Gene Expression Analysis of Neural Cells and Tissues Using DNA Microarrays

Stanislav L. Karsten1, Lili C. Kudo1, Daniel H. Geschwind1

1 David Geffen School of Medicine at UCLA, Los Angeles, California
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 4.28
DOI:  10.1002/0471142301.ns0428s45
Online Posting Date:  October, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

DNA microarrays pose specific challenges to those studying the central and peripheral nervous systems. Probably the most important involve difficulty in obtaining appropriate tissue for study, as well as the problems posed by cellular heterogeneity. This unit describes advances in the available technologies and provides protocols for cDNA microarray hybridization, including the use of PCR amplicons. Protocols are also provided for the two major methods for limiting cellular heterogeneity by study of RNA from single cell populations in high‐throughput microarray studies, laser capture microdissection (LCM), and automated fluorescent cell sorting (FACS‐array). Curr. Protoc. Neurosci. 45:4.28.1‐4.28.38. © 2008 by John Wiley & Sons, Inc.

Keywords: gene expression; flow sorting; single cell analysis; laser capture; microarray analysis

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Direct Labeling of cDNA using Klenow Fragment
  • Alternate Protocol 1: Direct Labeling using Reverse Transcriptase
  • Basic Protocol 2: Indirect Labeling and Detection of cDNA using PCR Amplification
  • Basic Protocol 3: Modified T7‐Based Two‐Round Amplification for Small Quantities of RNA Derived Through Laser Capture Microdissection (LCM) or Fluorescence‐Assisted Cell Sorting (FACS)
  • Support Protocol 1: Laser Capture Microdissection (LCM)
  • Support Protocol 2: Enzymatic Dissociation and Fluorescence‐Assisted Cell Sorting (FACS) of the Genetically Labeled Neurons from BAC‐EGFP Transgenic Mice
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Direct Labeling of cDNA using Klenow Fragment

  Materials
  • Sample: 0.8 µg/ml poly(A)+ RNA or 20 µg/ml total RNA (units 4.26& 5.3) in TE buffer ( 2.NaN)
  • SuperScript II cDNA kit (Invitrogen Life Technologies) containing:
    • 0.5 µg/µl oligo(dT) 12‐18
    • 5× first‐strand buffer
    • 0.1 M dithiothreitol (DTT)
    • 10 mM 4dNTP mix (10 mM each dATP, dCTP, dGTP, and dTTP)
    • 200 U/µl SuperScript II reverse transcriptase
    • 5× second‐strand buffer
    • 10 U/µl E. coli DNA polymerase I
    • 2 U/µl RNase H
    • 10 U/µl E. coli DNA ligase
    • 5× random primers (hexamers)
    • DEPC‐treated H 2O
  • 10 U/µl RNasin (Promega)
  • 15 mM β‐nicotinamide adenine dinucleotide (β‐NAD; Sigma)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol ( appendix 2A), prepared with molecular‐biology‐grade ingredients
  • Chloroform, molecular biology grade
  • 10 M ammonium acetate
  • 1 µg/µl glycogen carrier (Boehringer Mannheim)
  • 100% ethanol (molecular‐biology grade; Sigma), −20°C
  • 70% (v/v) ethanol diluted with DEPC‐treated H 2O, ice cold
  • 5× Klenow buffer (Stratagene)
  • 0.25 mM dCTP
  • 2.5 mM 3dNTP mix (2.5 mM each dATP, dGTP, and dTTP)
  • 1 mM cyanine‐3‐ and cyanine‐5‐dCTP (Cy3‐ and Cy5‐dCTP; GE Healthcare)
  • 5 U/µl Klenow fragment (exo) (Stratagene)
  • 3 M sodium acetate, pH 5.2 ( appendix 2A)
  • Hybridization buffer (see recipe)
  • 2× SSC ( appendix 2A)
  • 0.2× and 2× SSC/0.1% SDS
  • Microarray (commercial or custom made; see and Internet Resources)
  • Additional reagents and equipment for cDNA labeling and detection (see ) and measuring DNA concentration by absorption spectroscopy ( appendix 1K)
NOTE: Unless otherwise mentioned, all reagents are available from Invitrogen.

