Gene Transfer into Rat Brain Using Adenoviral Vectors

Mariana Puntel1, Kurt M. Kroeger1, Nicholas S.R. Sanderson1, Clare E. Thomas1, Maria G. Castro1, Pedro R. Lowenstein1

1 Board of Governors' Gene Therapeutics Research Institute, Departments of Medicine and Biomedical Sciences, Cedars‐Sinai Medical Center and Departments of Medicine, and Molecular and Medical Pharmacology, Jonsson Comprehensive Cancer Center, Brain Research Institute, David Geffen School of Medicine, University of California Los Angeles, Los Angeles, California
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 4.24
DOI:  10.1002/0471142301.ns0424s50
Online Posting Date:  January, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Viral vector–mediated gene delivery is an attractive procedure for introducing genes into the brain, both for purposes of basic neuroscience research and to develop gene therapy for neurological diseases. Replication‐defective adenoviruses possess many features which make them ideal vectors for this purpose—efficiently transducing terminally differentiated cells such as neurons and glial cells, resulting in high levels of transgene expression in vivo. Also, in the absence of anti‐adenovirus immunity, these vectors can sustain very long‐term transgene expression within the brain parenchyma. This unit provides protocols for the stereotactic injection of adenoviral vectors into the brain, followed by protocols to detect transgene expression or infiltrates of immune cells by immunocytochemistry or immunofluorescence. ELISPOT and neutralizing antibody assay methodologies are provided to quantitate the levels of cellular and humoral immune responses against adenoviruses. Quantitation of adenoviral vector genomes within the rat brain using qPCR is also described. Curr. Protoc. Neurosci. 50:4.24.1‐4.24.49. © 2010 by John Wiley & Sons, Inc.

Keywords: viral vectors; gene therapy; immune response; T cells; B cells; brain inflammation; macrophages; gene transfer; immunocytochemistry; qPCR; ELISPOT assay; adenovirus

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: In Vivo Adenovirus‐Mediated Gene Transfer into the CNS of Adult Rats
  • Basic Protocol 2: Evaluation of Gene Transfer, Inflammatory Responses, and Vector‐Mediated Toxicity Following In Vivo Administration of Recombinant Adenovirus Vectors
  • Alternate Protocol 1: Fluorescence‐Based Immunohistochemical Staining of Brain Sections
  • Basic Protocol 3: Simultaneous Evaluation of Vector‐Induced Inflammation and Demyelination with Luxol Fast Blue and Cresyl Violet
  • Basic Protocol 4: Evaluation of Vector‐Mediated Toxicity by Toluidine Blue Staining
  • Basic Protocol 5: Detection of Vector Genomes in Rat Brains by Quantitative PCR
  • Basic Protocol 6: Assessment of Blood‐Brain Barrier Integrity in the Rat Brain
  • Basic Protocol 7: Activation of a Strong Anti‐Viral Immune Response by Intradermal Administration of Adenovirus Vector
  • Basic Protocol 8: Assessment of Anti‐Adenovirus Neutralizing Antibodies
  • Basic Protocol 9: Assessment of the Frequency of Anti‐Adenovirus‐Specific IFN‐γ‐Secreting Lymphocytes
  • Support Protocol 1: Perfusion, Fixation, and Sectioning of Brain Tissue
  • Support Protocol 2: Preparation of Gelatin or APES‐Coated Slides
  • Support Protocol 3: Transport of Recombinant Adenoviral Vectors on Dry Ice
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: In Vivo Adenovirus‐Mediated Gene Transfer into the CNS of Adult Rats

  Materials
  • Adenoviral vector (unit 4.23)
  • Dulbecco's PBS, pH 7.4, without Ca or Mg (Cellgro, cat. no. 21‐031 CV)
  • Adult rat (250 g body weight; rats 200 to 350 g may be fitted into the frame; however the stereotactic coordinates may not be accurate with larger or smaller animals, since standard atlases illustrate the brain of 250‐g rats)
  • Anesthetics and analgesics (also see appendix 4B)
    • Ketamine
    • Dexmedetomidine (Orion Corp., http://www.orion.fi/)
    • Carprofen (Hospira, http://www.hospira.com/)
    • Xylazine
    • Atipamezole (Antisedan; Orion Corp., http://www.orion.fi/)
    • Buprenorphine (Buprenex)
  • Betadine (povidone‐iodine)
  • Ophthalmic ointment (Puralube)
  • Lactated Ringer's solution
  • Rat chow
  • Oxygenated Tyrode's solution with heparin (see recipe)
  • 4% (w/v) paraformaldehyde in PBS
  • Stereotactic frame with rat adapter and blunt ear bars (Stoelting)
  • Stereomicroscope (e.g., Zeiss Stemi 1000 zoom) equipped with 16× eyepieces and 0.4× auxiliary objective lens, and mounted on hinged coupling arm on a heavy foot stand (or equivalent)
  • Electric drill with 1.75‐mm drill bit (Stoelting)
  • Heat pad
  • Fiber‐optic illuminator with twin goose‐neck pipes (Leica)
  • Surgical equipment, sterile:
    • Surgical shavers (Stoelting)
    • Scalpel and blades
    • Skin retractors
    • Cotton swabs
    • Curved and straight forceps
    • Holding scissors
    • Sharp scissors
    • Sterile gauze
  • 10‐µl, 26‐G Hamilton syringe with needle (model 701RN, Fisher)
  • 3–0 nylon sutures
  • Petri dish, plastic
  • Additional reagents and equipment for rodent anesthesia ( appendix 4B) and perfusion ( protocol 11)

