Artificial Chromosome Preparation in Arabidopsis

Minoru Murata1

1 Institute of Plant Science and Resources, Okayama University, Kurashiki
Publication Name:  Current Protocols in Plant Biology
Unit Number:   
DOI:  10.1002/cppb.20010
Online Posting Date:  May, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In Arabidopsis thaliana, various attempts have been made to create artificial chromosomes as a new tool for cytological and genetic analyses. However, most of the efforts have been unsuccessful until recently. Most eukaryotic chromosomes are linear, and therefore the Arabidopsis artificial chromosomes have also been designed to be linear and to carry the telomere structure at both ends. In contrast, circular artificial chromosomes were successfully created by the Cre/LoxP system combined with Ac/Ds transposon system, on the basis of the discovery that ring minichromosomes are relatively stable and transmissible to the next generations in A. thaliana. Because ring minichromosomes ∼1 to 6 Mb in size have been generated, in this article, the protocol for inducing large chromosomal rearrangements resulting in ring chromosome formation is described. © 2016 by John Wiley & Sons, Inc.

Keywords: Arabidopsis thaliana; Ac‐Ds transposon system; Cre/LoxP; ring minichromosome

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Generation of Artificial Ring Chromosomes
  • Support Protocol 1: Cytological Confirmation of ARC Generation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of Artificial Ring Chromosomes

  Materials
  • Arabidopsis transgenic lines used:
  • WiscDsLox506E08* (ABRC, cat. no. CS859268)
  • The Ac‐RLC‐62 and ‐63 lines*, expressing transposase (TPase) gene derived from maize Activator (AC) (ABRC, cat. nos. CS859430 and CS859431)
  • The Cre‐expressing line, Cre13** (Marjanac et al., ) or CreII*** (Murata et al. unpub. observ.)
  • *All these lines originated from ecotype Columbia (Col) of Arabidopsis thaliana, and available from the Arabidopsis Biological Resource Center (ABRC) at Ohio State University.
  • **This transgenic line originated from ecotype C24, and was obtained from Dr. A. Depicker (VIB, Ghent, Belgium).
  • ***This transgenic line originated from ecotype Columbia (Col‐0) in our laboratory.
  • 5% (v/v) household bleach solution with 0.02% (v/v) Triton X‐100
  • Agar‐solidified MS medium (see recipe) containing:
    • 10 μg/ml glufosinate (trade name, Basta) for germinating CS859268 line
    • 50 μg/ml kanamycin for germinating Ac RLC‐62, Ac RLC‐63, Cre13, and CreII lines
    • 50 μg/liter kanamycin and 10 μg/liter glufosinate for germinating F1 plants
    • 10 μg/liter hygromycin B and 10 μg/ml glufosinate for germinating F2 plants
    • No selective chemicals (just agar plates)
  • Planting soil
  • Silica gel
  • DNeasy Plant Mini kit (Qiagen)
  • PCR primers:
    • Ca35S (5′‐CGCACAATCCCACTATCC‐3′)
    • LUC (5′‐AGAGTTTTCACTGCATACGACG ‐3′)
    • Cre‐F2: 5′‐GCAACATTTGGGCCAGCTAAACATGCTTC‐3′
    • Cre‐R2: 5′‐AACAGGTAGTTATTCGGATCATCAGCTAC‐3′
  • Primers for TAIL‐PCR (Table 20.1.0)
  • pGEM‐T Easy plasmid vector (Promega)
  • Growth chamber (SANYO, L200)
  • 8‐cm‐diameter flower pots
  • Plastic containers (e.g., Tupperware)
  • 0.5 ml PCR tubes or 96‐well PCR plates
  • Thermal cycler (e.g., GeneAmp PCR system 9700, Applied Biosystems)
  • Additional reagents and equipment for the polymerase chain reaction (PCR; Kramer and Coen, ), DNA sequencing (Ausubel et al., , Chapter 7), use of the BLASTN program (Wolfsberg and Madden, ), and simple and rapid isolation of DNA from plants (Edwards et al., )
Table 0.1.1   MaterialsPrimers and Their Sequences for TAIL‐PCR a

Primer Sequence (5′‐>3′)
Ds1‐I AAGGAAATTGTCGTGAACGGTGA
Ds1‐II GGTGTAACGGTCGGGAAACTAGC
Ds1‐III GGTTCGAAATCGATCGGGATAAA
Ds2‐I CGGATCGTATCGGTTTTCGATTA
Ds2‐II ACCGGTATATCCCGTTTTCGTTT
Ds2‐III TACCGACTGTTACCGACCGTTTT
AD7 NTCGASTWTSGWGTT
AD17 TCNGSATWTGSWTGT
AD2‐1 NGTCGASWGANAWGAA
AD1‐1 TGWGNAGSANCASAGA
AD2‐2 AGWGNAGWANCAWAGG
AD5 STTGNTASTNCTNTGC
AD3 WGTGNAGWANCANAGA

 aN: A, C, G, or T; S: C or G; W: A or T.