Alternate Protocol 1: Direct Labeling using Reverse Transcriptase

  • 100 mM 3dNTP mix (100 mM each dATP, dGTP, and dTTP; store up to several months at −20°C)
  • 100 mM dCTP
  • 0.5 µg/µl oligo(dT) 18‐20
  • 1 mM cyanine‐3‐ and cyanine‐5‐dCTP (Cy3‐dCTP and Cy5‐dCTP; Amersham Pharmacia Biotech)
  • 20 mM EDTA, pH 8.0 ( appendix 2A)
  • 0.5 M NaOH
  • 0.5 M HCl
  • 100% isopropanol

Basic Protocol 2: Indirect Labeling and Detection of cDNA using PCR Amplification

  Materials
  • 10 U/µl DpnII and 10× buffer (NEB)
  • 1% and 1.2% agarose gels ( appendix 1N)
  • 1× TAE electrophoresis buffer ( appendix 1N)
  • T4 DNA ligase and 10× buffer (NEB)
  • 10 mM ATP
  • 2 µg/µl custom‐synthesized oligonucleotide adaptors R1 and R2 ( appendix 1A):
    • R1: 5′‐AGCACTCTCCAGCCTCTCACCGCA‐3′
    • R2: 5′‐GATCTGCGGTGAGAGGCTGGAGAGTGCT‐3′
  • 10× PCR reaction buffer (Qiagen)
  • 25 mM MgCl 2 (Qiagen)
  • 10 mM 4dNTP mix (10 mM each dATP, dCTP, dGTP, and dTTP)
  • 5 U/µl Taq DNA polymerase (Qiagen) or AmpliTaq DNA polymerase (Perkin‐Elmer)
  • Small thin‐walled PCR tubes
  • Thermal cycler (e.g., Perkin‐Elmer 9600 PCR machine with heated lid)
  • Additional reagents and equipment for cDNA labeling and detection (see ), synthesis of double‐stranded cDNA ( protocol 1), restriction endonuclease digestion ( appendix 1M), agarose gel electrophoresis ( appendix 1N), and measuring DNA concentration by absorption spectroscopy ( appendix 1K)

Basic Protocol 3: Modified T7‐Based Two‐Round Amplification for Small Quantities of RNA Derived Through Laser Capture Microdissection (LCM) or Fluorescence‐Assisted Cell Sorting (FACS)

  Materials
  • 2‐mercaptoethanol (2‐ME)
  • RNeasy Mini Kit (Qiagen) including:
    • Buffer RLT
    • Buffer RPE (concentrate)
    • RNase‐free H 2O
    • Carrier RNA
    • RNeasy MinElute Spin Columns in 2‐ml collection tubes
    • Buffer RW1
  • 96% to 100% ethanol
  • Total RNA sample (e.g., from protocol 5 or protocol 62)
  • Molecular‐biology‐grade H 2O (RNase‐, DNase‐, and protease‐free)
  • Low RNA Input Linear Amplification Kit PLUS Two‐Color (Agilent) including:
    • T7 promoter primer
    • 5× first strand buffer
    • 0.1 M DTT
    • 10 mM dNTP mix
    • MMLV Reverse Transcriptase (RT)
    • RNase Inhibitor
    • 4× transcription buffer
    • NTP mix
    • Inorganic pyrophosphatase
    • T7 RNA polymerase
    • 50% polyethylene glycol (PEG)
    • Cyanine 3‐CTP
    • Cyanine 5‐CTP
  • RNeasy Mini spin columns
  • Hybridization kit (Agilent) including:
    • 10× control targets/blocking agent
    • 25× fragmentation buffer
    • 2× hybridization buffer
    • Wash solution 1
    • Wash solution 2
    • Stabilization and drying solution
  • ND‐1000 spectrophotometer (NanoDrop Technologies) or Agilent Bioanalyzer 2100
  • Microarray slides (e.g., Agilent)
  • Additional reagents and equipment for cDNA labeling and detection (see )

Support Protocol 1: Laser Capture Microdissection (LCM)

  Materials
  • Slide‐mounted tissue sections of interest (e.g., unit 1.1)
  • 75% and 95% ethanol prepared using molecular‐biology‐grade (RNase‐, DNase‐, and protease‐free) H 2O
  • 0.5% cresyl violet solution (see recipe)
  • 100% ethanol (molecular‐biology‐grade)
  • Xylene (molecular‐biology‐grade)
  • Coplin jars or staining dishes
  • PixCell IIe LCM System (Arcturus, Molecular Probes) or newer model

Support Protocol 2: Enzymatic Dissociation and Fluorescence‐Assisted Cell Sorting (FACS) of the Genetically Labeled Neurons from BAC‐EGFP Transgenic Mice