Basic Protocol 2: Evaluation of Gene Transfer, Inflammatory Responses, and Vector‐Mediated Toxicity Following In Vivo Administration of Recombinant Adenovirus Vectors

  Materials
  • Brain sections (see protocol 11)
  • TBS/Triton: Tris‐buffered saline (TBS; appendix 2A) containing 0.5% (v/v) Triton X‐100
  • Citrate buffer (optional; 10 mM citric acid in H 2O, adjusted to pH 6 with 0.1 N NaOH), prewarmed to 60°C
  • 0.3% (v/v) H 2O 2 in PBS
  • TBS/Triton (see above) containing 10% horse serum (TBS/Triton/10% HS)
  • Primary antibody recognizing epitope of interest (e.g., transgene or immune cell marker)
  • TBS/Triton/1% HS (see above) with 0.1% (w/v) sodium azide
  • Biotinylated secondary antibody (biotinylated antibody against immunoglobulin of species in which primary antibody was raised)
  • Vectastain ABC Elite kit (Vector Laboratories)
  • Dulbecco's PBS, pH 7.4, without Ca or Mg (Cellgro, cat. no. 21‐031 CV)
  • 0.1 M sodium acetate, pH 6.0
  • DAB staining solution (see recipe)
  • Soft‐bristled paintbrush
  • 6‐well tissue culture plates
  • Platform shaker
  • Gelatin‐coated glass slides (unit 1.1)
  • Additional reagents and equipment for dehydrating and coverslipping sections (unit 1.2)

Alternate Protocol 1: Fluorescence‐Based Immunohistochemical Staining of Brain Sections

  • Blocking serum (from the species in which the secondary antibodies were generated)
  • Two primary antibodies recognizing epitopes of interest, generated in different species
  • Appropriate secondary antibodies labeled with two different fluorescent markers (e.g., Alexa 488 and Alexa 594)
  • Prolong‐Gold Antifade Reagent (Invitrogen, cat. no. P36930)
  • Fluorescence microscope

Basic Protocol 3: Simultaneous Evaluation of Vector‐Induced Inflammation and Demyelination with Luxol Fast Blue and Cresyl Violet

  Materials
  • Free‐floating Vibratome‐cut brain sections (see protocol 11)
  • 50%, 70%, 80%, and 96% ethanol
  • Luxol fast blue (LFB) solution (see recipe)
  • 95% methylated spirits
  • 0.05% (w/v) lithium carbonate
  • 0.1% (w/v) cresyl violet in 1% (v/v) acetic acid
  • APES‐coated glass slides (see protocol 12)
  • 60°C oven
  • Additional reagents and equipment for mounting sections on slides (see protocol 2, step 17) and dehydrating and coverslipping sections (unit 1.2)

Basic Protocol 4: Evaluation of Vector‐Mediated Toxicity by Toluidine Blue Staining

  Materials
  • 1% toluidine blue (see recipe)
  • Semi‐thin plastic embedded 5‐µm brain sections (see unit 1.2) mounted on gelatin‐coated (see unit 1.1) or APES‐coated (see protocol 12) glass slides
  • Additional reagents and equipment for dehydrating and coverslipping sections (unit 1.2)

Basic Protocol 5: Detection of Vector Genomes in Rat Brains by Quantitative PCR

  Materials
  • Brains from rats perfused without fixative (see protocol 11)
  • DNeasy Blood and Tissue Kit (Qiagen, cat. no. 69506)
  • 100% and 70% ethanol, molecular biology grade
  • Adenovirus L3 primer/probe set (consists of custom‐made oligos synthesized, e.g., by Operon or Eurofins; see Puntel et al., ):
    • 1 nmol/µl forward primer: 5′‐GAGTTGGCACCCCTATTCGA‐3′
    • 1 nmol/µl reverse primer: 5′‐ATGCCACATCCGTTGACTTG‐3′
    • 100 pmol probe: 6‐VIC‐5′‐CCACCCGTGTGTACCTGGTGGACA‐3′‐TAMRA
    • 2× QuantiTect Probe PCR Master Mix (Qiagen)
  • DEPC‐treated H 2O (Fluka)
  • Standard plasmid containing the target sequence (e.g., pSt) for preparing standard curve (also see Puntel et al., )
  • 1‐mm Alto rat brain acrylic matrix (CellPoint Scientific)
  • Digital single‐channel and multichannel pipet (Eppendorf) with aerosol‐barrier tips and sterile disposable solution basins
  • Sterile 96‐well PCR plates
  • Optical support base (Applied Biosystems, cat. no. 4308775)
  • Optical adhesive cover (Applied Biosystems, cat. no. 431171)
  • Compression pad (Applied Biosystems, cat. no. 431171)
  • SDS Enterprise Database software (Applied Biosystems)
  • Real Time Quantitative PCR instrument (Applied Biosystems)
  • Beckman Allegra 6R centrifuge/GH 3.8A rotor with microplate adaptor

