Protein Interaction Profile Sequencing (PIP‐seq) in Plants

Stephen J. Anderson1, Matthew R. Willmann1, Brian D. Gregory1

1 Department of Biology, University of Pennsylvania, Philadelphia
Publication Name:  Current Protocols in Plant Biology
Unit Number:   
DOI:  10.1002/cppb.20001
Online Posting Date:  May, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

RNA secondary structure and RNA‐protein interactions are necessary for maintaining biological functionality and regulatory mechanisms within eukaryotic transcriptomes. Determining the structural characteristics and protein‐bound sites of RNA molecules has therefore become a major research objective and requires the development of global methods for probing intra‐ and intermolecular RNA interaction sites. Sequencing RNAs treated with single‐strand‐ and double‐strand‐specific ribonucleases in the absence of proteins allows the inference of RNA secondary structure. These samples can be compared to samples treated with nucleases in the presence of interacting proteins to identify protein‐bound sequences. Thus, these four libraries reveal a comprehensive, transcriptome‐wide view of RNA secondary structure and RNA protein interaction sites in a single experiment for any plant species of interest. © 2016 by John Wiley & Sons, Inc.

Keywords: protein interaction profile sequencing (PIP‐seq); RNA‐binding proteins; RNA secondary structure; RNA‐protein interactions

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Formaldehyde Crosslinking
  • Alternate Protocol 1: Formaldehyde Crosslinking via Vacuum Chamber
  • Alternate Protocol 2: Formaldehyde Crosslinking of Physcomitrella patens (Moss) Grown in Liquid Media
  • Basic Protocol 2: Protein Interaction Profiling
  • Basic Protocol 3: Strand‐Specific High‐Throughput Sequencing Library Preparation
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Formaldehyde Crosslinking

  Materials
  • Healthy plant tissue
  • 1% formaldehyde (Sigma, cat. no. 252549)
  • 125 mM glycine (Sigma, cat. no. G8790)
  • 10‐ml syringe (without needle)
  • 50‐ml conical tube
  • Liquid nitrogen

Alternate Protocol 1: Formaldehyde Crosslinking via Vacuum Chamber

  Materials
  • Plant tissue
  • Crosslinking buffer (see recipe)
  • 1 M glycine (Sigma, cat. no. G8790)
  • Deionized, distilled H 2O
  • Scale
  • 50‐ml conical tubes
  • Tube rotator with end‐over‐end function
  • Vacuum chamber connected to a vacuum line or pump
  • Paper towels
  • Liquid nitrogen

Alternate Protocol 2: Formaldehyde Crosslinking of Physcomitrella patens (Moss) Grown in Liquid Media

  Materials
  • Liquid culture of moss Physcomitrella patens
  • 37% formaldehyde (Sigma, cat. no. 252549)
  • 1 M glycine (Sigma, cat. no. G8790)
  • PBS (Life Technologies, cat. no. 14190136)
  • Shaker
  • Ice
  • 50‐ml conical tubes
  • Centrifuge

Basic Protocol 2: Protein Interaction Profiling

  Materials
  • Formaldehyde‐crosslinked plant tissue (see protocol 1, or protocol 2 or 2)
  • RIP buffer (see recipe)
  • 1× DNase solution (see recipe)
  • 16× RNase stop buffer (see recipe)
  • 3 M NaOAc, pH 5.5 (Life Technologies, cat. no. AM9740)
  • 70% and 100% EtOH (Decon Labs, cat. no. 2716)
  • RNase ONE buffer (Promega, cat. no. M4261)
  • RNase ONE (Promega, cat. no. M4261)
  • QIAzol (Qiagen, cat. no. 79306)
  • 10× Structure Buffer (Life Technologies, cat. no. AM2275)
  • RNAse V1 (Life Technologies, cat. no. AM2275)
  • Liquid nitrogen
  • Mortar and pestle
  • 1.7‐ml microcentrifuge tubes
  • Plastic pestle
  • 2.0‐ml tubes
  • Centrifuge
  • Heat blocks (e.g., 37°C and 65°C)

