cDNA Library Construction from Single Cells

Phillip R. Kramer1

1 NIH, NINDS, CDNS, Bethesda, Maryland
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 4.27
DOI:  10.1002/0471142301.ns0100s19
Online Posting Date:  August, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

cDNA Library Construction from Single Cells (Phillip R. Kramer, National Institute of Neuronal Disorders and Stroke, NIH, Bethesda, Maryland). Analysis of gene expression or comparing gene expression patterns between cells and/or tissues facilitates the identification of molecules activated by a cellular program or by a particular physiological or pharmacological treatment. This unit presents a protocol for studying these molecules at the level of a single cell.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Production and Amplification of cDNA from Single Cells
  • Support Protocol 1: Isolation of Individual Cells from Acute Tissue and Tissue Explants Grown in Vitro
  • Basic Protocol 2: Phage Library Construction and Differential Screening
  • Support Protocol 2: Gene Expression Profiling Using PCR Amplification of Truncated cDNA Libraries
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Production and Amplification of cDNA from Single Cells

  Materials
  • Isolated cells in cDNA lysis buffer (see protocol 2)
  • 200 U/µl MMLV reverse transcriptase with 5× buffer (Life Technologies)
  • 1 to 5 U/µl AMV reverse transcriptase (Life Technologies)
  • 10× PCR buffer II (PE Biosystems)
  • 25 mM MgCl 2 (Perkin Elmer)
  • 20 mg/ml BSA, molecular grade
  • 100 mM solutions of each dATP, dGTP, dCTP, dTTP
  • 5% (v/v) Triton X‐100, RNase‐ and DNase‐free (e.g., Sigma)
  • PAGE‐purified AL1 primer: ATT GGA TCC AGG CCG CTC TGG ACA AAA TAT GAA TCC (T) 24 (Life Technologies)
  • AmpliTaq DNA polymerase (PE Biosystems)
  • 5× terminal transferase buffer (Life Technologies)
  • 25 U/µl terminal transferase (Boehringer Mannheim)
  • Mineral oil, molecular biology grade
  • TE buffer ( appendix 2A), pH 7.5
  • Tris‐buffered phenol ( appendix 2A)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 100% ethanol
  • 10 mM Tris⋅Cl, pH 7.0 ( appendix 2A)
  • 1.5% (w/v) agarose gel
  • 37°C and 65°C water baths
  • 0.2‐ml thin‐walled reaction tubes
  • DNA thermal cycler (e.g., Perkin Elmer or equivalent with extended cycle time feature)
  • 1.5‐ml microcentrifuge tubes
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N), transfer onto nylon membrane and Southern analysis (CPMB UNITS & )

Support Protocol 1: Isolation of Individual Cells from Acute Tissue and Tissue Explants Grown in Vitro

  Materials
  • Tissue sample
  • Calcium‐ and magnesium‐free phosphate buffered saline (CMF‐PBS) or Hank's buffered saline solution (CMF‐HBSS; appendix 2A)
  • CMF‐PBS or CMF‐HBSS containing 0.025% trypsin/0.75 mM EDTA, 37°C
  • 5× MMLV buffer (e.g., Life Technologies)
  • DEPC‐treated, sterile deionized H 2O (RNase‐free; appendix 2A)
  • NP‐40 (e.g., USB)
  • RNase inhibitors: Prime RNase inhibitor (Eppendorf) and RNA guard (Amersham Pharmacia Biotech)
  • Stock primer mix (see recipe)
  • Dissecting microscope
  • Sterile 60‐ or 100‐mm polystyrene or glass petri dish
  • Sterile scalpel or razor blade
  • 5‐ml plastic pipets
  • 37°C incubator
  • 0.5‐ml thin‐walled tubes, sterile, RNase‐free
  • 15‐ml polypropylene tubes
  • Inverted microscope and micromanipulator (e.g., Sutter Instruments)
  • 0.5‐ (i.d.) × 130‐mm glass capillary tubing
  • Micropipet puller (e.g., Sutter Instruments)
  • Syringe with attached tubing fitted for the glass capillary tube or microinjector (e.g., Nanoject II, Drummond Scientific)
  • Sterile 1.5‐ml polypropylene tubes