Basic Protocol 6: Assessment of Blood‐Brain Barrier Integrity in the Rat Brain

  Materials
  • Horseradish peroxidase (HRP; Type II; Sigma)
  • Normal saline: 0.9% (w/v) NaCl, sterile
  • Adult rat
  • Dulbecco's PBS, pH 7.4, without Ca or Mg (Cellgro, cat. no. 21‐031 CV)
  • Hanker‐Yates solution A (see recipe)
  • Hanker‐Yates solution B (see recipe)
  • Towel or other restraining device for rats
  • 0.5‐µl microfine disposable needle–fitted syringe (e.g., 0.3‐mm × 12.7‐mm, Becton, Dickinson)
  • 6‐well tissue culture dishes
  • Platform shaker
  • Gelatin‐coated slides (unit 1.1)
  • Additional reagents and equipment for perfusion fixation and Vibratome sectioning (see protocol 11 and unit 1.1) and mounting with DPX mountant (unit 1.2, protocol 1, steps 27 to 31)

Basic Protocol 7: Activation of a Strong Anti‐Viral Immune Response by Intradermal Administration of Adenovirus Vector

  Materials
  • Adult rat
  • Normal saline: 0.9% (w/v) NaCl, sterile
  • Adenoviral vector aliquots in 0.5‐ml microcentrifuge tubes on ice: each tube should contain 100 µl of vector diluted in 0.9% (w/v) NaCl such that each 100 µl contains 5 × 108 infectious units of vector
  • Gas anesthetic trolley with the following components:
    • Isoflurane gas anesthetic
    • Isoflurane vaporizer (e.g., Fluotec; GE Healthcare)
    • Medical oxygen cylinder
    • Medical nitrous oxide cylinder
    • Induction chamber
    • Isoflurane scavenger (e.g., Fluovac; Harvard Apparatus)
  • Desiccator jar (optional)
  • Surgical shavers (Stoelting)
  • Gauze surgical swabs
  • 1.0 ml microfine disposable needle–fitted syringe (e.g., 0.3 mm × 12.7‐mm, Becton, Dickinson)

Basic Protocol 8: Assessment of Anti‐Adenovirus Neutralizing Antibodies

  Materials
  • Adult immunized rats ( protocol 8)
  • 293 HEK cells (ATCC no. CRL‐1573)
  • 293 cell complete medium (see recipe)
  • Well characterized positive and negative plasma, to be used as assay controls
  • Ad‐hCMV‐lacZ (first‐generation adenovirus expressing β‐galactosidase; prepare by co‐transfection of 293 cells with the shuttle vector pAL119‐LacZ and pJM17, as described in unit 4.23)
  • Dulbecco's PBS, pH 7.4, without Ca or Mg (Cellgro, cat. no. 21‐031 CV)
  • 4% (w/v) paraformaldehyde in PBS
  • Gas anesthetic trolley with the following components:
    • Isoflurane gas anesthetic
    • Isoflurane vaporizer (e.g., Fluotec; GE Healthcare)
    • Medical oxygen cylinder
    • Medical nitrous oxide cylinder
    • Induction chamber
    • Isoflurane scavenger (e.g., Fluovac; Harvard Apparatus)
  • Desiccator jar (optional)
  • Heparinized capillary tube
  • Gauze pad
  • Vacutainer tubes (BD Biosciences, cat. no. 367981, optional)
  • Sterile 96‐well tissue culture plates
  • Additional reagents and equipment for anesthesia of rat (see protocol 8) blood collection ( appendix 4G) and Xgal staining (unit 4.23)

Basic Protocol 9: Assessment of the Frequency of Anti‐Adenovirus‐Specific IFN‐γ‐Secreting Lymphocytes

  Materials
  • 35% (v/v) ethanol, filtered through 0.2‐µm filter
  • Rat IFN‐γ ELISpot Development Module (R&D Systems, cat. no. SEL585) including:
    • Capture Antibody Concentrate
    • Detection Antibody Concentrate
  • Dulbecco's PBS, pH 7.4, without Ca or Mg (Cellgro, cat. no. 21‐031 CV)
  • Complete RPMI (see recipe), sterile
  • Adult immunized rats ( protocol 8)
  • 10× ACK solution (see recipe)
  • Fetal bovine serum (FBS), heat inactivated 30 min at 56°C
  • Dimethylsulfoxide (DMSO)
  • Liquid N 2
  • 70% ethanol
  • Stimulants (will vary by assay; those below are in general use):
    • Viral antigen: heat‐inactivated adenovirus (see recipe)
    • Cell lysate (see recipe)
    • Protein and peptide antigens: concanavalin A (ConA; see recipe)
  • Recombinant rat IFN‐γ (R&D Systems, cat. no. 585‐IF) as positive control (use at 200 ng IFN‐γ per well in 200 µl complete medium)
  • Wash buffer: 0.05% Tween 20 in PBS, pH 7.2 to 7.4, filtered through 0.2‐µm filter
  • Reagent diluent: 1% (w/v) BSA in PBS, pH 7.2 to 7.4, filtered through 0.2‐µm filter
  • ELISpot Blue Color Module (R&D Systems, cat. no. SEL002) including:
    • Streptavidin‐AP Concentrate
    • BCIP/NBT Chromogen
  • 96‐well filtration plate (Multiscreen HTS, IP; Millipore, cat. no. MSIPS4510)
  • Surgical instruments, sterile
  • 15‐ and 50‐ml conical polypropylene centrifuge tubes (e.g., Falcon), sterile
  • 12‐well tissue culture plate
  • 10‐ml syringe
  • Refrigerated centrifuge
  • Cryovials
  • Wash bottle
  • Dissecting microscope
  • Automated imager (Axioskop 2 mot plus; Zeiss) and KS ELISPOT software (v. 4.7; Zeiss), or scanner with 6000 to 1200 dpi resolution
  • Eli‐Puncher Kit (ZellNet Consulting; http://zellnet.com/)
  • ImageJ software (http://rsbweb.nih.gov/ij/applet/)
  • Additional reagents and equipment for basic cell culture techniques including counting viable cells by trypan blue exclusion ( appendix 3B)