  Materials
  • Freshly removed laboratory animal brain (e.g., from BAC‐EGFP transgenic mice)
  • Papain Dissociation System Kit (Worthington) including:
    • Vial 1: Earle's Balanced Salt Solution (EBSS)
    • Vial 2: papain‐containing L‐cysteine and EDTA
    • Vial 3: Deoxyribonuclease I (DNase)
    • Vial 4: Albumin ovomucoid inhibitor (AOI)
  • FACS buffer (see recipe)
  • 1 mg/ml propidium iodide (PI)
  • Rocking platform (optional)
  • Three manually pulled glass pipets of decreasing (0.1‐ to 0.2‐mm) tip diameter
  • Refrigerated centrifuge and sterile centrifuge tubes
  • FACS tubes
  • FACS instrument (e.g., FACSVantage SE Cell Sorter; BD Biosciences)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 4.28.1 Amplicon synthesis and labeling flow chart and time considerations.

Videos

Literature Cited

   Altman, N. 2005. Replication, variation and normalisation in microarray experiments. Appl. Bioinformatics 4:33‐44.
   Arlotta, P., Molyneaux, B.J., Chen, J., Inoue, J., Kominami, R., and Macklis, J.D. 2005. Neuronal subtype‐specific genes that control corticospinal motor neuron development in vivo. Neuron 45:207‐221.
   Aubert, J., Stavridis, M.P., Tweedie, S., O'Reilly, M., Vierlinger, K., Li, M., Ghazal, P., Pratt, T., Mason, J.O., Roy, D., and Smith, A. 2003. Screening for mammalian neural genes via fluorescence‐activated cell sorter purification of neural precursors from Sox1‐gfp knock‐in mice. Proc. Natl. Acad. Sci. U.S.A. 100:11836‐11841.
   Becker, I., Becker, K.F., Rohrl, M.H., Minkus, G., Schutze, K., and Hofler, H. 1996. Single‐cell mutation analysis of tumors from stained histologic slides. Lab. Invest. 75:801‐807.
   Blackshaw, S., Fraioli, R.E., Furukawa, T., and Cepko, C.L. 2001. Comprehensive analysis of photoreceptor gene expression and the identification of candidate retinal disease genes. Cell 107:579‐589.
   Brown, P.O. and Botstein, D. 1999. Exploring the new world of the genome with DNA microarrays. Nat. Genet. 21:33‐37.
   Brown, V., Jin, P., Ceman, S., Darnell, J.C., O'Donnell, WT., Tenenbaum, S.A., Jin, X., Feng, Y., Wilkinson, K.D., Keene, J.D., Darnell, R.B., and Warren, S.T. 2001. Microarray identification of FMRP‐associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome. Cell 107:477‐487.
   Chan, V., Graves, D.J., and McKenzie, S.E. 1995. The biophysics of DNA hybridization with immobilized oligonucleotide probes. Biophys. J. 69:2243‐2255.
   Chung, C.Y., Seo, H., Sonntag, K.C., Brooks, A., Lin, L., and Isacson, O. 2005. Cell type‐specific gene expression of midbrain dopaminergic neurons reveals molecules involved in their vulnerability and protection. Hum. Mol. Genet. 14:1709‐1725.
   Coppola, G. and Geschwind, D.H. 2006. Microarrays and the microscope: Balancing throughput with resolution. J. Physiol. 575:353‐359.
   de With, A. and Greulich, K.O. 1995. Wavelength dependence of laser‐induced DNA damage in lymphocytes observed by single‐cell gel electrophoresis. J. Photochem. Photobiol. B 30:71‐76.
   DeRisi, J., Penland, L., Brown, P.O., Bittner, M.L., Meltzer, P.S., Ray, M., Chen, Y., Su, Y.A., and Trent, J.M. 1996. Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat. Genet. 14:457‐460.
   DeRisi, J.L., Iyer, V.R., and Brown, P.O. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278:680‐686.
   Dougherty, J.D. and Geschwind, D.H. 2002. Subtraction‐coupled custom microarray analysis for gene discovery and gene expression studies in the CNS. Chem. Senses 27:293‐298.
   Eberwine, J., Yeh, H., Miyashiro, K., Cao, Y., Nair, S., Finnell, R., Zettel, M., and Coleman, P. 1992. Analysis of gene expression in single live neurons. Proc. Natl. Acad. Sci. U.S.A. 89:3010‐3014.
   Fodor, S.P., Read, J.L., Pirrung, M.C., Stryer, L., Lu, A.T., and Solas, D. 1991. Light‐directed, spatially addressable parallel chemical synthesis. Science 251:767‐773.
