean as possible to minimize contamination and DNA degradation. Laboratory coats and clean latex gloves should be worn routinely and procedures to prepare the PCR samples should be undertaken in a laminar flow cabinet.

Support Protocol 3: Quality Control of Recombinant Adenovirus Vectors: Assays for (1) Lipopolysaccharide Contamination, (2) Replication‐Competent Virus, and (3) Determination of Purity

  Materials
  • Recombinant adenovirus preparation to be tested
  • Limulus Amebocyte lysate pyrogen kit (Cambrex, cat. no. 50‐647U)
  • HeLa cells (ATCC #CCL‐2; ECACC #93021013)
  • Maintenance medium (see recipe), prewarmed to 37°C
  • Dulbecco's phosphate‐buffered saline (CellGro, VWR, cat. no. 45000‐434), prewarmed to 37°C
  • Virion lysis buffer (see recipe)
  • Virus storage buffer (see recipe)
  • 175‐cm2 flasks
  • 15‐cm tissue culture dishes
  • 37°C incubator
  • 24‐well tissue culture plate
  • 50‐ml conical tube
  • Screw‐cap microcentrifuge tube
  • 56°C water bath
  • Spectrophotometer

Basic Protocol 2: Infection of Neuronal and Glial Cells in Primary Culture

  Materials
  • Frozen virus ( protocol 1)
  • 1% Virkon
  • Plating medium (see recipe) or VM culture medium (see recipe), prewarmed to 37°C
  • Neocortical glial culture (see protocol 8)
  • Neocortical neuronal culture (see protocol 6)
  • Ventral‐mesencephalic (VM) culture (see protocol 7)
  • Dulbecco's phosphate‐buffered saline (D‐PBS; CellGro, VWR, cat. no. 45000‐434), prewarmed to 37°C
  • 37°C water bath
  • Autoclave

Support Protocol 4: Preparation of Low‐Density Primary Neocortical Neuronal Cultures

  Materials
  • Pregnant rat (E17‐18)
  • 70% ethanol
  • Hanks’ balanced salt solution, calcium‐ and magnesium‐free (CMF‐HBSS; CellGro, VWR, cat. no. 45000‐458), ice‐cold (sterile)
  • 1 M HEPES buffer solution (CellGro, VWR, cat. no. 45000‐690)
  • 0.05% (w/v) trypsin/0.02% (w/v) EDTA (CellGro, VWR, cat. no. 45000‐082)
  • Plating medium (see recipe), prewarmed to 37°C
  • Sterile dissecting equipment
  • Petri dishes
  • Dissection microscope (e.g., Leica)
  • 15‐ and 50‐ml polypropylene conical tubes
  • 37°C incubator
  • Sterile flame‐polished glass Pasteur pipets
  • 70‐µm nylon cell strainer
  • 35‐mm well diameter tissue culture plates
  • Poly‐L‐lysine coated 22‐mm2 glass coverslips (see recipe)
  • Additional reagents and equipment for counting cells using a hemacytometer and mammalian cell tissue culture ( appendix 3B)

Support Protocol 5: Preparation of Low‐Density Primary Ventral‐Mesencephalic Cultures

  Materials
  • Pregnant rat (E14)
  • 70% ethanol
  • Hanks’ balanced salt solution, calcium‐ and magnesium‐free (CMF‐HBSS; CellGro, VWR, cat. no. 45000‐458), ice‐cold (sterile)
  • 1 M HEPES buffer solution (CellGro, VWR, cat. no. 45000‐690)
  • 0.05% (w/v) trypsin/0.02% (w/v) EDTA (CellGro, VWR, cat. no. 45000‐082)
  • VM culture medium (see recipe)
  • Sterile dissecting equipment
  • Petri dishes
  • Dissection microscope (e.g., Leica)
  • 29‐G, 0.5‐in. needles
  • 15‐ml conical polypropylene tube
  • Sterile flame‐polished glass Pasteur pipets
  • 70‐µm nylon cell strainer
  • 22‐mm well diameter tissue culture plates
  • Poly‐L‐ornithine and laminin coated 16‐mm diameter glass coverslips (see recipe)
  • Additional reagents and equipment for counting cells using a hemacytometer and mammalian cell tissue culture ( appendix 3B)

