Virus‐Induced Gene Silencing and Transient Gene Expression in Soybean (Glycine max) Using Bean Pod Mottle Virus Infectious Clones

Steven A. Whitham1, Lori M. Lincoln2, R. V. Chowda‐Reddy3, Jaime D. Dittman4, Jamie A. O'Rourke2, Michelle A. Graham1

1 These authors contributed equally to this work, 2 Agricultural Research Service, Corn Insects and Crop Genetics Research Unit, United States Department of Agriculture, Ames, Iowa, 3 Department of Agronomy, Iowa State University, Ames, Iowa, 4 Department of Plant Pathology and Microbiology, Iowa State University, Ames, Iowa
Publication Name:  Current Protocols in Plant Biology
Unit Number:   
DOI:  10.1002/cppb.20012
Online Posting Date:  June, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Virus‐induced gene silencing (VIGS) is a powerful and rapid approach for determining the functions of plant genes. The basis of VIGS is that a viral genome is engineered so that it can carry fragments of plant genes, typically in the 200 to 300 base pair size range. The recombinant viruses are used to infect experimental plants, and wherever the virus invades, the target gene or genes will be silenced. VIGS is thus transient, and in the span of a few weeks, it is possible to design VIGS constructs and then generate loss‐of‐function phenotypes through RNA silencing of the target genes. In soybean (Glycine max), the Bean pod mottle virus (BPMV) has been engineered to be valuable tool for silencing genes with diverse functions and also for over‐expression of foreign genes. This protocol describes a method for designing BPMV constructs and using them to silence or transiently express genes in soybean. © 2016 by John Wiley & Sons, Inc.

Keywords: gene expression; RNA silencing; soybean; viral vector; virus‐induced gene silencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Construction of BPMV Clones for VIGS Applications
  • Basic Protocol 2: Inoculation of Soybean Plants Using Biolistics
  • Alternate Protocol 1: Construction of BPMV Clones for Gene Expression Applications
  • Support Protocol 1: Primer Design for Amplifying Soybean Gene Fragments to Clone into pBPMV‐IA‐V2
  • Support Protocol 2: Primer Design for Amplifying Open Reading Frames to Clone into pBPMV‐IA‐D35
  • Support Protocol 3: Rub Inoculation Using Lyophilized BPMV‐Infected Soybean Leaves
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of BPMV Clones for VIGS Applications

  Materials
  • Plasmid DNA of the infectious BPMV RNA2 clone, pBPMV‐IA‐V2 (Zhang et al., )
  • TOP10 Electrocompetent E. coli cells and SOC broth
  • LB broth and plates containing 100 μg/ml ampicillin
  • Qiagen Plasmid Midi‐Prep Kit
  • BamHI, XhoI (SalI and/or StuI, if necessary), 10× restriction buffer, and bovine serum albumin (BSA) (Promega)
  • Calf intestinal alkaline phosphatase (CIAP)
  • 6× Loading dye (see recipe)
  • 1% agarose gel
  • 1‐kb ladder
  • Qiagen QIAquick Gel Extraction Kit
  • Soybean genomic DNA or cDNA
  • Forward and reverse target gene primers diluted to 10 μM ( protocol 4)
  • Qiagen QIAquick PCR Purification Kit
  • Taq DNA polymerase including 10× PCR buffer and MgCl 2 (Invitrogen)
  • T4 DNA ligase and 10× ligation buffer
  • MCS primers: MCS_F 5′‐CTACAGTTTTTGACATTCTCC‐3′; MCS_R 5′‐ATAGACAGAGCATACTCAACG‐3′
  • Electroporator
  • Electroporation cuvettes (0.1 cm gap)
  • 37°C shaking incubator
  • Nanodrop spectrophotometer
  • Vortex mixer
  • Thermal cycler
  • 0.2‐ml PCR tubes
  • 15‐ and 50‐ml Falcon tubes
  • 20‐μl pipet tips, sterile