   Geschwind, D.H. 2000. Mice, microarrays, and the genetic diversity of the brain. Proc. Natl. Acad. Sci. U.S.A. 97:10676‐10678.
   Geschwind, D.H. and Gregg, J.P. 2002. Microarrays For the Neurosciences: An Essential Guide. MIT Press, Cambridge, Mass.
   Geschwind, D.H., Ou, J., Easterday, M.C., Dougherty, J.D., Jackson, R.L., Chen, Z., Antoine, H., Terskikh, A., Weissman, I.L., Nelson, S.F., and Kornblum, H.I. 2001. A genetic analysis of neural progenitor differentiation. Neuron 29:325‐339.
   Ghorbel, M.T., Sharman, G., Hindmarch, C., Becker, K.G., Barrett, T., and Murphy, D. 2006. Microarray screening of suppression subtractive hybridization‐PCR cDNA libraries identifies novel RNAs regulated by dehydration in the rat supraoptic nucleus. Physiol. Genomics 24:163‐172.
   Ginsberg, S.D. and Mirnics, K. 2006. Functional genomic methodologies. Prog. Brain Res. 158:15‐40.
   Ginsberg, S.D., Crino, P.B., Hemby, S.E., Weingarten, J.A., Lee, V.M., Eberwine, J.H., and Trojanowski, J.Q. 1999. Predominance of neuronal mRNAs in individual Alzheimer's disease senile plaques. Ann. Neurol. 45:174‐81.
   Gregg, J. and Baldwin, D. 2001. Microarrays: An introduction. In Microarrays: The New Frontier in Gene Discovery and Gene Expression Analysis. (Society for Neuroscience Short Course Syllabus, Society for Neuroscience, Washington, D.C.
   Gris, P., Murphy, S., Jacob, J.E., Atkinson, I., and Brown, A. 2003. Differential gene expression profiles in embryonic, adult‐injured and adult‐uninjured rat spinal cords. Mol. Cell. Neurosci. 24:555‐567.
   Harmer, S.L., Hogenesch, J.B., Straume, M., Chang, H.S., Han, B., Zhu, T., Wang, X., Kreps, J.A., and Kay, S.A. 2000. Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science 290:2110‐2113.
   Horvath, S., Zhang, B., Carlson, M., Lu, K.V., Zhu, S., Felciano, R.M., Laurance, M.F., Zhao, W., Qi, S., Chen, Z., Lee, Y., Scheck, A.C., Liau, L.M., Wu, H., Geschwind, D.H., Febbo, P.G., Kornblum, H.I., Cloughesy, T.F., Nelson, S.F., and Mischel, P.S. 2006. Analysis of oncogenic signaling networks in glioblastoma identifies ASPM as a molecular target. Proc. Natl. Acad. Sci. U.S.A. 103:17402‐17407.
   Ibrahim, S.F. and Van Den Engh, G. 2003. High‐speed cell sorting: Fundamentals and recent advances. Curr. Opin. Biotechnol. 14:5‐12.
   Kacharmina, J.E., Crino, P.B., and Eberwine, J. 1999. Preparation of cDNA from single cells and subcellular regions. Methods Enzymol. 303:3‐18.
   Kamme, F., Salunga, R., Yu, J., Tran, D.T., Zhu, J., Luo, L., Bittner, A., Guo, H.Q., Miller, N., Wan, J., and Erlander, M. 2003. Single‐cell microarray analysis in hippocampus CA1: Demonstration and validation of cellular heterogeneity. J. Neurosci. 23:3607‐3615.
   Karsten, S.L., Van Deerlin, V.M., Sabatti, C., Gill, L.H., and Geschwind, D.H. 2002. An evaluation of tyramide signal amplification and archived fixed and frozen tissue in microarray gene expression analysis. Nucleic Acids Res. 30:E4.
   Karsten, S.L., Kudo, L.C., Jackson, R., Sabatti, C., Kornblum, H.I., and Geschwind, D.H. 2003. Global analysis of gene expression in neural progenitors reveals specific cell‐cycle, signaling, and metabolic networks. Dev. Biol. 261:165‐182.
   Karsten, S.L., Sang, T.K., Gehman, L.T., Chatterjee, S., Liu, J., Lawless, G.M., Sengupta, S., Berry, R.W., Pomakian, J., Oh, H.S., Schulz, C., Hui, K.S., Wiedau‐Pazos, M., Vinters, H.V., Binder, L.I., Geschwind, D.H., and Jackson, G.R. 2006. A genomic screen for modifiers of tauopathy identifies puromycin‐sensitive aminopeptidase as an inhibitor of tau‐induced neurodegeneration. Neuron 51:549‐560.
   Kerr, M.K., Martin, M., and Churchill, G.A. 2000. Analysis of variance for gene expression microarray data. J. Comput. Biol. 7:819‐837.