Support Protocol 1: Perfusion, Fixation, and Sectioning of Brain Tissue

  Materials
  • Cylinder of pre‐mixed 95% oxygen, 5% carbon dioxide with regulator and tubing
  • Tyrode's solution with heparin (see recipe)
  • Fixative: 4% (w/v) paraformaldehyde in PBS
  • Experimental rat (e.g., following step 22 of protocol 1)
  • Ketamine/xylazine anesthetics ( appendix 4B)
  • Optional (fixative if electron microscopy is downstream application): 4% (w/v) paraformaldehyde/0.1% (w/v) glutaraldehyde in 0.1 M cacodylate buffer
  • Dulbecco's PBS, pH 7.4, without Ca or Mg (Cellgro, cat. no. 21‐031 CV)
  • Sodium azide (optional)
  • Superglue
  • Peristaltic perfusion pump (e.g., Masterflex, Cole‐Parmer) or gravity‐fed device (Fig. )
  • Tubing
  • Two‐way valve
  • Dissecting board (e.g., slab of styrofoam) in tray
  • Large and small scissors
  • Forceps
  • Aluminum‐hub blunt perfusion needle (e.g., Monoject 81‐202314, Cardinal Health, http://www.cardinal.com/)
  • Dissecting pins
  • Hemostat
  • Bone rongeurs
  • Small spatula
  • Sodium azide (optional)
  • 6‐well tissue culture plate
  • Cutting platform
  • Vibratome (e.g., model VT1000S, Leica)
  • Soft‐bristled paintbrush

Support Protocol 2: Preparation of Gelatin or APES‐Coated Slides

  Materials
  • Gelatin (Type B G7‐500; Fisher Scientific, cat. no. CAS9000‐70‐8)
  • 95% ethanol
  • Acid alcohol: 1% (w/v) hydrochloric acid in 70% methylated spirits
  • 3% (v/v) 3‐aminopropyl‐trioxysilane (APES; Sigma) in acetone
  • Acetone
  • Glass microscope slides
  • Slide rack
  • 37° or 50°C drying oven
  • Glass microscope slides
  • 37°C or 50°C drying oven