Support Protocol 6: Preparation of Neocortical Glial Cultures

  Materials
  • 0‐ to 3‐day‐old rat pups
  • 100% ethanol
  • Hanks’ balanced salt solution, calcium‐ and magnesium‐free (CMF‐HBSS; CellGro, VWR, cat. no. 45000‐458), ice‐cold (sterile)
  • 1 M HEPES buffer solution (CellGro, VWR, cat. no. 45000‐690)
  • Plating medium (see recipe), prewarmed to 37°C
  • Sterile dissecting equipment, including fine curved forceps
  • Dissection microscope (e.g., Leica)
  • 15‐ and 50‐ml conical polypropylene tubes
  • Sterile flame‐polished glass Pasteur pipets
  • 70‐µm nylon cell strainer
  • Centrifuge
  • 35‐mm well diameter tissue culture plates
  • Poly‐L‐ornithine/laminin‐coated 22‐mm2 coverslips (see recipe)
  • Additional reagents and equipment for counting cells using a hemacytometer and mammalian cell tissue culture ( appendix 3B)

Support Protocol 7: Three Assays to Detect Transgene Expression Within Infected Neuronal and Glial Cells in Primary Culture: (1) Xgal Staining, (2) Fluorescence Immunocytochemical Staining, and (3) FACS Analysis