   Kudo, L.C., Karsten, S.L., Chen, J., Levitt, P., and Geschwind, D.H. 2006. Genetic analysis of anterior‐posterior expression gradients in the developing mammalian forebrain. Cereb. Cortex 17;2108‐2122.
   Kuhn, K., Baker, S.C., Chudin, E., Lieu, M.H., Oeser, S., Bennett, H., Rigault, P., Barker, D., McDaniel, T.K., and Chee, M.S. 2004. A novel, high‐performance random array platform for quantitative gene expression profiling. Genome Res. 14:2347‐2356.
   Lazarov, O., Robinson, J., Tang, Y.P., Hairston, I.S., Korade‐Mirnics, Z., Lee, V.M., Hersh, L.B., Sapolsky, R.M., Mirnics, K., and Sisodia, S.S. 2005. Environmental enrichment reduces Abeta levels and amyloid deposition in transgenic mice. Cell 120:701‐713.
   Lee, M.L., Kuo, F.C., Whitmore, G.A., and Sklar, J. 2000. Importance of replication in microarray gene expression studies: Statistical methods and evidence from repetitive cDNA hybridizations. Proc. Natl. Acad. Sci. U.S.A. 97:9834‐9839.
   Lefebvre d'Hellencourt, C. and Harry, G.J. 2005. Molecular profiles of mRNA levels in laser capture microdissected murine hippocampal regions differentially responsive to TMT‐induced cell death. J. Neurochem. 93:206‐220.
   Li, M.Z., Wang, J.S., Jiang, D.J., Xiang, C.X., Wang, F.Y., Zhang, K.H., Williams, P.R., and Chen, Z.F. 2006. Molecular mapping of developing dorsal horn‐enriched genes by microarray and dorsal/ventral subtractive screening. Dev. Biol. 292:555‐564.
   Lipshutz, R.J., Fodor, S.P., Gingeras, T.R., and Lockhart, D.J. 1999. High density synthetic oligonucleotide arrays. Nat. Genet. 21:20‐24.
   Liu, Q.Y., Sooknanan, R.R., Malek, L.T., Ribecco‐Lutkiewicz, M., Lei, J.X., Shen, H., Lach, B., Walker, P.R., Martin, J., and Sikorska, M. 2006. Novel subtractive transcription‐based amplification of mRNA (STAR) method and its application in search of rare and differentially expressed genes in AD brains. BMC Genomics 7:286.
   Lobo, M.K., Karsten, S.L., Gray, M., Geschwind, D.H., and Yang, X.W. 2006. FACS‐array profiling of striatal projection neuron subtypes in juvenile and adult mouse brains. Nat. Neurosci. 9:443‐452.
   Lockhart, D.J. and Winzeler, E.A. 2000. Genomics, gene expression and DNA arrays. Nature 405:827‐836.
   Lockhart, D.J., Dong, H., Byrne, M.C., Follettie, M.T., Gallo, M.V., Chee, M.S., Mittmann, M., Wang, C., Kobayashi, M., Horton, H., and Brown, E.L. 1996. Expression monitoring by hybridization to high‐density oligonucleotide arrays. Nat. Biotechnol. 14:1675‐1680.
   Luo, Z. and Geschwind, D.H. 2001. Microarray applications in neuroscience. Neurobiol. Dis. 8:183‐193.
   Luo, L., Salunga, R.C., Guo, H., Bittner, A., Joy, K.C., Galindo, J.E., Xiao, H., Rogers, K.E., Wan, J.S., Jackson, M.R., and Erlander, M.G. 1999. Gene expression profiles of laser‐captured adjacent neuronal subtypes. Nat. Med. 5:117‐122.
   Ma, C., Lyons‐Weiler, M., Liang, W., LaFramboise, W., Gilbertson, J.R., Becich, M.J., and Monzon, F.A. 2006. In vitro transcription amplification and labeling methods contribute to the variability of gene expression profiling with DNA microarrays. J. Mol. Diagn. 8:183‐192.
   Malyala, A., Pattee, P., Nagalla, S.R., Kelly, M.J., and Ronnekleiv, O.K. 2004. Suppression subtractive hybridization and microarray identification of estrogen‐regulated hypothalamic genes. Neurochem. Res. 29:1189‐1200.
   Middleton, F.A., Mirnics, K., Pierri, J.N., Lewis, D.A., and Levitt, P. 2002. Gene expression profiling reveals alterations of specific metabolic pathways in schizophrenia. J. Neurosci. 22:2718‐2729.
   Mirnics, K. and Pevsner, J. 2004. Progress in the use of microarray technology to study the neurobiology of disease. Nat. Neurosci. 7:434‐439.