Basic Protocol 3: Strand‐Specific High‐Throughput Sequencing Library Preparation

  Materials
  • RNA samples from protocol 4
  • 10× fragmentation reagent (Life Technologies, cat. no. AM8740)
  • Fragmentation stop solution (Life Technologies, cat. no. AM8740)
  • DEPC‐treated H 2O
  • 5 mg/ml glycogen (Life Technologies, cat. no. AM9510)
  • 3 M NaOAc, pH 5.5 (Life Technologies, cat. no. AM9740)
  • 80% and 100% EtOH
  • NEB T4 DNA Ligase Buffer (New England Biolabs, cat. no. B0202S)
  • T4 Polynucleotide kinase (New England Biolabs, cat. no. M0201S)
  • 10 mM ATP (Life Technologies, cat. no. AM8110G)
  • 1× TBE
  • Gel loading buffer II (Life Technologies, cat. no. AM8546G)
  • 10‐base pair (bp) ladder (Life Technologies, cat. no. 10821‐015)
  • 10 mg/ml ethidium bromide (Life Technologies, cat. no. 15585‐011)
  • 0.3 M NaCl
  • 5 μM 3′ adapter oligonucleotide RA3: 5′App TGGAATTCTCGGGTGCCAAGG–3′ (IDT, custom DNA synthesis)
  • RNA Ligase Buffer (New England Biolabs, cat. no. B0216L)
  • RNaseOUT (Life Technologies, cat. no. 10777019)
  • 200 U/μl T4 RNA Ligase 2, truncated (New England Biolabs, cat. no. M0242S)
  • 25 μM 5′ adapter RNA oligonucleotide RA5: 5′–GUUCAGAGUUCUACAGUCCGACGAUC–3′ (IDT, custom synthesis)
  • T4 RNA Ligase 1 (New England Biolabs, cat. no. M0204S)
  • 100 μM reverse transcription primer RTP: 5′–GCCTTGGCACCCGAGAATTCCA–3′ (IDT, custom DNA synthesis)
  • 5× First Strand Buffer (Life Technologies, cat. no. 18064‐014
  • 50 mM dNTPs
  • 100 mM DTT (Life Technologies, cat. no. 18064‐014)
  • SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064‐014)
  • 2× Phusion master mix (New England Biolabs, cat. no. M0531L)
  • 5 mM betaine (MP Biomedicals, cat. no. 215046180)
  • 10 μM 5′ RNA‐seq PCR primer: 5′–AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA–3′ (IDT, custom DNA synthesis)
  • 10 μM indexed primers for PCR: 5′–CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA–3′ (IDT, custom DNA synthesis), where NNNNNN denotes the position of the 6‐nt bar code in each indexed primer
  • Nuclease‐free H 2O (Life Technologies, cat. no. AM9932)
  • DSN hybridization buffer (see recipe)
  • 10× DSN Master Buffer (Evrogen, cat. no. EA001)
  • DSN Enzyme (Evrogen, cat. no. EA001)
  • DSN STOP Solution (Evrogen, cat. no. EA001)
  • Heat block (37°C, 70°C, 68°C)
  • Centrifuges
  • Ice
  • 15% polyacrylamide TBE‐urea gels, 1.0 mm, 10 well (Life Technologies, cat. no. EC6885BOX)
  • Gel box for running pre‐poured gels (Life, Technologies, cat. no. EI0001)
  • 18‐gauge needles
  • 10‐ml syringe
  • Razor blades
  • Gel breaker tubes (IST Engineering, cat. no. 3388‐100)
  • 2.0‐ml tubes
  • Mechanical rotator
  • Spin‐X columns (Costar, cat. no. 8160)
  • 200‐μl PCR tubes
  • Thermal cycler
  • 6% polyacrylamide TBE gels, 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Baltz, A.G., Munschauer, M., Schwanhäusser, B., Vasile, A., Murakawa, Y., Schueler, M., Youngs, N., Penfold‐Brown, D., Drew, K., Milek, M., Wyler, E., Bonneau, R., Selbach, M., Dieterich, C., and Landthaler, M. 2012. The mRNA‐bound proteome and its global occupancy profile on protein‐coding transcripts. Mol. Cell 46:674‐690. doi: 10.1016/j.molcel.2012.05.021.
  Brooks, S.A. and Rigby, W.F. 2000. Characterization of the mRNA ligands bound by the RNA binding protein hnRNP A2 utilizing a novel in vivo technique. Nucleic Acids Res. 28:e49. doi: 10.1093/nar/28.10.e49.
  Cruz, J.A. and Westhof, E. 2009. The dynamic landscapes of RNA architecture. Cell 136:604‐609. doi: 10.1016/j.cell.2009.02.003.
  Ding, Y., Tang, Y., Kwok, C.K., Zhang, Y., Bevilacqua, P.C., and Assmann, S.M. 2014. In vivo genome‐wide profiling of RNA secondary structure reveals novel regulatory features. Nature 505:696‐700. doi: 10.1038/nature12756.
  Foley, S.W., Vandivier, L.E., Kuksa, P.P., and Gregory, B.D. 2015. Transcriptome‐wide measurement of plant RNA secondary structure. Curr. Opin. Plant Biol. 27:36‐43. doi: 10.1016/j.pbi.2015.05.021.