  Materials
  • Infected cells in primary culture
  • Dulbecco's phosphate‐buffered saline (D‐PBS; CellGro, VWR, cat. no. 45000‐434), prewarmed to 37°C
  • 1% Virkon
  • 4% paraformaldehyde solution (see recipe)
  • Phosphate‐buffered saline (PBS; see recipe)
  • 0.3% (v/v) Triton X‐100 in PBS
  • Xgal staining solution (see recipe) containing 1 mg/ml 5‐bromo‐4‐chloro‐3‐indoyl β‐D‐galactopyranoside (Xgal; Sigma) in dimethyl sulfoxide (DMSO)
  • Tris‐buffered saline (TBS; see recipe)
  • Mowiol 4‐88 mounting solution (see recipe)
  • 10 mM sodium citrate, pH 6.0
  • 0.5 mg/ml sodium borohydride
  • 50 mM ammonium chloride
  • 10% and 1% (v/v) normal blocking serum (preferably from species in which secondary antibody was raised) in PBS
  • Primary antibody
  • Fluorescent secondary antibody labeled with Alexa‐Fluor 488 or Alexa‐Fluor 488 (Molecular Probes)
  • Pro‐Long Gold Anti‐Fade Reagent (Molecular Probes, cat. no. P36930)
  • 0.05% (w/v) trypsin/ 0.02% (w/v) EDTA (CellGro, VWR, cat. no. 45000‐082)
  • Plating medium (see recipe), ice‐cold
  • FACS staining buffer (see recipe)
  • FACS permeabilizing buffer (see recipe)
  • Parafilm
  • Humidified chamber (e.g., sealable box containing a damp tissue)
  • Fine forceps
  • 12‐well plate
  • Glass slides
  • Epifluorescence microscope
  • 35‐mm tissue culture plates
  • Polypropylene centrifuge tubes suitable for fluorescence‐activated cell sorting (different machines require different tubes so check with FACS manufacturer)
  • Centrifuge
  • Fluorescence‐activated cell sorter (Becton Dickenson)15‐ml and 50‐ml polypropylene conical tubes
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Barcia, C., Thomas, C.E., Curtin, J.F., King, G.D., Wawrowsky, K., Candolfi, M., Xiong, W.D., Liu, C., Kroeger, K., Boyer, O., Kupiec‐Weglinski, J., Klatzmann, D., Castro, M.G., and Löwenstein, P.R. 2006. In vivo mature immunological synapses forming SMACs mediate clearance of virally infected astrocytes from the brain. J. Exp. Med. 203:2095‐107.
   Bett, A.J., Haddara, W., Prevec, L., and Graham, F.L. 1994. An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc. Natl. Acad. Sci. U.S.A. 91:8803‐8806.
   Berkner, K.L. and Sharp, P.A., 1983. Generation of adenovirus by cotransfection of plasmids. Nucleic Acids Res. 11:6003‐6020.
   Berkner, K.L. and Sharp, P.A., 1984. Expression of dihydrofolate reductase, and of the adjacent E1b region, in an Ad5‐dihydrofolate reductase recombinant virus. Nucleic Acids Res. 12:1925‐1941.
   Burlingham, B.T., Brown, D.T., and Doerfler, W. 1974. Incomplete particles of adenovirus. I. Characteristics of the DNA associated with incomplete adenovirions of types 2 and 12. Virology 60:419‐430.
   Candolfi, M., Curtin, J.F., Xiong, W.D., Kroeger, K.M., Liu, C., Rentsendorj, A., Agadjanian, H., Medina‐Kauwe, L., Palmer, D., Ng, P., Löwenstein, P.R., and Castro, M.G. 2006. Effective high‐capacity gutless adenoviral vectors mediate transgene expression in human glioma cells. Mol. Ther. 14:371‐381.
   Candolfi, M., Pluhar, G.E., Kroeger, K., Puntel, M., Curtin, J., Barcia, C., Muhammad, A.K, Xiong, W., Liu, C., Mondkar, S., Kuoy, W., Kang, T., McNeil, E.A., Freese, A.B., Ohlfest, J.R., Moore, P., Palmer, D., Ng, P., Young, J.D., Löwenstein, P.R., and Castro, M.G. 2007. Optimization of adenoviral vector‐mediated transgene expression in the canine brain in vivo, and in canine glioma cells in vitro. Neuro. Oncol. 9:245‐258.
   Cartmell, T., Southgate, T.D., Rees, G.S., Castro, M.G., Löwenstein, P.R., and Luheshi, G.N. 1999. Interleukin‐1 mediates a rapid inflammatory response after injection of adenoviral vectors in the brain. J. Neurosci. 19:1517‐1523.
   Chartier, C., Degryse, E., Gantzer, M., Dieterle, A., Pavirani, A., and Mehtali, M. 1996. Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coli. J. Virol. 70:4805‐4810.
   Cowsill, C., Southgate, T.D., Morrissey G., Dewey, R.A., Morelli, A.E., Maleniak, T.C., Forrest, Z., Klatzmann, D., Wilkinson, G.W.G., Löwenstein, P.R., and Castro, M.G. 2000. Central nervous system toxicity of two adenoviral vectors encoding variants of the herpes simplex virus type 1 thymidine kinase: Reduced cytotoxicity of a truncated HSV1‐TK. Gene Ther. 7:679‐685.
   Dewey, R.A., Morrissey, G., Cowsill, C.M., Stone, D., Bolognani, F., Dodd, N.J.F., Southgate, T.D., Klatzmann, D., Lassmann, H., Castro, M.G., and Löwenstein. P.R. 1999. Chronic brain inflammation and persistent HSV1‐TK expression in survivors of syngeneic glioma treated by adenovus‐mediated gene therapy: Implications for clinical trials. Nat. Med. 5:1256‐1263.