   Mirnics, K., Middleton, F.A., Marquez, A., Lewis, D.A., and Levitt, P. 2000. Molecular characterization of schizophrenia viewed by microarray analysis of gene expression in prefrontal cortex. Neuron 28:53‐67.
   Mirnics, K., Middleton, F.A., Lewis, D.A., and Levitt, P. 2001. Analysis of complex brain disorders with gene expression microarrays: Schizophrenia as a disease of the synapse. Trends Neurosci. 24:479‐486.
   Mortazavi, A., Williams, B.A., McCue, K., Schaeffer, L., and Wold, B. 2008. Mapping and quantifying mammalian transcriptomes by RNA‐Seq. Nat. Methods 7:621‐628.
   Nishimura, Y., Martin, C.L., Vazquez‐Lopez, A., Spence, S.J., Alvarez‐Retuerto, A.I., Sigman, M., Steindler, C., Pellegrini, S., Schanen, N.C., Warren, S.T., and Geschwind, D.H. 2007. Genome‐wide expression profiling of lymphoblastoid cell lines distinguishes different forms of autism and reveals shared pathways. Hum. Mol. Genet. 14:1628‐1698.
   Oldham, M.C., Horvath, S., and Geschwind, D.H. 2006. Conservation and evolution of gene coexpression networks in human and chimpanzee brains. Proc. Natl. Acad. Sci. U.S.A. 103:17973‐17978.
   Pavlidis, P., Li, Q., and Noble, W.S. 2003. The effect of replication on gene expression microarray experiments. Bioinformatics 19:1620‐1627.
   Pomeroy, S.L., Tamayo, P., Gaasenbeek, M., Sturla, L.M., Angelo, M., McLaughlin, M.E., Kim, J.Y., Goumnerova, L.C., Black, P.M., Lau, C., Allen, J.C., Zagzag, D., Olson, J.M., Curran, T., Wetmore, C., Biegel, J.A., Poggio, T., Mukherjee, S., Rifkin, R., Califano, A., Stolovitzky, G., Louis, D.N., Mesirov, J.P., Lander, E.S., and Golub, T.R. 2002. Prediction of central nervous system embryonal tumour outcome based on gene expression. Nature 415:436‐442.
   Ramdas, L., Wang, J., Hu, L., Cogdell, D., Taylor, E., and Zhang, W. 2001. Comparative evaluation of laser‐based microarray scanners. Biotechniques 31:546.
   Ren, B., Robert, F., Wyrick, J.J., Aparicio, O., Jennings, E.G., Simon, I., Zeitlinger, J., Schreiber, J., Hannett, N., Kanin, E., Volkert, T.L., Wilson, C.J., Bell, S.P., and Young, R.A. 2000. Genome‐wide location and function of DNA binding proteins. Science 290:2306‐2309.
   Rossner, M.J., Hirrlinger, J., Wichert, S.P., Boehm, C., Newrzella, D., Hiemisch, H., Eisenhardt, G., Stuenkel, C., von Ahsen, O., and Nave, K.A. 2006. Global transcriptome analysis of genetically identified neurons in the adult cortex. J. Neurosci. 26:9956‐9966.
   Ryu, E.J., Angelastro, J.M., and Greene, L.A. 2005. Analysis of gene expression changes in a cellular model of Parkinson disease. Neurobiol. Dis. 18:54‐74.
   Sabatti, C., Karsten, S.L., and Geschwind, D.H. 2002. Thresholding rules for recovering a sparse signal from microarray experiments. Math. Biosci. 176:17‐34.
   Sandberg, R., Yasuda, R., Pankratz, D.G., Carter, T.A., Del Rio, J.A., Wodicka, L., Mayford, M., Lockhart, D.J., and Barlow, C. 2000. Regional and strain‐specific gene expression mapping in the adult mouse brain. Proc. Natl. Acad. Sci. U.S.A. 97:11038‐11043.
   Schena, M., Shalon, D., Davis, R.W., and Brown, P.O. 1995. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270:467‐470.
   Schena, M., Heller, R.A., Theriault, T.P., Konrad, K., Lachenmeier, E., and Davis, R.W. 1998. Microarrays: Biotechnology's discovery platform for functional genomics. Trends Biotechnol. 16:301‐306.
   Schutze, K. and Lahr, G. 1998. Identification of expressed genes by laser‐mediated manipulation of single cells. Nat. Biotechnol. 16:737‐742.
   Schutze, K., Posl, H., and Lahr, G. 1998. Laser micromanipulation systems as universal tools in cellular and molecular biology and in medicine. Cell. Mol. Biol. (Noisy‐le‐Grand) 44:735‐746.
   Sharon, D., Blackshaw, S., Cepko, C.L., and Dryja, T.P. 2002. Profile of the genes expressed in the human peripheral retina, macula, and retinal pigment epithelium determined through serial analysis of gene expression (SAGE). Proc. Natl. Acad. Sci. U.S.A. 99:315‐320.
