Daun02 Inactivation of Behaviorally Activated Fos‐Expressing Neuronal Ensembles

Eisuke Koya1, Gabriella Margetts‐Smith1, Bruce T. Hope2

1 School of Psychology, University of Sussex, Falmer, United Kingdom, 2 NIDA IRP, NIDA/NIH/DHHS, Baltimore, Maryland
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 8.36
DOI:  10.1002/cpns.2
Online Posting Date:  July, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Learned associations about salient experiences (e.g., drug exposure, stress) and their associated environmental stimuli are mediated by a minority of sparsely distributed, behaviorally activated neurons coined ‘neuronal ensembles.’ For many years, it was not known whether these neuronal ensembles played causal roles in mediating learned behaviors. However, in the last several years the ‘Daun02 inactivation technique’ in Fos‐lacZ transgenic rats has proved very useful in establishing causal links between neuronal ensembles that express the activity‐regulated protein Fos and learned behaviors. Fos‐expressing neurons in these rats also express the bacterial protein β‐galactosidase (β‐gal) in strongly activated neurons. When the prodrug Daun02 is injected into the brains of these rats 90 min after a behavior (e.g., drug‐seeking) or cue exposure, then Daun02 is converted into daunorubicin by β‐gal, which selectively inactivates Fos‐ and β‐gal‐expressing neurons that were activated 90 min before the Daun02 injection. This unit presents protocols for breeding the Fos‐lacZ rats and conducting appropriate Daun02 inactivation experiments. © 2016 by John Wiley & Sons, Inc.

Keywords: Daun02 inactivation; Fos‐lacZ rats; neuronal ensemble inactivation

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Breeding and Genotyping of Fos‐LacZ Transgenic Rats
  • Basic Protocol 2: Preparation of Daun02
  • Basic Protocol 3: Surgical Procedures for Guide Cannula Implantation for Rat
  • Basic Protocol 4: Intracranial Infusions of Daun02 and Subsequent Behavioral Testing
  • Basic Protocol 5: Transcardial Perfusions for X‐gal Staining (or Immunohistochemistry For β‐gal or fos) Following the Final Behavioral Test
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Breeding and Genotyping of Fos‐LacZ Transgenic Rats

  Materials
  • Sprague‐Dawley rat
  • Local (e.g., lidocaine cream) or general anesthetic (e.g., isoflurane)
  • 70% ethanol
  • Cauterizing agent (e.g., silver nitrate)
  • 50 mM NaOH (e.g., Sigma, cat. no. 72068‐100ML)
  • 1 M Tris·HCl, pH 8.0 (e.g., Sigma, cat. no. T2694‐1L)
  • OneTaq 2× Master Mix (New England Biolabs, cat. no. M0482S)
  • PCR primers:
  • Forward sequence: GTTGCAGTGCACGGCAGATACACTTGCTGA
  • Reverse sequence: GCCACTGGTGTGGGCCATAATTCAATTCGC
  • 2% agarose gel
  • 1× TAE buffer (e.g., ThermoFisher Scientific cat. no. 15558‐026)
  • Ear punch collector (e.g., Fine Science Tools, cat. no. 24212‐02)
  • Sterile blade or scissors
  • 1.5‐ml microcentrifuge tubes
  • 95°C incubator
  • Vortex
  • Microcentrifuge
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 1N)

Basic Protocol 2: Preparation of Daun02

  Materials
  • Daun02 (e.g., Sequoia Research Products, cat. no. SRP04000g)
  • DMSO (e.g., Sigma, cat. no. D8418‐50ML)
  • 20% Tween‐80 (e.g., Sigma, cat. no. P4780‐100ML)
  • PBS, sterile (e.g., Sigma, cat. no. P5493‐1L)
  • aCSF (e.g, Tocris, cat. no. 3525)
  • 1.5‐ml microcentrifuge tube (made from DMSO‐compatible material)
  • Vortex
  • Microcentrifuge

Basic Protocol 3: Surgical Procedures for Guide Cannula Implantation for Rat

  Materials
  • Fos‐lacZ rat
  • Anesthesia (e.g., isoflurane/air mixture or ketamine and xylazine) that will last for the duration of surgery (∼1 hr)
  • Atropine sulfate
  • Betadine
  • 70% ethanol
  • Dental acrylic (e.g., Plastics One)
  • Stereotaxic atlas for rat (e.g., Paxinos and Watson, )
  • Shaver
  • Stereotaxic frame equipped with carrier for guide cannula (e.g., David Kopf Instruments, Stoelting)
  • Scalpel
  • Serrefine forceps or hemostats
  • Metal spatula
  • Cotton swabs or dental cotton rolls
  • Dental drill with appropriate drill bits
  • Jeweler's forceps and screwdriver
  • Bone screws: 4.8 mm shaft length, 2.5 mm head diameter, 1.57 mm shaft diameter (Plastics One, cat. no. 0‐80 × 3/16)
  • Cannula infusion system with guide, dummy, and 23‐G internal cannula (e.g., Plastics One)
  • Fine‐tipped felt pen
  • Heating blanket
  • Thermometer