Support Protocol 1: Cytological Confirmation of ARC Generation

  Materials
  • Plants determined to contain an ARC by PCR analysis ( protocol 1Basic Protocol)
  • Fixative (3 volumes of ethanol:1 volume of glacial acetic acid; store at −20°C)
  • Enzyme solution for chromosome preparation (see recipe)
  • Antifade mounting medium (e.g., Vectashield)
  • 4′, 6‐diamidino‐2‐phenylindole dihydrochloride (DAPI)
  • Glass microscope slides
  • Coverslip
  • Fine forceps
  • Dissection needles
  • Fluorescence microscope with a CCD camera and a filter set for UV excitation and blue emission
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Ananiev, E.V., Wu, C., Chamberlin, M.A., Svitashev, S., Schwartz, C., Gordon‐Kamm, W., and Tingey, S. 2009. Artificial chromosome formation in maize (Zea mays L.). Chromosoma 118:157‐177. doi: 10.1007/s00412‐008‐0191‐3.
  Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.) 2016. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
  Bent, A.F. 2000. Arabidopsis in planta transformation. Uses, mechanisms, and prospects for transformation of other species. Plant Physiol. 124:1540‐1547. doi: 10.1104/pp.124.4.1540.
  Birchler, J.A., Gao, Z., Sharma, A., Presting, G.G., and Han, F. 2011. Epigenetic aspects of centromere function in plants. Curr. Opin. Plant Biol. 14:217‐222. doi: 10.1016/j.pbi.2011.02.004.
  Carlson, S.R., Rudgers, G.W., Zieler, H., Mach, J.M., Luo, S., Grunden, E., Krol, C., Copenhaver, G.P., and Preuss, D. 2007. Meiotic transmission of an in vitro‐assembled autonomous maize minichromosome. PLoS Genet. 3:1965‐1974. doi: 10.1371/journal.pgen.0030179.
  Clough, S.J. and Bent, A.F. 1998. Floral dip: A simplified method for Agrobacterium‐mediated transformation of Arabidopsis thaliana. Plant J. 16:735‐743. doi: 10.1046/j.1365‐313x.1998.00343.x.
  Edwards, K., Johnstone, C., and Thompson, C. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 19:1349. doi: 10.1093/nar/19.6.1349.
  Farr, C.J., Stevanovic, M., Thomson, E.J., Goodfellow, P.N., and Cooke, H.J. 1992. Telomere‐associated chromosome fragmentation: Applications in genome manipulation and analysis. Nat. Genet. 2:275‐282. doi: 10.1038/ng1292‐275.
  Gaeta, R.T., Masonbrink, R.E., Krishnaswamy, L., Zhao, C., and Birchler, J.A. 2012. Synthetic chromosome platforms in plants. Annu. Rev. Plant Biol. 63:307‐330. doi: 10.1146/annurev‐arplant‐042110‐103924.
  Kapusi, E., Ma, L., Teo, C.H., Hensel, G., Himmelbach, A., Schubert, I., Mette, M.F., Kumlehn, J., and Houben, A. 2012. Telomere‐mediated truncation of barley chromosomes. Chromosoma 121:181‐190. doi: 10.1007/s00412‐011‐0351‐8.
  Koornneef, M., Alonso‐Blanco, C., Peeters, A.J., and Soppe, W. 1998. Genetic control of flowering time in Arabidopsis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49:345‐370. doi: 10.1146/annurev.arplant.49.1.345.
  Kramer, M.F. and Coen, D.M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14. doi: 10.1002/0471142727.mb1501s56.
  Liu, Y.G. and Whittier, R.F. 1995. Thermal asymmetric interlaced PCR: Automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 25:674‐681. doi: 10.1016/0888‐7543(95)80010‐J.
  Malik, H.S. and Henikoff, S. 2009. Major evolutionary transitions in centromere complexity. Cell 138:1067‐1082. doi: 10.1016/j.cell.2009.08.036.
  Marjanac, G., De Paepe, A., Peck, I., Jacobs, A., De Buck, S., and Depicker, A. 2008. Evaluation of CRE‐mediated excision approaches in Arabidopsis thaliana. Transgenic Res. 17:239‐250. doi: 10.1007/s11248‐007‐9096‐9.
