Models of Amyotrophic Lateral Sclerosis

Mandy Jackson1, Raquelli Ganel1, Jeffrey D. Rothstein1

1 Johns Hopkins University, Baltimore, Maryland
Publication Name:  Current Protocols in Neuroscience
Unit Number:  Unit 9.13
DOI:  10.1002/0471142301.ns0913s20
Online Posting Date:  November, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Amyotrophic lateral sclerosis (ALS) is a progressive neurological disorder caused by degeneration of the motor neurons in cortex, brainstem and spinal cord. Two experimental models of ALS are described in this unit: organotypic cultures of spinal cord, and transgenic mice expressing a human mutant superoxide dismutase 1 (SOD1) gene. Appropriate animal and cell culture models of ALS can be used to help unravel the sequence of events in motor neuronal degeneration and test potential therapies.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Spinal Cord Organotypic Cultures
  • Basic Protocol 2: Assessment of the Clinical Efficacy of Therapeutic Agents in a Mutant SOD1 Transgenic Mouse Model of Amyotrophic Lateral Sclerosis
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Spinal Cord Organotypic Cultures

  Materials
  • Incubation medium (see recipe), 37°C
  • Gey's balanced salt solution (GBSS; Invitrogen Life Technologies) supplemented with 6.4 mg/ml glucose and filter sterilized before each use
  • 70%, 95% (v/v), and absolute ethanol
  • 5% (v/v) Betadine
  • 8‐day‐old litter of Sprague Dawley rat pups (Charles River Laboratories)
  • 0.1 M sodium phosphate buffer, pH 7.4 ( appendix 2A)
  • 100% (v/v) methanol, ice cold (for SMI‐32 immunostaining only)
  • 0.1% (v/v) Triton X‐100 in 0.1 M sodium phosphate buffer, pH 7.4 (for Islet‐1 immunostaining only)
  • TBS: 50 mM Tris⋅Cl ( appendix 2A)/1.5% (w/v) NaCl, pH 7.4
  • 1% and 5% (v/v) horse serum (heat inactivated) in TBS
  • Monoclonal SMI‐32 antibody (Sternberger Monoclonals)
  • Monoclonal Islet‐1 antibody (Vector Laboratories)
  • Biotinylated horse anti‐mouse antibody (Vector Laboratories)
  • ABC reagent (Vector Laboratories) diluted 1:100 in TBS
  • 0.5 mg/ml diaminobenzidine (DAB)/0.075% (v/v) hydrogen peroxidase
  • Xylene
  • Permount
  • 6‐well (35 mm) tissue culture plates
  • Sterilized dissection instruments, including:
  •  17.8‐cm (7‐in.) microdissecting forceps, serrated
  •  12‐cm (4.75‐in.) microdissecting tweezers, straight
  •  Two 10.5‐cm (4.125‐in.) microdissecting tweezers, tips at 45° angle
  •  16‐cm (6.25‐in.) microspatula, 1.3 × 0.3–cm (0.5 × 0.125–in.) spoon end
  •  14‐cm (5.5‐in.) operating scissors, straight, sharp‐blunt
  •  Microdissecting tweezers, curved
  •  11.5‐cm (4.5‐in.) microdissecting scissors, straight
  • Millicell CM 30‐mm inserts (Millipore)
  • Petri dishes or 10‐cm tissue culture plates, sterile
  • McIlwain tissue chopper (Stoelting)
  • Double‐ and single‐edged razor blades, sterile
  • Aclar plastic film (Honeywell Specialty Films), cut into 5.5 × 3.5–cm pieces, sterilized by autoclaving
  • 100‐ml beakers
  • Glass transfer pipets (∼2‐mm i.d.), made by breaking a 2.3‐cm (5.75‐in.) Pasteur pipet where it narrows (∼1.7 cm from the tip) and flaming the broken end for smoothness, sterile
  • Dissecting bench setup including:
  •  Styrofoam dissection surface and pins
  •  250‐ml beaker containing 5% (v/v) Betadine
  •  250‐ml beaker containing 70% (v/v) ethanol
  •  Spray bottle with sterile saline
  •  Spray bottle with 70% (v/v) ethanol
  •  Cotton gauze, numerous 4 × 4–cm pieces, soaked in 70% (v/v) ethanol
  • Magnifying dissecting glasses
  • Incubator, humidified 37°C, 5% CO 2
  • Pasteur pipets, sterile
  • Fine brush
  • Netwell inserts (Fisher)
  • 12‐well tissue culture plates
  • Shaker, 4°C
  • Glass slides
  • Coverslips
  • Microscope with 40 and 100× magnification
NOTE: All reagents and equipment coming in contact with live cells must be sterile, and proper sterile technique should be followed accordingly.