Basic Protocol 4: Intracranial Infusions of Daun02 and Subsequent Behavioral Testing

  Materials
  • Fos‐lacZ rat with implanted guide cannula (see protocol 3)
  • Vehicle solution (see protocol 2)
  • 4 μg/μl Daun02 solution, room temperature (see protocol 2)
  • 70% ethanol
  • 4% (w/v) paraformaldehyde (optional)
  • Dummy injector needle
  • Flexible plastic tubing
  • 10‐μl Hamilton syringes equipped with 30‐G needle
  • Infusion pump (Harvard Apparatus, item 70‐2001)
  • Sterile gauze

Basic Protocol 5: Transcardial Perfusions for X‐gal Staining (or Immunohistochemistry For β‐gal or fos) Following the Final Behavioral Test

  Materials
  • PBS, pH 7.4 (Sigma, cat. no. P5493‐1L)
  • 4% (w/v) paraformaldehyde (PFA; Sigma, cat. no. P6148‐1KG)
  • 30% (w/v) sucrose in PBS (see recipe)
  • Behaviorally tested and Daun02‐ or vehicle‐injected rat (see protocol 4)
  • General anesthetic (e.g., isoflurane, ketamine and xylazine)
  • 0.02% (w/v) sodium azide in PBS
  • X‐gal solution (see recipe)
  • 70%, 80%, 95%, and 100% ethanol
  • Clearing agent (e.g., CitriSolv, VWR, cat. no. 89426‐268; Histoclear III, AGTC Bioproducts, cat. no. HS‐204)
  • Mounting medium (e.g., Permount, Fisher Scientific, cat. no. SP15‐500; Histomount, National Diagnostics, cat. no. HS‐103)
  • Peristaltic pump attached to an IV line with 16‐G blunt‐end needle
  • Glass desiccator (if using isoflurane)
  • Scissors, large‐ and small‐sized
  • Hemostat
  • Forceps
  • Rat guillotine (e.g., Kent Scientific)
  • Rongeurs
  • Spatula
  • 50‐ml conical tube
  • Cryostat
  • Corning Costar 6‐well cell culture plates (Sigma, cat. no. CLS3516)
  • Corning Netwells inserts, 24 mm diam. (Sigma, cat. no. CLS3480)
  • 37°C shaking incubator or water bath
  • Chrome‐alum coated glass slides (e.g., SuperFrost Plus, Fisher Scientific, cat. no. 22‐037‐246)
  • Bright field microscope
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Assi, H., Candolfi, M., Lowenstein, P.R., and Castro, M.G. 2013. Rodent Glioma Models: Intracranial Stereotactic Allografts and Xenografts. Humana Press, Totowa, N.J.
  Bossert, J.M., Stern, A.L., Theberge, F.R., Cifani, C., Koya, E., Hope, B.T., and Shaham, Y. 2011. Ventral medial prefrontal cortex neuronal ensembles mediate context‐induced relapse to heroin. Nat. Neurosci. 14:420‐422. doi: 10.1038/nn.2758.
  Cruz, F.C., Koya, E., Guez‐Barber, D.H., Bossert, J.M., Lupica, C.R., Shaham, Y., and Hope, B.T. 2013. New technologies for examining neuronal ensembles in drug addiction and fear. Nat. Rev. Neurosci. 14:743‐754. doi: 10.1038/nrn3597.
  Cruz, F.C., Babin, K.R., Leao, R.M., Goldart, E.M., Bossert, J.M., Shaham, Y., and Hope, B.T. 2014a. Role of nucleus accumbens shell neuronal ensembles in context‐induced reinstatement of cocaine‐seeking. J. Neurosci. 34:7437‐7446. doi: 10.1523/JNEUROSCI.0238‐14.2014.
  Cruz, F.C., Javier Rubio, F., and Hope, B.T. 2014b. Using c‐fos to study neuronal ensembles in corticostriatal circuitry of addiction. Brain Res. 1628:157‐173. doi: 10.1016/j.brainres.2014.11.005.
  Fanous, S., Goldart, E.M., Theberge, F.R., Bossert, J.M., Shaham, Y., and Hope, B.T. 2012. Role of orbitofrontal cortex neuronal ensembles in the expression of incubation of heroin craving. J. Neurosci. 32:11600‐11609. doi: 10.1523/JNEUROSCI.1914‐12.2012.
  Farquhar, D., Pan, B.F., Sakurai, M., Ghosh, A., Mullen, C.A., and Nelson, J.A. 2002. Suicide gene therapy using E. coli beta‐galactosidase. Cancer Chemother. Pharmacol. 50:65‐70. doi: 10.1007/s00280‐002‐0438‐2.