  McClintock, B. 1938. The production of homozygous deficient tissues with mutant characteristics by means of the aberrant mitotic behavior of ring‐shaped chromosomes. Genetics 23:315‐376.
  Medberry, S.L., Dale, E., Qin, M., and Ow, D.W. 1995. Intra‐chromosomal rearrangements generated by Cre‐lox site‐specific recombination. Nucleic Acids Res. 23:485‐490. doi: 10.1093/nar/23.3.485.
  Murata, M. 2014. Minichromosomes and artificial chromosomes in Arabidopsis. Chromosome Res. 22:167‐178. doi: 10.1007/s10577‐014‐9421‐0.
  Murata, M. and Motoyoshi, F. 1995. Floral chromosomes of Arabidopsis thaliana for detecting low‐copy DNA sequences by fluorescence in situ hybridization. Chromosoma 104:39‐43. doi: 10.1007/BF00352224.
  Murata, M., Ogura, Y., and Motoyoshi, F. 1994. Centromeric repetitive sequences in Arabidopsis thaliana. Jpn. J. Genet. 69:361‐370. doi: 10.1266/jjg.69.361.
  Murata, M., Yokota, E., Shibata, F., and Kashihara, K. 2008. Functional analysis of the Arabidopsis centromere by T‐DNA insertion‐induced centromere breakage. Proc. Natl. Acad. Sci. U.S.A. 105:7511‐7516. doi: 10.1073/pnas.0802828105.
  Murata, M., Shibata, F., Hironaka, A., Kashihara, K., Fujimoto, S., Yokota, E., and Nagaki, K. 2013. Generation of an artificial ring chromosome in Arabidopsis by Cre/LoxP‐mediated recombination. Plant J. 74:363‐371. doi: 10.1111/tpj.12128.
  Nelson, A.D., Lamb, J.C., Kobrossly, P.S., and Shippen, D.E. 2011. Parameters affecting telomere‐mediated chromosomal truncation in Arabidopsis. Plant Cell 23:2263‐2272. doi: 10.1105/tpc.111.086017.
  Teo, C.H., Ma, L., Kapusi, E., Hensel, G., Kumlehn, J., Schubert, I., Houben, A, and Mette, M.F. 2011. Induction of telomere‐mediated chromosomal truncation and stability of truncated chromosomes in Arabidopsis thaliana. Plant J. 68:28‐39. doi: 10.1111/j.1365‐313X.2011.04662.x.
  Wolfsberg, T.G. and Madden, T.L. 1999. Sequence similarity searching using the BLAST family of programs. Curr. Protoc. Mol. Biol. 46:19.3.1‐19.3.29.
  Woody, S.T., Austin‐Phillips, S., Amasino, R.M., and Krysan, P.J. 2007. The WiscDsLox T‐DNA collection: An arabidopsis community resource generated by using an improved high‐throughput T‐DNA sequencing pipeline. J. Plant Res. 120:157‐165. doi: 10.1007/s10265‐006‐0048‐x.
  Xu, C., Cheng, Z., and Yu, W. 2012. Construction of rice mini‐chromosomes by telomere‐mediated chromosomal truncation. Plant J. 70:1070‐1079. doi: 10.1111/j.1365‐313X.2012.04916.x.
  Yokota, E., Nagaki, K., and Murata, M. 2010. Minichromosome stability induced by partial genome duplication in Arabidopsis thaliana. Chromosoma 119:361‐369. doi: 10.1007/s00412‐010‐0259‐8.
  Yokota, E., Shibata, F., Nagaki, K., and Murata, M. 2011. Stability of monocentric and dicentric ring minichromosomes in Arabidopsis. Chromosome Res. 19:999‐1012. doi: 10.1007/s10577‐011‐9250‐3.
  Yu, W., Lamb, J.C., Han, F., and Birchler, J.A. 2006. Telomere‐mediated chromosomal truncation in maize. Proc. Natl. Acad. Sci. U.S.A. 103:17331‐17336. doi: 10.1073/pnas.0605750103.
  Zhang, S., Raina, S., Li, H., Li, J., Dec, E., Ma, H., Huang, H., and Fedoroff, N.V. 2003. Resources for targeted insertional and deletional mutagenesis in Arabidopsis. Plant Mol. Biol. 53:133‐150. doi: 10.1023/B:PLAN.0000009271.08420.d9.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library