Basic Protocol 2: Assessment of the Clinical Efficacy of Therapeutic Agents in a Mutant SOD1 Transgenic Mouse Model of Amyotrophic Lateral Sclerosis

  Materials
  • Male SOD1 transgenic mice: B6SJL‐TgN(SOD1‐G93A)1Gur (GIH; survival: 132 ± 11 days) or B6SJL‐TgN(SOD1‐G93A)1Gurdel (GIL; survival: 251 ± 28 days) mice (The Jackson Laboratory)
  • Female B6SJL mice (The Jackson Laboratory)
  • Inhalational anesthetic (halothane or isoflurane)
  • Tail buffer (see recipe)
  • 10 mg/ml proteinase K, stored in aliquots at −20°C
  • Buffered phenol, pH 8.0 ( appendix 2A)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol ( appendix 2A)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 70% and 100% (v/v) ethanol
  • TE buffer ( appendix 2A), optional
  • 5 U/µl Taq DNA polymerase supplied with 10× PCR amplification buffer with 15 mM MgCl 2 (Roche Diagnostics)
  • 20 mM dNTP mix (Invitrogen Life Technologies)
  • 676 µM mouse SOD1 primer (5′‐GTTACATATAGGGGTTTACTTCATAATCTG‐3′), custom synthesis
  • 676 µM human SOD1 primer (5′‐CCAAGATGCTTAACTCTTGTAATCAATGGC‐3′), custom synthesis
  • 676 µM mouse or human (m/h) SOD1 primer (5′‐CAGCAGTCACATTGCCCAA/GGTCTCCAACATG‐3′), custom synthesis
  • Mineral oil
  • 5× loading buffer: 10% (w/v) Ficoll 400/0.05 M disodium EDTA, pH 8.0/0.5% (w/v) SDS/0.125% (w/v) bromphenol blue
  • Therapeutic agent
  • 4% (w/v) chloral hydrate
  • Cryoprotective solution: 30% (w/v) sucrose/5% (v/v) glycerol/0.02% (w/v) sodium azide in 0.1 M PBS ( appendix 2A)
  • 55°C water bath
  • Microcentrifuge, room temperature and 4°C
  • Thermal cycler
  • Microscope with 250× magnification
  • Additional reagents and equipment for inhalant anesthesia ( appendix 4B), quantifying DNA ( appendix 1K), agarose gel electrophoresis ( appendix 1N), monitoring rotarod activity (unit 8.12), transcardial perfusion (unit 1.1), paraffin embedding (CPMB UNIT ), microtome sectioning (unit 1.1), and section staining with thionin (unit 1.1)
CAUTION: Phenol is extremely caustic and chloroform is a suspected carcinogen. Wear appropriate protective equipment and work in a fume hood.CAUTION: Sodium azide is poisonous. Wear gloves and handle cautiously.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bargett, M.E., Heritage, R.L., Harding, J., and Brenner, D.M. 1994. Accumulation of extracellular excitatory amino acids after glutamate uptake inhibition: An in‐vivo microdialysis study of the ventral striatum. Soc. Neurosci. Abstr. 20:926.
   Bar‐Peled, O., Knudson, M., Korsmeyer, S.J., and Rothstein, J.D. 1999. Motor neuron degeneration is attenuated in bax‐deficient neurons in vitro. J. Neurosci. Res. 55:542‐556.