  Fornari, R.V., Wichmann, R., Atsak, P., Atucha, E., Barsegyan, A., Beldjoud, H., Messanvi, F., Thuring, C.M., and Roozendaal, B. 2012. Rodent stereotaxic surgery and animal welfare outcome improvements for behavioral neuroscience. J. Vis. Exp. 59:e3528. doi: 10.3791/3528.
  Guzowski, J.F. 2002. Insights into immediate‐early gene function in hippocampal memory consolidation using antisense oligonucleotide and fluorescent imaging approaches. Hippocampus 12:86‐104. doi: 10.1002/hipo.10010.
  Herdegen, T. and Leah, J.D. 1998. Inducible and constitutive transcription factors in the mammalian nervous system: Control of gene expression by Jun, Fos and Krox, and CREB/ATF proteins. Brain Res. Rev. 28:370‐490. doi: 10.1016/S0165‐0173(98)00018‐6.
  John, E.R. and Schwartz, E.L. 1978. The neurophysiology of information processing and cognition. Annu. Rev. Psychol. 29:1‐29. doi: 10.1146/annurev.ps.29.020178.000245.
  Koya, E., Golden, S.A., Harvey, B.K., Guez‐Barber, D.H., Berkow, A., Simmons, D.E., Bossert, J.M., Nair, S.G., Uejima, J.L., Marin, M.T., Mitchell, T.B., Farquhar, D., Ghosh, S.C., Mattson, B.J., and Hope, B.T. 2009. Targeted disruption of cocaine‐activated nucleus accumbens neurons prevents context‐specific sensitization. Nat. Neurosci. 12:1069‐1073. doi: 10.1038/nn.2364.
  Ma, W., Rogers, K., Zbar, B., and Schmidt, L. 2002. Effects of different fixatives on beta‐galactosidase activity. J. Histochem. Cytochem. 50:1421‐1424. doi: 10.1177/002215540205001015.
  Morgan, J.I. and Curran, T. 1988. Calcium as a modulator of the immediate‐early gene cascade in neurons. Cell Calcium 9:303‐311. doi: 10.1016/0143‐4160(88)90011‐5.
  Morgan, J.I. and Curran, T. 1991. Stimulus‐transcription coupling in the nervous system: Involvement of the inducible proto‐oncogenes fos and jun. Annu. Rev. Neurosci. 14:421‐451. doi: 10.1146/annurev.ne.14.030191.002225.
  Mountcastle, V.B. 1957. Modality and topographic properties of single neurons of cat's somatic sensory cortex. J. Neurophysiol. 20:408‐434.
  O'Keefe, J. and Dostrovsky, J. 1971. The hippocampus as a spatial map. Preliminary evidence from unit activity in the freely‐moving rat. Brain Res. 34:171‐175. doi: 10.1016/0006‐8993(71)90358‐1.
  Paxinos, G. and Watson C. 2006. The Rat Brain in Stereotactic Coordinates, 6th ed. Academic Press, New York.
  Pfarr, S., Meinhardt, M.W., Klee, M.L., Hansson, A.C., Vengeliene, V., Schonig, K., Bartsch, D., Hope, B.T., Spanagel, R., and Sommer, W.H. 2015. Losing control: Excessive alcohol seeking after selective inactivation of cue‐responsive neurons in the infralimbic cortex. J. Neurosci. 35:10750‐10761. doi: 10.1523/JNEUROSCI.0684‐15.2015.
  Rousselle, C., Clair, P., Lefauconnier, J.M., Kaczorek, M., Scherrmann, J.M., and Temsamani, J. 2000. New advances in the transport of doxorubicin through the blood‐brain barrier by a peptide vector‐mediated strategy. Mol. Pharmacol. 57:679‐686. doi: 10.1124/mol.57.4.679.
  Smeyne, R.J., Schilling, K., Robertson, L., Luk, D., Oberdick, J., Curran, T., and Morgan, J.I. 1992. fos‐lacZ transgenic mice: Mapping sites of gene induction in the central nervous system. Neuron 8:13‐23. doi: 10.1016/0896‐6273(92)90105‐M.
  Umemoto, M. and Olds, M.E. 1975. Effects of chlordiazepoxide, diazepam and chlorpromazine on conditioned emotional behaviour and conditioned neuronal activity in limbic, hypothalamic and geniculate regions. Neuropharmacology 14:413‐425. doi: 10.1016/0028‐3908(75)90024‐6.
Internet Resources
  http://oacu.od.nih.gov/ARAC/documents/Rodent_Genotyping.pdf
  Helpful tips on tissue biopsy for genotyping
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library