Support Protocol 3: Transport of Recombinant Adenoviral Vectors on Dry Ice

  Materials
  • Adenoviral victor aliquotted into labeled 0.5‐ml Treff Lab tubes or other suitable tubes
  • Dry ice
  • 50‐ml polypropylene centrifuge tubes (Greiner)
  • Minigrip resealable polythene bags (Fisher)
  • Parafilm, cut into squares 3 cm × 3 cm
  • Polystyrene box
  • Cardboard box (into which the polystyrene box snugly fits)
  • Brown tape
NOTE: Each step performed below is done individually at short intervals in the −80°C freezer to keep the aliquots frozen. Freeze/thawing of the aliquot may affect the viral titer.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Akli, S., Caillaud, C., Vigne, E., Stratford‐Perricaudet, L.D., Poenaru, L., Perricaudet, M., Kahn, A., and Peschanski, M.R. 1993. Transfer of a foreign gene into the brain using adenovirus vectors. Nature Genetics 3:224‐228.
   Amalfitano, A. and Parks, R.J. 2002. Separating fact from fiction: Assessing the potential of modified adenovirus vectors for use in human gene therapy. Curr. Gene Ther. 2:111‐133.
   Barcia, C., Gerdes, C., Xiong, W., Thomas, C.E., Liu, C., Kroeger, K.M., Castro, M.G., and Lowenstein, P.R. 2006a. Immunological thresholds in neurological gene therapy: Highly efficient elimination of transduced cells may be related to the specific formation of immunological synapses between T cells and virus‐infected brain cells. Neuron Glia Biol. 2:309‐327.
   Barcia, C., Thomas, C.E., Curtin, J.F., King, G.D., Wawrowsky, K., Candolfi, M., Xiong, W.D., Liu, C., Kroeger, K., Boyer, O., Kupiec‐Weglinski, J., Klatzmann, D., Castro, M.G., and Lowenstein, P.R. 2006b. In vivo mature immunological synapses forming SMACs mediate clearance of virally infected astrocytes from the brain. J. Exp. Med. 203:2095‐2107.
   Barcia, C., Jimenez‐Dalmaroni, M., Kroeger, K.M., Puntel, M., Rapaport, A.J., Larocque, D., King, G.D., Johnson, S.A., Liu, C., Xiong, W., Candolfi, M., Mondkar, S., Ng, P., Palmer, D., and Castro, M.G. 2007. Sustained, one year expression from high‐capacity helper‐dependent adenoviral vectors delivered to the brain of animals with a pre‐existing systemic anti‐adenoviral immune response: implications for clinical trials. Mol. Ther. 15:2154‐2163.
   Barcia, C., K. Wawrowsky, K., Barrett, R.J., Liu, C., Castro, M.G., and Lowenstein, P.R. 2008. In vivo polarization of IFN‐γ at Kupfer and non‐Kupfer immunological synapses during the clearance of virally infected brain cells. J. Immunol. 180:1344‐1352.
   Bechmann, I., Galea, I., and Perry, V.H. 2007. What is the blood‐brain barrier (not)? Trends Immunol. 28:5‐11.
   Bell, M.D., Taub, D.D., Kunkel, S.J., Streiter, R.M., Foley, R., Gauldie, J., and Perry, V.H. 1996. Recombinant human adenovirus with rat MIP‐2 gene insertion causes prolonged PMN recruitment to the murine brain. Eur. J. Neurosci. 8:1803‐1811.
   Brunetti‐Pierri, N., Stapleton, G.E., Law, M., Breinholt, J., Palmer, D.J., Zuo, Y., Grove, N.C., Finegold, M.J., Rice, K., Beaudet, A.L., Mullins, C.E., and Ng, P. 2009. Efficient, long‐term hepatic gene transfer using clinically relevant HDAd doses by balloon occlusion catheter delivery in nonhuman primates. Mol. Ther. 17:327‐333.
   Byrnes, A.P., Rusby, J.E., Wood, M.J.A., and Charlton, H.M. 1995. Adenovirus gene transfer causes inflammation in the brain. Neuroscience 66:1015‐1024.
   Byrnes, A.P., MacLaren, R.E., and Charlton, H.M. 1996a. Immunological instability of persistent adenovirus vectors in the brain: Peripheral exposure to vector leads to renewed inflammation, reduced gene expression and demyelination. J. Neurosci. 16:3045‐3055.
   Byrnes, A.P., Wood, M.J.A., and Charlton, H.M. 1996b. Role of T cells in inflammation caused by adenovirus vectors in the brain. Gene Therapy 3:644‐651.
   Candolfi, M., Pluhar, G.E., Kroeger, K., Puntel, M., Curtin, J., Barcia, C., Muhammad, A.K., Xiong, W., Liu, C., Mondkar, S., Kuoy, W., Kang, T., McNeil, E.A., Freese, A.B., Ohlfest, J.R., Moore, P., Palmer, D., Ng, P., Young, J.D., Lowenstein, P.R., and Castro, M.G. 2007. Optimization of adenoviral vector‐mediated transgene expression in the canine brain in vivo, and in canine glioma cells in vitro. Neuro‐Oncol. 9:245‐258.
   Candolfi, M., Kroeger, K.M., Muhammad, A.K., Yagiz, K., Farrokhi, C., Pechnick, R.N., Lowenstein, P.R., and Castro, M.G. 2009. Gene therapy for brain cancer: Combination therapies provide enhanced efficacy and safety. Curr. Gene Ther. 9:409‐421.
   Carson, M.J. and Sutcliffe, J.G. 1999. Balancing function vs. self defence: The CNS as an active regulator of immune responses. J. Neurosci. Res. 55:1‐8.
   Cartmell, T., Southgate, T., Rees, G.S., Castro, M.G., Lowenstein, P.R., and Luheshi, G.N. 1999. Interleukin‐1 mediates a rapid inflammatory response after injection of adenoviral vectors into the brain. J. Neurosci. 19:1517‐1523.
   Chen, H.H., Mack, L.M., Choi, S.Y., Ontell, M., Kochanek, S., and Clemens, P.R. 1999. DNA from both high‐capacity and first‐generation adenoviral vectors remains intact in skeletal muscle. Hum. Gene Ther. 10:365‐373.