   Dion, L.D., Fang, J., and Garver, R.I. 1996. Supernatant rescue assay vs. polymerase chain reaction for detection of wild type adenovirus‐containing recombinant adenovirus stocks. J. Virol. Methods 56:99‐107.
   Easton, R.M., Johnson, E.M., and Creedon, D.J. 1998. Analysis of events leading to neuronal death after infection with E1‐deficient adenovirus vectors. Mol. Cell. Neurosci. 11:334‐347.
   Fallaux, F.J., Kranenburg, O., Cramer, S.J., Houweling, A., van Ormondt, H., Hoeben, R.C., and van der Eb, A.J. 1996. Characterization of 911: A new helper cell line for the titration and propagation of early region 1‐deleted adenoviral vectors. Hum. Gene Ther. 7:215‐222.
   Fallaux, F.J., Bout, A., van der Velde, I., van den Wollenberg, D.J.M., Hehir, K.M., Keegan, J., Auger, C., Cramer, S.J., van Ormondt, H., van der Eb, A.J., Valerio, D., and Hoeben, R.C. 1998. New helper cells and matched early region 1‐deleted adenovirus vectors prevent generation of replication‐competent adenoviruses. Hum. Gene Ther. 9:1909‐1917.
   Gluzman, Y. and Van Doren, K. 1983. Palindromic adenovirus type 5‐SV40 hybrid. J. Virol. 45:91‐103.
   Gossen, M. and Bujard, H., 1992. Tight control of gene expression in mammalian cells by tetracycline‐responsive promoters. Proc. Natl. Acad. Sci. U.S.A. 89:5547‐5551.
   Graham, F.L., Smiley, J., Russell, W.C., and Nairu, R. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 68:937‐940.
   Hehir, K.M., Armenatano, D., Cardoza, L.M., Choquette, T.L., Berthelette, P.B., White, G.A., Couture, L.A., Everton, M.B., Keegan, J., Martin, J.M., Pratt, D.A., Smith, M.P., Smith, A.E., and Wadsworth, S.C. 1996. Molecular characterization of replication‐competent variants of adenovirus vectors and genome modifications to prevent their occurrence. J. Virol. 70:8459‐8467.
   Imler, J.‐L., Chartier, C., Dreyer, D., Sainte‐Marie, M., Faure, T., Pavirani, A., and Mehtali, M. 1996. Novel complementation cell lines derived from human lung carcinoma A549 cells support the growth of E1‐deleted adenovirus vectors. Gene Ther. 3:75‐84.
   Ketner, G., Spencer, F., Tugendrreich, S., Connely, C., and Hieter, P. 1994. Efficient manipulation of the human adenovirus genome as an infectious yeast artificial chromosome clone. Proc. Natl. Acad. Sci. U.S.A. 91:6186‐6190.
   Krougliak, V. and Graham, F.L. 1995. Development of cell lines capable of complementing E1, E4, and protein IX defective adenovirus type 5 mutants. Hum. Gene Ther. 6:1575‐1586.
   Lavoie, J.N., Champagne, C., Gingras, M.C., and Robert, A. 2000. Adenovirus E4 open reading frame 4‐induced apoptosis involves dysregulation of Src family kinases. J. Cell Biol. 150:1037‐1056.
   Liebermann, H. and Mentel, R. 1994. Quantification of adenovirus particles. J. Virol. Methods 50:281‐291.
   Lochmuller, H., Jani, A., Huard, J., Prescot, S., Simoneau, M., Massie, B., Karpati, G, and Acsadi, G. 1994. Emergence of early region 1‐containing replication‐competent adenovirus in stocks of replication‐defective adenovirus recombinants (delta E1 + delta E3) during multiple passages in 293 cells. Hum. Gene Ther. 5:1485‐1491.
   Louis, N., Evelegh, C., and Graham, F.L. 1997. Cloning and sequencing of the cellular‐viral junctions from the human adenovirus type 5 transformed 293 cell line. Virology 233:423‐429.
   Löwenstein, P.R., Shering, A., Bain, D., Castro, M.G., and Wilkinson, G.W.G. 1996. The use of adenovirus vectors to transfer genes to identified target brain cells in vitro. In Protocols for Gene Transfer in Neuroscience: Towards Gene Therapy of Neurological Disorders. (P.R. Löwenstein and L.W. Enquist, eds.) pp. 93‐114. John Wiley & Sons, Chichester, U.K.
   Mahr, A.J. and Gooding, L.R. 1999. Immune evasion by adenoviruses. Immunol. Rev. 168:121‐130.
   McVey, D., Zuber, M., Ettyreddy, D., Brough, D.E., and Kovesdi, I. 2002. Rapid construction of adenoviral vectors by lambda phage genetics. J. Virol. 76:3670‐3677.
   Morelli, A.E., Larregina, A.T., Smith‐Arica, J., Dewey, R.A., Southgate, T.D., Ambar, B., Fontana, A., Castro, M.G., and Löwenstein, P.R. 1999. Neuronal and glial cell type‐specific promoters within adenovirus recombinants restrict the expression of the apoptosis‐inducing molecule Fas ligand to predetermined brain cell types, and abolish peripheral liver toxicity. J. Gen. Virol. 80:571‐583.
   Ng, P. and Graham F.L. 2002. Construction of first generation adenoviral vectors. Methods Mol. Med. 69:389‐414.