Basic Protocol 2: Phage Library Construction and Differential Screening

  Materials
  • Cell‐amplified cDNA (see protocol 1, step )
  • PCR buffer (see protocol 1, step )
  • Tris‐buffered phenol ( appendix 2A)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 10 mM and 1 M Tris⋅Cl, pH 7.0 and pH 7.5, respectively ( appendix 2A)
  • EcoRI restriction enzyme and appropriate buffer ( appendix 1M)
  • Low‐melting agarose (melts at 65°C at 1.5%, e.g., Seaplaque GTG or NuSieve GTG agarose)
  • 0.5 µg/ml ethidium bromide
  • PCR prep DNA purification resin (e.g., Promega) or equivalent commercially available DNA gel purification method
  • 100% ethanol
  • Phage vector DNA (e.g., Lambda ZapII arms, EcoRI cut and dephosphorylated; Stratagene)
  • 200 U/µl high‐concentration ligase and 10× ligase buffer
  • Phage packaging extract (e.g., Gigapack II gold extract; Stratagene) containing host bacteria (e.g., XL‐1‐Blue MRF′; Stratagene)
  • 10× Taq PCR buffer (150 mM Tris⋅Cl, pH 8.0, 500 mM KCl)
  • 25 mM MgCl 2 in dH 2O
  • 100 mM solutions of each of dATP, dTTP, dCTP, dGTP
  • 5 µg/ml T7 primer (5′‐TAATACGACTCACTATAGGG‐3′) in TE buffer (Life Technologies)
  • 5 µg/ml T3 primer (5′‐TAACCCTCACTAAAGGGA‐3′) in TE buffer (Life Technologies)
  • AmpliTaq DNA polymerase (PE Biosystems)
  • 0.5 M NaOH
  • 0.5× sodium phosphate buffer containing 1% (w/v) BSA and 4% (w/v) SDS
  • APH solution (see recipe)
  • 1‐5 × 107 cpm/ml radiolabeled probe for specific gene or control genes such as tubulin, actin, GAPDH (e.g., labeled as described in CPMB UNIT )
  • 0.5% SDS in 0.5× SSC (see appendix 2A for SSC)
  • 10× PCR buffer II (PE Biosystems)
  • 20 mg/ml BSA
  • [α‐32P]dCTP
  • 5% Triton X‐100
  • PAGE‐purified AL1 primer: ATT GGA TCC AGG CCG CTC TGG ACA AAA TAT GAA TCC (T)24 (Life Technologies)
  • Thermal cycler
  • 0.2‐ml thin‐walled PCR tubes
  • 37°C and 50°C water baths
  • Razor blades
  • 1.5‐ml microcentrifuge tubes
  • 137‐mm nylon membranes (e.g., Hybond N+, NEN Genescreen)
  • 20‐G needle
  • Plastic wrap
  • Paper towels or Whatman paper
  • 65°C incubator
  • X‐ray film
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N), titering of phage (Stratagene's protocol or unit 5.18),Southern transfer (CPMB UNIT ), homology cloning (unit 4.1), in situ hybridizations (unit 1.3)

Support Protocol 2: Gene Expression Profiling Using PCR Amplification of Truncated cDNA Libraries