   Sharp, F.R., Xu, H., Lit, L., Walker, W., Apperson, M., Gilbert, D.L., Glauser, T.A., Wong, B., Hershey, A., Liu, D.Z., Pinter, J., Zhan, X., Liu, X., and Ran, R. 2006. The future of genomic profiling of neurological diseases using blood. Arch. Neurol. 63:1529‐1536.
   Simone, N.L., Bonner, R.F., Gillespie, J.W., Emmert‐Buck, M.R., and Liotta, L.A. 1998. Laser‐capture microdissection: Opening the microscopic frontier to molecular analysis. Trends Genet. 14:272‐276.
   Sorlie, T., Perou, C.M., Tibshirani, R., Aas, T., Geisler, S., Johnsen, H., Hastie, T., Eisen, M.B., van de Rijn, M., Jeffrey, S.S., Thorsen, T., Quist, H., Matese, J.C., Brown, P.O., Botstein, D., Eystein Lonning, P., and Borresen‐Dale, A.L. 2001. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. U.S.A. 98:10869‐10874.
   Spellman, P.T., Sherlock, G., Zhang, M.Q., Iyer, V.R., Anders, K., Eisen, M.B., Brown, P.O., Botstein, D., and Futcher, B. 1998. Comprehensive identification of cell cycle‐regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol. Biol. Cell 9:3273‐3297.
   Srinivasan, R. 1986. Ablation of polymers and biological tissue by ultraviolet lasers. Science 234:559‐565.
   Stears, R.L., Getts, R.C., and Gullans, S.R. 2000. A novel, sensitive detection system for high‐density microarrays using dendrimer technology. Physiol. Genomics 3:93‐99.
   Tang, Y., Lu, A., Aronow, B.J., and Sharp, F.R. 2001. Blood genomic responses differ after stroke, seizures, hypoglycemia, and hypoxia: Blood genomic fingerprints of disease. Ann. Neurol. 50:699‐707.
   Tkatchenko, A.V., Walsh, P.A., Tkatchenko, T.V., Gustincich, S., and Raviola, E. 2006. Form deprivation modulates retinal neurogenesis in primate experimental myopia. Proc. Natl. Acad. Sci. U.S.A. 103:4681‐4686.
   Tseng, G.C., Oh, M.K., Rohlin, L., Liao, J.C., and Wong, W.H. 2001. Issues in cDNA microarray analysis: quality filtering, channel normalization, models of variations and assessment of gene effects. Nucleic Acids Res. 29:2549‐2557.
   van 't Veer, L.J., Dai, H., van de Vijver, M.J., He, Y.D., Hart, A.A., Mao, M., Peterse, H.L., van der Kooy, K., Marton, M.J., Witteveen, A.T., Schreiber, G.J., Kerkhoven, R.M., Roberts, C., Linsley, P.S., Bernards, R., and Friend, S.H. 2002. Gene expression profiling predicts clinical outcome of breast cancer. Nature 415:530‐536.
   van Haaften, R.I., Schroen, B., Janssen, B.J., van Erk, A., Debets, J.J., Smeets, H.J., Smits, J.F., van den Wijngaard, A., Pinto, Y.M., and Evelo, C.T. 2006. Biologically relevant effects of mRNA amplification on gene expression profiles. BMC Bioinformatics 7:200.
   Velculescu, V.E., Zhang, L., Vogelstein, B., and Kinzler, K.W. 1995. Serial analysis of gene expression. Science 270:484‐487.
   Wei, C., Li, J., and Bumgarner, R.E. 2004. Sample size for detecting differentially expressed genes in microarray experiments. BMC Genomics 5:87.
   Welford, S.M., Gregg, J., Chen, E., Garrison, D., Sorensen, P.H., Denny, C.T., and Nelson, S.F. 1998. Detection of differentially expressed genes in primary tumor tissues using representational differences analysis coupled to microarray hybridization. Nucleic Acids Res. 26:3059‐3065.
   Whetsell, L., Maw, G., Nadon, N., Ringer, D.P., and Schaefer, F.V. 1992. Polymerase chain reaction microanalysis of tumors from stained histological slides. Oncogene 7:2355‐2361.
   Whitney, L.W. and Becker, K.G. 2001. Radioactive 33‐P probes in hybridization to glass cDNA microarrays using neural tissues. J. Neurosci. Methods 106:9‐13.
   Whitney, L.W., Becker, K.G., Tresser, N.J., Caballero‐Ramos, C.I., Munson, P.J., Prabhu, V.V., Trent, J.M., McFarland, H.F., and Biddison, W.E. 1999. Analysis of gene expression in mutiple sclerosis lesions using cDNA microarrays. Ann. Neurol. 46:425‐428.
