An Efficient Targeted Mutagenesis System Using CRISPR/Cas in Monocotyledons

Zhen Liang1, Yuan Zong1, Caixia Gao2

1 University of Chinese Academy of Sciences, Beijing, China, 2 State Key Laboratory of Plant Cell and Chromosome Engineering, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, China
Publication Name:  Current Protocols in Plant Biology
Unit Number:   
DOI:  10.1002/cppb.20021
Online Posting Date:  June, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Precise genome modification using artificial nucleases is a powerful tool for in‐depth understanding of gene functions and for creating new varieties. The CRISPR/Cas system, derived from an adaptive immunity system in bacteria and archaea, can introduce DNA double‐strand breaks (DSBs) into pre‐selected genomic loci and lead to loss of gene function due to error‐prone non‐homologous end joining (NHEJ). RNA‐guided nucleases have been widely used in several eukaryotic organisms. In this article, we provide a detailed protocol for designing and constructing gRNA targets, detecting nuclease activity in transient protoplast assays, and identifying mutations in transgenic plants (including rice, wheat and maize). Targeted mutations in T0 plants can be generated in 14 to 18 weeks. © 2016 by John Wiley & Sons, Inc.

Keywords: CRISPR/Cas; gene knock‐out; maize; rice; wheat

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: CRISPR/Cas‐Mediated Genome Modifications in Monocotyledons
  • Support Protocol 1: Protoplast Transformation Assay
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: CRISPR/Cas‐Mediated Genome Modifications in Monocotyledons

  Materials
  • pEasy‐Blunt cloning vector (TransGen Biotech)
  • pEasy‐TI cloning vector (TransGen Biotech)
  • gRNA expression plasmids:
  • pOsU3‐gRNA (Addgene, Plasmid #53063)
  • pTaU6‐gRNA (Addgene, Plasmid #53062)
  • pZmU3‐gRNA (Addgene, Plasmid #53061)
  • 10× annealing buffer (OriGene)
  • AarI (Fermentas/Thermo Scientific) and corresponding 10× buffer
  • BbsI (Fermentas/Thermo Scientific) and corresponding 10× buffer
  • 10× Fast Green buffer(Fermentas/Thermo Scientific, supplied with FastDigest restriction enzyme)
  • DNA gel purification kit (Axygen)
  • T4 DNA ligase (Fermentas/Thermo Scientific) and 10× T4 DNA ligase buffer
  • Chemically competent E coli DH5α (TransGen Biotech)
  • LB medium and plates (see reciperecipes) containing 100 μg/ml ampicillin
  • 50% (v/v) glycerol
  • Primers (Table 20.2.1000; prepared by DNA synthesis facility, e.g., BGI; also see Ellington and Pollard, ):
  • OsU3‐F
  • TaU6‐F
  • ZmU3‐F
  • gRNA‐R 5′‐AAACN( 19)‐3′
  • Plasmid miniprep kit (Axygen)
  • Wizard Plus midiprep kit (Promega)
  • pJIT163‐Ubi‐rCas9 (this plasmid can be obtained from the authors on request)
  • DNAquick plant system (Tiangen Biotech)
  • 10× FastDigest buffer (Thermo Fisher Scientific)
  • T7 Endonuclease I (T7EI, ViewSolid Biotech) and 10× T7EI buffer
  • PCR thermal cycler (BioRad; also see Kramer and Coen, )
  • NanoDrop spectrophotometer (Thermo Scientific)
  • Digital gel imaging system (BioDoc‐It; UVP, cat. no. 97‐0256‐02)
  • Gel quantification software (e.g., ImageJ from the NIH)
  • Additional reagents and equipment for PCR (Kramer and Coen, ), general cloning techniques including sequencing (Ausubel et al., ), oligonucleotide synthesis (Ellington and Pollard, ), agarose gel electrophoresis (Voytas, ), and colony PCR (Woodman, )
Table 0.2.1   MaterialsPrimers Used for gRNA Cloning and Validation