   Chen, C.T., Lin, J., Li, Q., Phipps, S.S., Jakubczak, J.L., Stewart, D.A., Skripchenko, Y., Forry‐Schaudies, S., Wood, J., Schnell, C., and Hallenbeck, P.L. 2000. Antiangiogenic gene therapy for cancer via systemic administration of adenoviral vectors expressing secretable endostatin. Hum. Gene Ther. 11:1983‐1996.
   Cotten, M., Baker, A., Saltik, M., Wagner, E., and Buschle, M. 1994. Lipopolysaccharide is a frequent contaminant of plasmid DNA preparations and can be toxic to primary human cells in the presence of adenovirus. Gene Ther. 1:239‐246.
   Cowsill, C., Southgate, T.D., Morrissey, G., Dewey, R.A., Morelli, A.E., Maleniak, T.C., Forrest, Z., Klatzmann, D., Wilkinson, G.W.G., Lowenstein, P.R., and Castro, M.G. 2000. Central nervous system toxicity of two adenoviral vectors encoding variants of the herpes simplex virus type 1 thymidine kinase: Reduced cytotoxicity of a truncated HSV1‐TK. Gene Ther. 7:679‐685.
   Cserr, H.F. and Knopf, P.M. 1997. Cervical lymphatics, the blood‐brain barrier and the immunoreactivity of the brain. In Immunology of the Nervous System (R.W. Keane and W.F. Hickey, eds.). Oxford University Press, Oxford.
   Davidson, B.L., Allen, E.D., Kozarsky, K.F., Wilson, J.M., and Roessler, B.J. 1993. A model system for in vivo gene transfer into the central nervous system using an adenoviral vector. Nat. Genet. 3:219‐223.
   Dewey, R.A., Morrissey, G., Cowsill, C.M., Stone, D., Bolognani, F., Dodd, N.J.F., Southgate, T.D., Katzmann, D., Lassmann, H., Castro, M.G., and Lowenstein, P.R. 1999. Chronic brain inflammation and persistent herpes simplex virus 1 thymidine kinase expression in survivors of syngenic glioma treated by adenovirus‐mediated gene therapy: Implications for clinical trials. Nat. Med. 5:1256‐1263.
   Fallaux, F.J., Kranenburg, O., Cramer, S.J., Houweling, A., Van Ormondt, H., Hoeben, R.C., and Van der Eb, A.J. 1996. Characterisation of 911: A new helper cell line for the titration and propagation of early region‐1 deleted adenoviral vectors. Hum. Gene Ther. 7:215‐222.
   Galea, I., Bechmann, I., and Perry, V.H. 2007. What is immune privilege (not)? Trends Immunol. 28:12‐18.
   Gerdes, C.A., Castro, M.G., and Lowenstein, P.R. 2000. Strong promoters are the key to highly efficient, non‐inflammatory and non‐cytotoxic adenoviral‐mediated transgene delivery into the brain in vivo. Mol. Ther.. 2:330‐338.
   Glover, C.P., Bienemann, A.S., Hopton, M., Harding, T.C., Kew, J.N., and Uney, J.B. 2003. Long‐term transgene expression can be mediated in the brain by adenoviral vectors when powerful neuron‐specific promoters are used. J. Gene Med. 5:554‐559.
   Hanker, J.S., Yates, P.E., Metz, C.B., and Rustioni, A. 1977. A new specific, sensitive and non‐carcinogenic reagent for the demonstration of horseradish peroxidase. Histochem. J. 9:789‐792.
   Hedman, M., Muona, K., Hedman, A., Kivelä, A., Syvänne, M., Eränen, J., Rantala, A., Stjernvall, J., Nieminen, M.S., Hartikainen, J., and Ylä‐Herttuala, S. 2009. Eight‐year safety follow‐up of coronary artery disease patients after local intracoronary VEGF gene transfer. Gene Ther. 16:629‐634.
   Ideguchi, M., Kajiwara, K., Yoshikawa, K., Uchida, T., and Ito, H. 2000. Local adenovirus‐mediated CTLA4‐immunoglobulin expression suppresses the immune responses to adenovirus vectors in the brain. Neuroscience 95:217‐226.
   Jeong, J.S., Lee, S.W., Hong, S.H., Lee, Y.J., Jung, H.I., Cho, K.S., Seo, H.H., Lee, S.J., Park, S., Song, M.S., Kim, C.M., and Kim, I.H. 2008. Antitumor effects of systemically delivered adenovirus harboring trans‐splicing ribozyme in intrahepatic colon cancer mouse model. Clin. Cancer Res. 14:281‐290.
   Jiang, H., McCormick, F., Lang, F.F., Gomez‐Manzano, C., and Fueyo, J. 2006. Oncolytic adenoviruses as antiglioma agents. Expert Rev. Anticancer Ther. 6:697‐708.
   Kajiwara, K., Byrnes, A.P., Charlton, H.M., Wood, M.J., and Wood, K.J. 1997. Immune responses to adenoviral vectors during gene transfer in the brain. Hum. Gene Ther. 8:253‐265.
   King, G.D., Muhammad, A.K., Xiong, W., Kroeger, K.M., Puntel, M., Larocque, D., Palmer, D., Ng, P., Lowenstein, P.R., and Castro, M.G. 2008. High‐capacity adenovirus vector‐mediated anti‐glioma gene therapy in the presence of systemic antiadenovirus immunity. J. Virol. 82:4680‐4684.
   Kreppel, F., Luther, T.T., Semkova, I., Schraermeyer, U., and Kochanek, S. 2002. Long‐term transgene expression in the RPE after gene transfer with a high‐capacity adenoviral vector. Invest. Ophthalmol. Vis. Sci. 43:1965‐1970.
   Larocque, D., Bergeron, J., Curtin, J., Girton, J., Bondale, N., Kroeger, K., Yang, J., Sanderonn, N., Castro, M.G., and Lowenstein, P.R. Exogenous Flt3L overrides the brain's immune privilege and facilitates the recognition of a neo‐antigen: Implications for brain immunotherapies. Proc. Natl. Acad. Sci. U.S.A. Submitted for publication.
   Le Gal La Salle, G., Robert, J.J., Berrard, S., Ridoux, V., Stratford‐Perricaudet, L.D., Perricaudet, M., and Mallet, J. 1993. An adenovirus vector for gene transfer into neurons and glia in the brain. Science 259:988‐990.