  Gosai, S.J., Foley, S.W., Wang, D., Silverman, I.M., Selamoglu, N., Nelson, A.D.L., Beilstein, M.A., Daldal, F., Deal, R.B., and Gregory, B.D. 2015. Global analysis of the RNA‐protein interaction and RNA secondary structure landscapes of the arabidopsis nucleus. Mol. Cell 57:376‐388. doi: 10.1016/j.molcel.2014.12.004.
  Guthrie, C. and Steitz, J. 2005. Nucleus and gene expression: Coordinated nuclear events regulate mRNA synthesis, processing, export and turnover. Curr. Opin. Cell Biol. 17:239‐241. doi: 10.1016/j.ceb.2005.04.015.
  Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M. Jr., Jungkamp, A.‐C., Munschauer, M., Ulrich, A., Wardle, G.S., Dewell, S., Zavolan, M., and Tuschl, T. 2010. Transcriptome‐wide identification of RNA‐binding protein and microRNA target sites by PAR‐CLIP. Cell 141:129‐141. doi: 10.1016/j.cell.2010.03.009.
  Hugouvieux, V., Kwak, J.M., and Schroeder, J.I. 2001. An mRNA cap binding protein, ABH1, modulates early abscisic acid signal transduction in Arabidopsis. Cell 106:477‐487. doi: 10.1016/S0092‐8674(01)00460‐3.
  Keene, J.D., Komisarow, J.M., and Friedersdorf, M.B. 2006. RIP‐Chip: The isolation and identification of mRNAs, microRNAs and protein components of ribonucleoprotein complexes from cell extracts. Nat. Protoc. 1:302‐307. doi: 10.1038/nprot.2006.47.
  Kupsch, C., Ruwe, H., Gusewski, S., Tillich, M., Small, I., and Schmitz‐Linneweber, C. 2012. Arabidopsis chloroplast RNA binding proteins CP31A and CP29A associate with large transcript pools and confer cold stress tolerance by influencing multiple chloroplast RNA processing steps. Plant Cell 24:4266‐4280. doi: 10.1105/tpc.112.103002.
  Li, F., Zheng, Q., Vandivier, L.E., Willmann, M.R., Chen, Y., and Gregory, B.D. 2012. Regulatory impact of RNA secondary structure across the Arabidopsis transcriptome. Plant Cell 24:4346‐4359. doi: 10.1105/tpc.112.104232.
  Lorković, Z.J. 2009. Role of plant RNA‐binding proteins in development, stress response and genome organization. Trends Plant Sci. 14:229‐236. doi: 10.1016/j.tplants.2009.01.007.
  Mortimer, S.A., Kidwell, M.A., and Doudna, J.A. 2014. Insights into RNA structure and function from genome‐wide studies. Nat. Rev. Genet. 15:469‐479. doi: 10.1038/nrg3681.
  Silverman, I.M., Li, F., Alexander, A., Goff, L., Trapnell, C., Rinn, J.L., and Gregory, B.D. 2014. RNase‐mediated protein footprint sequencing reveals protein‐binding sites throughout the human transcriptome. Genome Biol. 15:R3. doi: 10.1186/gb‐2014‐15‐1‐r3.
  Spitale, R.C., Flynn, R.A., Zhang, Q.C., Crisalli, P., Lee, B., Jung, J.‐W., Kuchelmeister, H.Y., Batista, P.J., Torre, E.A., Kool, E.T., and Chang, H.Y. 2015. Structural imprints in vivo decode RNA regulatory mechanisms. Nature 519:486‐490. doi: 10.1038/nature14263.
  Ule, J., Jensen, K., Mele, A., and Darnell, R.B. 2005. CLIP: A method for identifying protein‐RNA interaction sites in living cells. Methods 37:376‐386. doi: 10.1016/j.ymeth.2005.07.018.
  Waggoner, S.A. and Liebhaber, S.A. 2003. Identification of mRNAs associated with αCP2‐containing RNP complexes. Mol. Cell. Biol. 23:7055‐7067. doi: 10.1128/MCB.23.19.7055‐7067.2003.
  Wilson, D.S. and Szostak, J.W. 1999. In vitro selection of functional nucleic acids. Annu. Rev. Biochem. 68:611‐647. doi: 10.1146/annurev.biochem.68.1.611.
  Zheng, Q., Ryvkin, P., Li, F., Dragomir, I., Valladares, O., Yang, J., Cao, K., Wang, L.‐S., and Gregory, B.D. 2010. Genome‐wide double‐stranded RNA sequencing reveals the functional significance of base‐paired RNAs in Arabidopsis. PLoS Genet. 6:e1001141. doi: 10.1371/journal.pgen.1001141.
Key References
  Gosai, S.J., Foley, S. W., Wang, D., Silverman, I.M., Selamoglu, N., Nelson, A.D.L., Beilstein, M.A., Daldal, F., Deal, R.B., and Gregory, B.D. 2015. Global analysis of the RNA‐protein interaction and RNA secondary structure landscapes of the Arabidopsis nucleus. Mol. Cell 57:376–388.
  This study was the first to use PIP‐seq for global analysis of RNA secondary structure and RNA‐protein interaction sites in a plant transcriptome.
Internet Resources
  http://gregorylab.bio.upenn.edu/PIPseq/
  Gregory Lab PIP‐seq resource.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library