   Wolber, P.K., Collins, P.J., Lucas, A.B., De Witte, A., and Shannon, K.W. 2006. The Agilent in situ‐synthesized microarray platform. Methods Enzymol. 410:28‐57.
   Yamazaki, H., Sekiguchi, M., Takamatsu, M., Tanabe, Y., and Nakanishi, S. 2004. Distinct ontogenic and regional expressions of newly identified Cajal‐Retzius cell‐specific genes during neocorticogenesis. Proc. Natl. Acad. Sci. U.S.A. 101:14509‐14514.
   Yang, G.P., Ross, D.T., Kuang, W.W., Brown, P.O., and Weigel, R.J. 1999. Combining SSH and cDNA microarrays for rapid identification of differentially expressed genes. Nucleic Acids Res. 27:1517‐1523.
   Yue, H., Eastman, P.S., Wang, B.B., Minor, J., Doctolero, M.H., Nuttall, R.L., Stack, R., Becker, J.W., Montgomery, J.R., Vainer, M., and Johnston, R. 2001. An evaluation of the performance of cDNA microarrays for detecting changes in global mRNA expression. Nucleic Acids Res. 29:E41‐41.
   Zhang, B. and Horvath, S. 2005. A general framework for weighted gene co‐expression network analysis. Stat. Appl. Genet. Mol. Biol. 4:Article17. Epub 2005 Aug 12.
Key References
   DeRisi et al., 1997. See above.
  Tour de force analysis of yeast gene expression done in the laboratory that started it all.
   Geschwind et al., 2001. See above.
  This paper demonstrates the power of using custom microarrays derived from RDA‐subtracted libraries for gene discovery and gene expression analysis in the central nervous system. It also emphasizes the utility of coupling microarray studies with methods such as in situ hybridization that provide high spatial resolution.
   Arlotta et al., 2005. See above.
  These two papers provide a first successful demonstration of automated cell sorting for collection of the genetically labeled neuronal subtypes and their subsequent analysis using high‐density oligonucleotide microarrays during development (Arlotta et al., ) and in adult tissue (Lobo et al., ). Detailed protocols are described and the specificity of microarray data is confirmed functionally from both young and adult animals.
   Lobo et al., 2006. See above.
  In this paper, laser capture microdissection (LCM) is coupled with microarray experiments to study gene expression in single neuronal types for the first time.
   Luo et al., 1999. See above.
  In this seminal paper, microarray analysis of human post‐mortem tissues is aimed to advance understanding of a complex neuropsychiatric disorder, schizophrenia.
   Mirnics et al., 2000. See above.
  Demonstration of the use of peripheral lymphoblasts from patients to identify changes in a complex disease of the brain (autism). This study showed that this approach could be used to identify expression changes that were relevant to the nervous system by validating changes in vivo in mice and in vitro in a neuronal cell line.
   Nishimura et al., 2007. See above.
  First demonstration of the power of network methods (systems biology) to identify key drivers of disease‐relevant biological alterations. Here, new therapeutic targets were identified in brain tumors.
   Horvath et al., 2006. See above.
  Seminal use of microarray technology for expression profiling used to classify CNS tumors and define prognosis.
   Pomeroy et al., 2002. See above.
  This important study demonstrates importance of strain background on gene expression in mice.
   Sandberg et al., 2000. See above.
  This seminal paper is the first demonstration of cDNA microarray analysis for high‐throughput gene expression studies.
   Schena et al., 1995. See above.
  The results presented demonstrate the reproducibility and reliability of cDNA microarray technology.
   Yue et al., 2001. See above.
Internet Resources
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library