   Li, Y., Kacka, M., Thompson, M., Hsieh, J.T., and Koeneman, K.S. 2009. Conditionally replicating adenovirus therapy utilizing bone sialoprotein promoter (Ad‐BSP‐E1a) in an in vivo study of treating androgen‐independent intraosseous prostate cancer. Urol. Oncol. 2009 Dec 5. [Epub ahead of print]
   Lowenstein, P.R. 2002. Immunology of viral‐vector‐mediated gene transfer into the brain: An evolutionary and developmental perspective. Trends Immunol. 23:23‐30.
   Määttä, A.M., Samaranayake, H., Pikkarainen, J., Wirth, T., and Ylä‐Herttuala, S. 2009. Adenovirus mediated herpes simplex virus‐thymidine kinase/ganciclovir gene therapy for resectable malignant glioma. Curr. Gene Ther. 9:356‐367.
   Matyszak, M.K. 1998. Inflammation in the CNS: Balance between immunological privilege and immune responses. Prog. Neurobiol. 56:19‐35.
   Mi, W., Belyavskyi, M., Johnson, R.R., Sieve, A.N., Storts, R., Meagher, M.W., and Welsh, C.J.J. 2004. Alterations in chemokine expression following Theiler's virus infection and restraint stress. Neuroimmunology 151:103‐115.
   Montero‐Menei, C.N., Sindji, L., Pouplard‐Barthelaix, A., Jehan, F., Denechaud, L., and Darcy, F. 1994. Lipopolysaccharide intracerebral administration induces minimal inflammatory reaction in rat brain. Brain Res. 653:101‐111.
   Morelli, A.E., Larregina, A.T., Smith‐Arica, J., Dewey, R.A., Southgate, T.D., Ambar, B., Fontana, A., Castro, M.G., and Lowenstein, P.R. 1999. Neuronal and glial cell type‐specific promoters within adenovirus recombinants restrict the expression of the apoptosis‐inducing molecule Fas ligand to predetermined brain cell types, and abolish peripheral liver toxicity. J. Gen. Virol. 80:571‐583.
   Morral, N., Parks, R.J., Zhou, H., Langston, C., Schiedner, G., Quinones, J., Graham, F.L., Kochanek, S., and Beaudet, A.L. 1998. High doses of a helper‐dependent adenoviral vector yield supraphysiological levels of alpha1‐antitrypsin with negligible toxicity. Hum. Gene Ther. 9:2709‐2716.
   Morsy, M.A. and Caskey, C.T. 1999. Expanded‐capacity adenoviral vectors—the helper‐dependent vectors. Mol. Med. Today 5:18‐24.
   Nandi, S. and Lesniak, M.S. 2009. Adenoviral virotherapy for malignant brain tumors. Expert Opin. Biol. Ther. 9:737‐747.
   Nyberg‐Hoffman, C. and Aguilar‐Cordova, E. 1999. Instability of adenoviral vectors during transport and its implication for clinical studies. Nat. Med. 5:955‐957.
   Ohmoto, Y., Wood, M.J.A., Charlton, H.M., Kajiwara, K., Perry, V.H., and Wood, K.J. 1999. Variation in the immune response to adenoviral vectors in the brain: Influence of mouse strain, environmental conditions and priming. Gene Ther. 6:471‐481.
   Opyrchal, M., Aderca, I., and Galanis, E. 2009. Phase I clinical trial of locoregional administration of the oncolytic adenovirus ONYX‐015 in combination with mitomycin‐C, doxorubicin, and cisplatin chemotherapy in patients with advanced sarcomas. Methods Mol. Biol. 542:705‐717.
   Palmer, T.D., Rossman, G.J., William, R.A., and Miller, A.D. 1991. Genetically modified skin fibroblasts persist long after transplantation but gradually inactivate introduced genes. Proc. Natl. Acad. Sci. U.S.A. 88:1330‐1334.
   Paxinos, G. and Watson, C. 1998. The Rat Brain in Stereotactic Coordinates. Academic Press, New York.
   Popovich, P.G. and Longbrake, E.E. 2008. Can the immune system be harnessed to repair the CNS? Nat. Rev. Neurosci. 9:481‐493.
   Puntel, M., Curtin, J.F., Zirger, J.M., Muhammad, A.K., Xiong, W., Liu, C., Hu, J., Kroeger, K.M., Czer, P., Sciascia, S., Mondkar, S., Lowenstein, P.R., and Castro, M.G. 2006. Quantification of high‐capacity helper‐dependent adenoviral vector genomes in vitro and in vivo, using quantitative TaqMan real‐time polymerase chain reaction. Hum. Gene Ther. 17:531‐544.
   Rosenberg, W.S., Breakefield, X.O., DeAntonio, C., and Isacson, O. 1992. Authentic and artifactual detection of the E.coli lacZ gene product in the rat brain by histochemical methods. Brain Res. Mol. Brain Res. 16:311‐315.
   Shering, A.F., Bain, D., Stewart, K., Epstein, A.L., Castro, M.G., Wilkinson, G.W.G., and Lowenstein, P.R. 1997. Cell‐type specific expression in brain cultures from a short human cytomegalovirus major intermediate early promoter depends on whether it is inserted into herpesvirus or adenovirus vectors. J. Gen. Virol. 78:445‐459.
   Smith‐Arica, J.R., Morelli, A.E., Larregina, A.T., Smith, J., Lowenstein, P.R., and Castro, M.G. 2000. Cell‐type specific and regulatable transgenesis in the adult brain: Adenovirus‐encoded combined transcriptional targeting and inducible transgene expression. Mol. Ther. 2:579‐587
   Stevenson, P.G., Hawke, S., Sloan, D.J., and Bangham, C.R.M. 1997. The immunogenicity of intracerebral virus infection depends on anatomical site. J. Virol. 71:145‐151.
   Thomas, C.E., Schiedner, G., Kochanek, S., Castro, M.G., and Lowenstein, P.R. 2000. Peripheral infection with adenovirus causes unexpected long‐term brain inflammation in animals injected intracranially with first‐generation, but not with high‐capacity vectors: Towards realistic long‐term neurological gene therapy for chronic diseases. Proc. Natl. Acad. Sci. U.S.A. 97:7482‐7487.