Basic Protocol 2: Inoculation of Soybean Plants Using Biolistics

  Materials
  • 1‐μm Gold microcarriers (see recipe)
  • Spermidine master mix (see recipe)
  • pBPMV‐IA‐R1M [Infectious cDNA of BPMV RNA1, see Zhang et al., )]
  • pSMV101A (expresses the Soybean mosaic virus helper component proteinase to promote transcription of BPMV cDNA clones in bombarded cells)
  • pBPMV‐IA‐V2 or pBPMV‐IA‐2D5C for controls (Zhang et al., )
  • pBPMV‐IA‐V2 clones prepared in protocol 1
  • 100% isopropanol
  • 70% isopropanol
  • Soybean seedlings at 10 to 14 days after germination with fully expanded unifoliate leaves (Fig.  A): place plants in the dark 24 hr before bombardment
  • Drierite desiccant
  • Vortex mixer
  • Sonicating water bath
  • Pipets and pipet tips
  • Microcentrifuge
  • Macocarriers and macrocarrier holders (Bio‐Rad)
  • PDS‐1000/He particle delivery system (Bio‐Rad)
  • 1100 psi rupture disks (Bio‐Rad)
  • High pressure helium tank
  • Forceps
  • Stopping screens (Bio‐Rad)
  • Leaf support platform (Fig.  B)
  • Course metal screen (Fig.  C)
  • Spray bottle
  • Clear plastic dome
  • 50‐ml polypropylene tubes
  • Cheesecloth
  • Lyophilizer
  • Kim wipes

Alternate Protocol 1: Construction of BPMV Clones for Gene Expression Applications

  Materials
  • Plasmid DNA of the infectious BPMV RNA2 clone, pBPMV‐IA‐D35
  • TOP10 Electrocompetent E. coli cells
  • Qiagen Plasmid Midi‐prep kit
  • Sterile water
  • BamHI, KpnI, and 10 restriction buffers and bovine serum albumin (BSA) (Promega)
  • Loading dye
  • 1% agarose gel
  • 1‐kb DNA ladder
  • Template DNA or cDNA for amplifying insert sequence
  • Primers to amplify foreign coding sequence ( protocol 5)
  • Taq DNA polymerase
  • Qiagen QIAquick PCR Purification Kit
  • LB broth and plates containing 100 μg/ml Ampicillin
  • SOC broth
  • T4 DNA ligase and 10× ligation buffer
  • Oligonucleotide primer: R2‐1548 F (5′‐CAAGAGAAAGATTTATTGGAGGGA‐3′); This primer flanks the cloning site in pBPMV‐IA‐D35 and can be used for colony PCR with a gene‐specific reverse primer and sequencing to confirm insert orientation and sequence (Zhang et al., )
  • Electroporator
  • Electroporation cuvettes
  • Vortex mixer
  • Thermal cycler
  • Nanodrop spectrophotometer

Support Protocol 1: Primer Design for Amplifying Soybean Gene Fragments to Clone into pBPMV‐IA‐V2

  Additional Materials (also see protocol 1)
  • Soybean target gene list
  • Computer, monitor, and internet access

Support Protocol 2: Primer Design for Amplifying Open Reading Frames to Clone into pBPMV‐IA‐D35

  Additional Materials (also see protocol 1)
  • Foreign gene sequences
  • Computer, monitor, and internet access

Support Protocol 3: Rub Inoculation Using Lyophilized BPMV‐Infected Soybean Leaves