   Bridges, R.J., Stanley, M.S., Anderson, M.W., Cotman, C.W., and Chamberlin, A.R. 1991. Conformationally defined neurotransmitter analogues. Selective inhibition of glutamate uptake by one pyrrolidine‐2,4‐dicarboxylate diastereomer. J. Med. Chem. 34:717‐725.
   Bruijn, L.I. and Cleveland, D.W. 1996. Mechanisms of selective motor neuron death in ALS: Insights from transgenic mouse models of motor neuron disease. Neuropathol. Appl. Neurobiol. 22:373‐387.
   Bruijn, L.I., Becher, M.W., Lee, M.K., Anderson, K.L., Jenkins, N.A., Copeland, N.G., Sisodia, S.S., Rothstein, J.D., Borchelt, D.R., Price, D.L., and Cleveland, D.W. 1997. ALS‐linked SOD1 mutant G85R mediates damage to astrocytes and promotes rapidly progressive disease with SOD1‐containing inclusions. Neuron 18:327‐338.
   Cleveland, D.W. and Rothstein, J.D. 2001. From Charcot to Lou Gehrig: Deciphering selective motor neuron death in ALS. Nat. Rev. Neurosci. 2:806‐819.
   Dugan, L.L., Turetsky, D.M., Cheng, D., Lobner, D., Wheeler, M., Almli, C.R., Shen, C.K.‐F., Luh, T.‐Y.L., Choi, D.W., and Lin, T.‐S. 1997. Carboxyfullerenes as neuroprotective agents. Proc. Natl. Acad. Sci. U.S.A. 94:9434‐9439.
   Gurney, M.E., Pu, H., Chiu, A.Y., Dal Canto, M.C., Polchow, C.Y., Alexander, D.D., Caliendo, J., Hentati, A., Kwon, Y.W., Deng, H.‐X., Chen, W., Zhai, P., Sufit, R.L., and Siddique, T. 1994. Motor neuron degeneration in mice that express a human Cu,Zn superoxide dismutase mutation. Science 264:1772‐1775.
   Gurney, M.E., Cuttings, F.B., Zhai, P., Doble, A., Taylor, C.P., Andrus, P.K., and Hall, E.D. 1996. Benefit of vitamin E, riluzole, and gabapentin in a transgenic model of familial amyotrophic lateral sclerosis. Ann. Neurol. 39:147‐157.
   Ho, T.W., Bristol, L., Coccia, C., Li, Y., Milbrandt, J., Johnson, E., Sanicola, M., Carmillo, P., Jin, L., Bar‐Peled, O., Griffin, J. W., and Rothstein, J.D. 2000. TGF β trophic factors differentially modulate motor axon outgrowth and protection from excitotoxicity. Exp. Neurol. 161:664‐675.
   Hottinger, A.F., Fine, E.G., Gurnet, M.E., Zurn, A.D., and Aebischer, P. 1997. The copper chelator D‐penicillamine delays onset of disease and extends survival in a transgenic mouse model of familial amyotrophic lateral sclerosis. Eur. J. Neurosci. 9:1548‐1551.
   Kuncl, R.W., Crawford, T.O., Rothstein, J.D., and Drachman, D.B. 1992. Motor neuron diseases. In Diseases of the Nervous System (A.K. Asbury, G.M. McKhann, and W.I. McDonald, eds.) pp. 1179‐1208. W.B. Saunders, Philadelphia.
   Lacomblez, L., Bensimon, G., Leigh, P.N., Guillet, P., Powe, L., Durrleman, S., Delumeau, J.C., and Meininger, V. 1996. A confirmatory dose ranging study of riluzole in ALS. ALS/Riluzole Study Group II. Neurology 47:S242‐S250.
   Lee, M.K., Marszalek, J.R., and Cleveland, D.W. 1994. A mutant neurofilament subunit causes massive, selective motor neuron death: Implications for the pathogenesis of human motor neuron disease. Neuron 13:975‐988.
   Lee, M.K., Borchelt, D.R., Wong, P.C., Sisodia, S.S., and Price, D.L. 1996. Transgenic models of neurodegenerative diseases. Curr. Opin. Neurobiol. 6:651‐660.