   Thomas, C.E., Birkett, D., Anozie, I., Castro, M.G., and Lowenstein, P.R. 2001a. Acute direct adenoviral vector cytotoxicity and chronic, but not acute, inflammatory responses correlate with decreased vector‐mediated transgene expression in the brain. Mol. Ther. 3:36‐46.
   Thomas, C.E., Schiedner, G., Kochanek, S., Castro, M.G., and Lowenstein, P.R. 2001b. Preexisting antiadenoviral immunity is not a barrier to efficient and stable transduction of the brain, mediated by novel high‐capacity adenovirus vectors. Hum. Gene Ther. 12:839‐846.
   Weller, R.O., Djuanda, E., Yow, H.Y., and Carare, R.O. 2009. Lymphatic drainage of the brain and the pathophysiology of neurological disease. Acta Neuropathol. 117:1‐14.
   Wood, M.J.A., Charlton, H.M., Wood, K.J., Kajiwara, K., and Byrnes, A.P. 1996. Immune responses to adenovirus vectors in the nervous system. Trends Neurosci. 19:497‐501.
   Xing, Z., McFarland, C.T., Sallenave, J.M., Izzo, A., Wang, J., and McMurray, D.N. 2009. Intranasal mucosal boosting with an adenovirus‐vectored vaccine markedly enhances the protection of BCG‐primed guinea pigs against pulmonary tuberculosis. PLoS One 4:e5856.
   Xiong, W., Goverdhana, S., Sciascia, S.A., Candolfi, M., Zirger, J.M., Barcia, C., Curtin, J.F., King, G.D., Jaita, G., Liu, C., Kroeger, K., Agadjanian, H., Medina‐Kauwe, L., Palmer, D., Ng, P., Lowenstein, P.R., and Castro, M.G. 2006. Regulatable gutless adenovirus vectors sustain inducible transgene expression in the brain in the presence of an immune response against adenoviruses. J. Virol. 80:27‐37.
   Xiong, W., Candolfi, M., Kroeger, K.M., Puntel, M., Mondkar, S., Larocque, D., Liu, C., Curtin, J.F., Palmer, D., Ng, P., Lowenstein, P.R., and Castro, M.G. 2008. Immunization against the transgene but not the TetON switch reduces expression from gutless adenoviral vectors in the brain. Mol. Ther. 16:343‐351.
   Yang, Y., Ertl, H.C.J., and Wilson, J.M. 1994. MHC class‐I restricted cytotoxic T‐lymphocytes to viral antigens destroy hepatocytes in mice infected with E1‐deleted recombinant adenoviruses. Immunity 1:433‐442.
   Yang, Y., Li, Q., Ertl, H.C.J., and Wilson, J.M. 1995. Cellular and humoral immune responses to viral antigens create barriers to lung‐directed gene therapy with recombinant adenoviruses. J. Virol. 69:2004‐2015.
   Zermansky, A.J., Bolognani, F., Stone, D., Cowsill, C.M., Morrissey, G., Castro, M.G., and Lowenstein, P.R. 2001. Towards global and long‐term neurological gene therapy: Unexpected transgene dependent, high‐level, and widespread distribution of HSV‐1 thymidine kinase throughout the CNS. Mol. Ther. 4:490‐498.
   Zirger, J.M., Barcia, C., Liu, C., Puntel, M., Mitchell, N., Campbell, I., Castro, M., and Lowenstein, P.R. 2006. Rapid upregulation of interferon‐regulated and chemokine mRNAs upon injection of 108 international units, but not lower doses, of adenoviral vectors into the brain. J. Virol. 80:5655‐5659.
   Zou, L., Zhou, H., Pastore, L., and Yang, K. 2000. Prolonged transgene expression mediated by a helper‐dependent adenoviral vector (hdAd) in the central nervous system. Mol. Ther. 2:105‐113.
Key References
   Dewey et al., 1999. See above.
  A description of previously unforeseen long‐term toxic side‐effects of administering a potentially therapeutic adenovirus vector. This paper provides an excellent illustration of the importance of investigating long‐term side effects of vector administration to the brain.
   Easton, R.M., Johnson, E.M., and Creedon, D.J. 1998. Analysis of events leading to neuronal death after infection with E1‐deficient adenovirus vectors. Mol. Cell. Neurosci. 11:334‐347.
  A detailed molecular study of the consequences of infecting peripheral neurons in culture.
   Gerdes et al., 2000. See above.
  Illustrates the different levels of expression achievable from two different adenovirus vectors with the same virus backbone, expressing the same transgene under the control of two different promoters.
   Thomas et al., 2000. See above.
  An in‐depth investigation, in the rat brain, of the longevity of transgene expression, and inflammatory and cytotoxic side‐effects from different doses of vector from 106 to 109 infectious units.
   Wood et al., 1996. See above.
  A review of the immune responses to adenovirus vectors injected into the brains of naive or primed animals.
   Wood, M.J.A., Byrnes, A.P., McMenamin, M., Kajiwara, K., Vine, A., Gordon, I., Lang, J., Wood, K.J., and Charlton, H.M. 1996. Immune responses to viruses: Practical implications for the use of viruses as vectors for experimental and clinical gene therapy. In Protocols for Gene Transfer in Neuroscience (P.R. Lowenstein and L.W. Enquist, eds.) pp. 365‐376. John Wiley & Sons, New York.
  Contains detailed protocols for the evaluation of immune responses to adenoviruses in the brain, including protocols for analysis of cytokine gene expression in the CNS and isolation of lymphocytes from the brain (not described in this unit).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library