   Noble, M. and Mayer‐Proschel, M. 1998. Culture of astrocytes, oligodendrocytes and O‐2A progenitor cells. In Culturing Nerve Cells: Cellular and Molecular Neuroscience. (G. Banker and K. Goslin, eds.) pp. 499‐543. MIT Press, Cambridge, Mass.
   Palmer, D.J. and Ng, P. 2003. Improved system for helper‐dependent adenoviral vector production. Mol. Ther. 8:846‐852.
   Parks, R.J., Chen, L., Anton, M., Sankar, U., Rudnicki, M.A., and Graham, F.L. 1996. A helper‐dependent adenovirus vector system: Removal of helper virus by Cre‐mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. U.S.A. 93:13565‐13570.
   Paxinos, G., Ashwell, K.W.S., and Tork, I. 1994. Atlas of the Developing Rat Nervous System. Academic Press, San Diego.
   Puntel, M., Curtin, J.F, Zirger, J.M., Muhammad, A.K., Xiong, W., Liu, C., Hu, J., Kroeger, K.M., Czer, P., Sciascia, S., Mondkar, S., Löwenstein, P.R., and Castro, M.G. 2006. Quantification of high‐capacity helper‐dependent adenoviral vector genomes in vitro and in vivo, using quantitative TaqMan real‐time polymerase chain reaction. Hum. Gene Ther. 17:531‐544.
   Revah, F., Horellou, P., Vigne, E., Le Gal La Salle, G., Robert, J.J., Perricaudet, M., and Mallet, J. 1996. Gene transfer into the central and peripheral nervous system using adenoviral vectors. In Protocols for Gene Transfer in Neuroscience: Towards Gene Therapy of Neurological Disorders. (P.R. Löwenstein and L.W. Enquist, eds.) pp. 81‐92. John Wiley & Sons, Chichester, U.K.
   Shering, A.F., Bain, D., Stewart, K., Epstein, A.L., Castro, M.G., Wilkinson, G.W.G., and Löwenstein, P.R. 1997. Cell type‐specific expression in brain cell cultures from a short human cytomegalovirus major immediate early promoter depends on whether it is inserted into herpesvirus or adenovirus vectors. J. Gen. Virol. 78:445‐459.
   Smith‐Arica, J.R., Morelli, A.E., Larregina, A.T., Smith, J., Löwenstein, P.R., and Castro, M.G. 2000. Cell‐type‐specific and regulatable transgenesis in the adult brain: Adenovirus‐encoded combined transcriptional targeting and inducible transgene expression. Mol. Ther. 2:579‐587.
   Spessot, R., Inchley, K., Hupel, T.M., and Bacchetti, S. 1989. Cloning of the herpes‐simplex virus ICP4 gene in an adenovirus vector‐effects on adenovirus gene‐expression and replication. Virology 168:378‐387.
   Thomas, C.E., Birkett, D., Anozie, I., Castro, M.G., and Löwenstein, P.R. 2001. Acute direct adenoviral vector cytotoxicity and chronic, but not acute, inflammatory responses correlate with decreased vector‐mediated transgene expression in the brain. Mol. Ther. 3:36‐46.
   Tollefson, A.E., Hermiston, T.W., and Wold, W.S.M., 1999. Preparation and titration of CsCl‐banded adenovirus stock. In Adenovirus Methods and Protocols (W.S.M. Wold, ed.) pp. 1‐9. Humana Press, Totowa, N.J.
   Wilkinson, G.W.G. and Akrigg, A. 1992. Constitutive and enhanced expression from the CMV major IE promoter in a defective adenovirus vector. Nucleic Acid Res. 20:2233‐2239.
   Windeatt, S., Southgate, T.D., Dewey, R.A., Bolognani, F., Perone, M.J., Larregina, A.T., Maleniak, T.C., Morris, I.D., Goya, R.G., Klatzmann, D., Löwenstein, P.R., and Castro, M.G., 2000. Adenovirus‐mediated Herpes simplex virus type‐1 thymidine kinase (HSV1‐TK) gene therapy suppresses oestrogen induced pituitary prolactinomas. J. Clin. Endo. Metab. 85:1296‐1305.
   Xiong, W., Goverdhana, S., Sciascia, S.A., Candolfi, M., Zirger, J.M., Barcia, C., Curtin, J.F., King, G.D., Jaita, G., Liu, C., Kroeger, K., Agadjanian, H., Medina‐Kauwe, L., Palmer, D., Ng, P., Löwenstein, P.R., and Castro, M.G. 2006. Regulatable gutless adenovirus vectors sustain inducible transgene expression in the brain in the presence of an immune response against adenoviruses. J. Virol. 80:27‐37.
   Zirger, J.M., Barcia, C., Liu, C., Puntel, M., Mitchell, N., Campbell, I., Castro, M., and Löwenstein, P.R. 2006. Rapid upregulation of interferon‐regulated and chemokine mRNAs upon injection of 108 international units, but not lower doses, of adenoviral vectors into the brain. J. Virol. 80:5655‐5659.
Key References
   Graham et al., 1977. See above.
  This paper demonstrates the transformation of the human embryonic kidney cell line with adenoviral DNA, as described in this unit.
   Berkner and Sharp, 1983. See above.
  Paper in which Berkner first discussed the use of adenoviruses as “cloning vehicles” for gene transfer, and her system for generating adenoviruses by cotransfection of plasmids.
   Berkner and Sharp, 1984. See above.
  The first generation of a recombinant adenovirus expressing a heterologous gene.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library