   Miller, R.G., Bouchard, J.P., Duquette, P., Eisen, A., Gelinas, D., Harati, Y., Munsat, T.L., Powe, L., Rothstein, J., Salzman, P., Sufit, R.L., and the ALS/riluzole Study Group‐II. 1996. Clinical trials of riluzole in patients with ALS. Neurology 47:S86‐S92.
   Plaitakis, A. 1990. Glutamate dysfunction and selective motor neuron degeneration in amyotrophic lateral sclerosis: A hypothesis. Ann. Neurol. 28:3‐8.
   Reinholz, M.M., Merkle, C.M., and Poduslo, J.F. 1999. Therapeutic benefits of putrescine‐modified catalase in a transgenic mouse model of familial amyotrophic lateral sclerosis. Exp. Neurol. 159:204‐216.
   Rosen, D.R., Siddique, T., Patterson, D., Figlewicz, D.A., Sapp, P., Hentati, A., Donaldson, D., Goto, J., O'Regan, J.P., Deng, H.‐X., Rahmani, Z., Krizus, A., McKenna‐Yasek, D., Cayabyab, A., Gaston, S.M., Berger, R., Tanzi, R.E., Halperin, J.J., Herzfeldt, B., Van den Bergh, R., Hung, W.‐Y., Bird, T., Deng, G., Mulder, D.W., Smyth, C., Laing, N.G., Soriano, E., Pericak‐Vance, M.A., Haines, J., Rouleau, G.A., Gusella, J.S., Horvitz, H.R., and Brown, R.H. Jr. 1993. Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 362:59‐62.
   Rothstein, J.D. and Kuncl, R.W. 1995. Neuroprotective strategies in a model of chronic glutamate‐mediated motor neuron toxicity. J. Neurochem. 65:643‐651.
   Rothstein, J.D., Martin, L.J., and Kuncl, R.W. 1992. Decreased glutamate transport by the brain and spinal cord in amyotrophic lateral sclerosis. N. Engl. J. Med. 326:1464‐1468.
   Rothstein, J.D., Jin, L., Dykes‐Hoberg, M., and Kuncl, R.W. 1993. Chronic inhibition of glutamate uptake produces a model of slow neurotoxicity. Proc. Natl. Acad. Sci. U.S.A. 90:6591‐6595.
   Rothstein, J.D., Dykes‐Hoberg, M., Pardo, C.A., Bristol, L.A., Jin, L., Kuncl, R.W., Kanai, Y., Hediger, M.A., Wang, Y., Schielke, J., and Welty, D.F. 1996. Knockout of glutamate transporters reveals a major role for astroglial transport in excitotoxicity and clearance of glutamate. Neuron 16:675‐686.
   Shaw, P.J., Chinnery, R.M., and Ince, P.G. 1994. [3H]D‐aspartate binding sites in the normal human spinal cord and changes in motor neuron disease: A quantitative autoradiographic study. Brain Res. 655:195‐201.
   Smith, R.G., Hamilton, S., Hoffman, F., Schneider, T., Nastainczyk, W.C.S., Birnbaumer, L., Stafani, E., and Appel, S.H. 1992. Serum antibodies of L‐type calcium channels in patients with amyotrophic lateral sclerosis. N. Engl. J. Med. 327:1721‐1728.
   Wong, P.C., Pardo, C.A., Borchelt, D.R., Lee, M.K., Copeland, N.G., Jenkins, N.A., Sisodia, S.S., Cleveland, D.W., and Price, D.L. 1995. An adverse property of a familial ALS‐linked SOD1 mutation causes motor neuron disease characterized by vacuolar degeneration of mitochondria. Neuron 14:1105‐1116.
Key References
   Barneoud, P., Lolivier, J., Sanger, D.J., Scatton, B., and Moser, P. 1997. Quantitative motor assessment in FALS mice: A longitudinal study. Neuroreport 8:2861‐2865.
  Provides details on how to carry out several different tasks that can be used to measure motor deficits.
   Gurney et al., 1994. See above.
  Describes the making and characterization of an SOD1 transgenic mouse model.
   Gurney, et al., 1996. See above.
  Shows a successful therapeutic study in the SOD1 transgenic mouse model.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library