  Materials
  • Amplified cDNA from a single cell or pooled cellular cDNAs (see protocol 1)
  • 10× PCR buffer (see protocol 3; e.g., Taq Gold PCR buffer)
  • 25 mM MgCl 2
  • 100 mM each dNTP
  • 100 µM PCR primer X dissolved in water or TE buffer
  • 100 µM PCR primer Y dissolved in water or TE buffer
  • 5 U/µl DNA polymerase (e.g., AmpliTaq Gold, PE Biosystems)
  • Gel loading dye
  • 0.5 µg/ml ethidium bromide ( appendix 2A)
  • Thermal cycler
  • 0.5‐ml thin‐walled PCR tubes
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Becker, I., Becker, K.F., Rohrl, M.H., Minkus, G., Schutze, K., and Hofler, H. 1996. Single‐cell mutation analysis of tumors from stained histologic slides. Lab. Invest. 75:801‐807.
   Brady, G., Barbara, M., and Iscove, N. 1990. Representative in vitro cDNA amplification from individual hemopoietic cells and colonies. Methods Mol. Cell. Biol. 2:17‐25.
   Brunet, J.F., Shapiro, E., Foster, S.A., Kandel, E.R., and Iino, Y. 1991 Identification of a peptide specific for Aplysia sensory neurons by PCR‐based differential screening. Science 252:856‐859.
   Cheetham, J.E., Coleman, P.D., and Chow, N. 1997. Isolation of single immunohistochemically identified whole neuronal cell bodies from post‐mortem human brain for simultaneous analysis of multiple gene expression. J. Neurosci. Methods 77:43‐48.
   Crino, P.B. and Eberwine, J. 1996a. Molecular characterization of the dendritic growth cone: Regulated mRNA transport and local protein synthesis. Neuron 17:1173‐1187.
   Crino, P.B., Trojanowski, J.Q., Dichter, M..A., and Eberwine, J. 1996b. Embryonic neuronal markers in tuberous sclerosis: Single‐cell molecular pathology. Proc. Natl. Acad. Sci. U.S.A. 93:14152‐14157.
   Davis, L.G., Kuehl, W.M., and Battey, J. 1994. Preparation and analysis of RNA from eukaryotic cells. In Basic Methods in Molecular Biology (S. Greenfield and M. Wonsiewicz, eds.) pp.320‐321. Appleton Lange, East Norwalk, Conn.
   Dulac, C. and Axel, R. 1995. A novel family of genes encoding putative pheromone receptors in mammals. Cell 83:195‐206.
   Eberwine, J., Cao, Y., Nair, S., Miyashiro, K., Mackler, S., Finnell, R., Surmeier, J., and Dichter, M. 1995. Mechanisms of neuronal plasticity as analyzed at the single cell level. Prog. Brain Res. 105:117‐126.
   Fend, F., Emmert‐Buck, M.R., Chuaqui, R., Cole, K., Lee, J., Liotta, L.A., and Raffeld, M. 1999. Immuno‐LCM: Laser capture microdissection of immunostained frozen sections for mRNA analysis. Am. J. Pathol. 154:61‐66.
   Fueshko, S. and Wray, S. 1994. LHRH cells migrate on peripherin fibers in embryonic olfactory explant cultures: An in vitro model for neurophilic neuronal migration. Dev. Biol. 166:331‐348.
   Hoon, M.A., Adler, E., Lindemeier, J., Battey, J.F., Ryba, N.J., and Zuker, C.S. 1999. Putative mammalian taste receptors: A class of taste‐specific GPCRs with distinct topographic selectivity. Cell 96:541‐551.
   Kramer, P.R., Krishnamurthy, R., Mitchell, P.J., and Wray, S. 2000. Transcription factor activator protein‐2 is required for continued luteinizing hormone‐releasing hormone expression in the forebrain of developing mice. Endocrinology 141:1823‐1838.
   Li, H.H., Gyllensten, U.B., Cui, X.F., Saiki, R.K., Erlich, H.A., and Arnheim, N. 1988. Amplification and analysis of DNA sequences in single human sperm and diploid cells. Nature 335:414‐417.
   O'Dell, D.M., Raghupathi, R., Crino, P.B., Morrison, B., Eberwine, J.H., and McIntosh, T.K. 1998. Amplification of mRNAs from single, fixed, TUNEL‐positive cells. Biotechniques 25:566‐568, 570.
   Rappolee, D.A., Wang, A., Mark, D., and Werb, Z. 1989. Novel method for studying mRNA phenotypes in single or small numbers of cells. J. Cell Biochem. 39:1‐11.
   Skynner, M.J., Sim, J.A., and Herbison, A.E. 1999. Detection of estrogen receptor alpha and beta messenger ribonucleic acids in adult gonadotropin‐releasing hormone neurons. Endocrinology 140:5195‐5201.
   Williams, J.G. 1981. The preparation and screening of a cDNA clone bank. In Genetic Engineering (R. Williamson, ed.) pp. 1‐59. Academic Press, New York.
Key Reference
   Dulac and Axel 1995. See above.
  The single cell amplification protocol was based on methods outlined in this report.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library