  Additional Materials (also see Basic Protocols protocol 11 and protocol 22)
  • Lyophilized tissue from plants infected with recombinant BPMV constructs from protocol 2
  • 50 mM potassium phosphate buffer, pH 7.0
  • ∼10‐day old soybean seedlings with fully expanded unifoliate leaves
  • Carborundum (320 grit) (silicon carbide powder), an abrasive dusted onto soybean leaves just before inoculation
  • Disposable gloves
  • Mortar and pestle
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Ali, A.K., Lin, J., Han, J., Ibrahim, K.M., Jarjees, M.M., and Qu, F. 2014. The 5′ untranslated region of Bean pod mottle virus RNA2 tolerates unusually large deletions or insertions. Virus Res. 179:247‐250. doi: 10.1016/j.virusres.2013.10.024.
  Becker, A. (ed.) 2013. Virus‐Induced Gene Silencing: Methods and Protocols, vol. 975. Humana Press, New York.
  Dinesh‐Kumar, S.P., Anandalakshmi, R., Marathe, R., Schiff, M., and Liu, Y. 2003. Virus‐induced gene silencing. Methods Mol. Biol. 236:287‐294.
  Juvale, P.S., Hewezi, T., Zhang, C., Kandoth, P.K., Mitchum, M.G., Hill, J.H., Whitham, S.A., and Baum, T.J. 2012. Temporal and spatial Bean pod mottle virus‐induced gene silencing in soybean. Mol. Plant Pathol. 13:1140‐1148. doi: 10.1111/j.1364‐3703.2012.00808.x.
  Kachroo, A. and Ghabrial, S. 2012. Virus‐induced gene silencing in soybean. Methods Mol. Biol. 894:287‐297. doi: 10.1007/978‐1‐61779‐882‐5_19.
  Kandoth, P.K., Heinz, R., Yeckel, G., Gross, N.W., Juvale, P.S., Hill, J., Whitham, S.A., Baum, T.J., and Mitchum, M.G. 2013. A virus‐induced gene silencing method to study soybean cyst nematode parasitism in Glycine max. BMC Res. Notes 6:255. doi: 10.1186/1756‐0500‐6‐255.
  Liu, J.Z., Horstman, H.D., Braun, E., Graham, M.A., Zhang, C., Navarre, D., Qiu, W.L., Lee, Y., Nettleton, D., Hill, J.H., and Whitham, S.A. 2011. Soybean homologs of MPK4 negatively regulate defense responses and positively regulate growth and development. Plant Physiol. 157:1363‐1378. doi: 10.1104/pp.111.185686.
  Lu, R., Martin‐Hernandez, A.M., Peart, J.R., Malcuit, I., and Baulcombe, D.C. 2003. Virus‐induced gene silencing in plants. Methods 30:296‐303. doi: 10.1016/S1046‐2023(03)00037‐9.
  Pflieger, S., Blanchet, S., Meziadi, C., Richard, M.M., Thareau, V., Mary, F., Mazoyer, C., and Geffroy, V. 2014. The "one‐step" Bean pod mottle virus (BPMV)‐derived vector is a functional genomics tool for efficient overexpression of heterologous protein, virus‐induced gene silencing and genetic mapping of BPMV R‐gene in common bean (Phaseolus vulgaris L.). BMC Plant Biol. 14:232. doi: 10.1186/s12870‐014‐0232‐4.
  Rao, S.S., El‐Habbak, M.H., Havens, W.M., Singh, A., Zheng, D., Vaughn, L., Haudenshield, J.S., Hartman, G.L., Korban, S.S., and Ghabrial, S.A. 2013. Overexpression of GmCaM4 in soybean enhances resistance to pathogens and tolerance to salt stress. Mol. Plant Pathol. 15:145‐160. doi: 10.1111/mpp.12075.
  Whitham, S.A., Eggenberger, A.L., Zhang, C., Chowda‐Reddy, R.V., Martin, K.M., and Hill, J.H. 2015. Recent advances in in planta transient expression and silencing systems for soybean using viral vectors. In Recent Advancements in Gene Expression and Enabling Technologies in Crop Plants (K. Azhakanandam, A. Silverstone, H. Daniell, and M.R. Davey, eds.) pp. 423‐451. Springer New York.
  Zhang, C. and Ghabrial, S.A. 2006. Development of Bean pod mottle virus‐based vectors for stable protein expression and sequence‐specific virus‐induced gene silencing in soybean. Virology 344:401‐411. doi: 10.1016/j.virol.2005.08.046.
  Zhang, C., Bradshaw, J.D., Whitham, S.A., and Hill, J.H. 2010. The development of an efficient multipurpose Bean pod mottle virus viral vector set for foreign gene expression and RNA silencing. Plant Physiol. 153:52‐65. doi: 10.1104/pp.109.151639.
  Zhang, C., Whitham, S.A., and Hill, J.H. 2013. Virus‐induced gene silencing in soybean and common bean. In Methods in Molecular Biology, Vol. 975 (A. Becker, ed.) pp. 149‐156. Humana Press, Totowa, N.J.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library