Name Sequence Purpose
OsU3F 5′‐AAGGAATCTTTAAACATACGA‐3′ Colony PCR and sequencing to validate the gRNA
TaU6F 5′‐CATCTAAGTATCTTGGTAAAG‐3′ Colony PCR and sequencing to validate the gRNA
ZmU3F 5′‐CCCAAGCTTGACCAAGCCCG‐3′ Colony PCR and sequencing to validate the gRNA
OsgRNA‐F 5′‐GGCANNNNNNNNNNNNNNNNNNN‐3′ gRNA cloning
TagRNA‐F 5′‐CTTGNNNNNNNNNNNNNNNNNNN‐3′ gRNA cloning
ZmgRNA‐F 5′‐AGCANNNNNNNNNNNNNNNNNNN‐3′ gRNA cloning
gRNA‐R 5′‐AAACNNNNNNNNNNNNNNNNNNN‐3′ gRNA cloning and colony PCR and sequencing to validate the gRNA

NOTE: The plasmid map and sequence for each of the plasmids listed above can be found in the supplementary materials file for this unit at http://www.currentprotocols.com/protocol/PB20021.

Support Protocol 1: Protoplast Transformation Assay

  Materials
  • Rice cultivar: Nipponbare (IGDB, CAS)
  • Wheat cultivar: Kenong 199 (IGDB, CAS)
  • Maize cultivar: Hi‐II (IGDB, CAS)
  • 75% ethanol
  • 2.55 (w/v) sodium hypochlorite
  • 1/2 MS solid medium (see recipe)
  • Nutrient‐rich soil (Pindstrup sphagnum)
  • 0.6 M mannitol, sterilized with a 0.45‐μm filter (store at room temperature)
  • Enzyme solution (for rice and wheat or for maize; see reciperecipes)
  • W5 solution (for rice and wheat or for maize; see reciperecipes)
  • MMG solution (see recipe)
  • gRNA expression plasmids:
  • pOsU3‐gRNA (Addgene, Plasmid #53063)
  • pTaU6‐gRNA (Addgene, Plasmid #53062)
  • pZmU3‐gRNA (Addgene, Plasmid #53061)
  • pJIT163‐Ubi‐rCas9 (this plasmid can be obtained from the authors on request)
  • PEG solution (see recipe)
  • Environmentally controlled incubators (Eppendorf)
  • Shaker
  • Round glass cup with diameter 66 mm and height 180 mm
  • 9‐cm Petri dishes
  • Blotting paper
  • Single‐edge razor blade (Feiying)
  • 150‐ml conical flask
  • Vacuum desiccator and vacuum pump
  • 40‐μm nylon mesh (BD Falcon)
  • 50‐ml round‐bottom centrifuge tubes (Haimeng)
  • 2‐ml round‐bottom microcentrifuge tubes
  • 6‐well tissue culture plates
  • Fluorescence microscope (Olympus)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Alfonso‐rubí, J., Carbonero, P., and Díaz, I. 1999. Parameters influencing the regeneration capacity of calluses derived from mature indica and japonica rice seeds after microprojectile bombardment. Euphytica 107:115‐122. doi: 10.1023/A:1026434228146.
  Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.). 2016. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
  Cong, L., Ran, F.A., Cox, D., Lin, S.L., Barretto, R., Habib, N., Hsu, P.D., Wu, X.B., Jiang, W.Y., Marraffini, L.A., and Zhang, F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823. doi: 10.1126/science.1231143.
  Doench, J.G., Hartenian, E., Graham, D.B., Tothova, Z., Hegde, M., Smith, I., Sullender, M., Ebert, B.L., Xavier, R.J., and Root, D.E. 2014. Rational design of highly active sgRNAs for CRISPR‐Cas9‐mediated gene inactivation. Nat. Biotechnol. 32:1262‐1267. doi: 10.1038/nbt.3026.
  Ellington, A. and Pollard, J.D. 1998. Synthesis and purification of oligonucleotides. Curr. Protoc. Mol. Biol. 42:2.11.1‐2.11.25.
  Fu, Y., Sander, J.D., Reyon, D., Cascio, V.M., and Joung, J.K. 2014. Improving CRISPR‐Cas nuclease specificity using truncated guide RNAs. Nat. Biotechnol. 32:279‐284. doi: 10.1038/nbt.2808.
  Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and Sander, J.D. 2013. High‐frequency off‐target mutagenesis induced by CRISPR‐Cas nucleases in human cells. Nat. Biotechnol. 31:822‐826. doi: 10.1038/nbt.2623.
  Gao, C. 2015. Genome editing in crops: From bench to field. Natl. Sci. Rev. 2:13‐15. doi: 10.1093/nsr/nwu054.
  Gao, C., Zhang, Y., and Li, J. 2016. Generation of stable transgenic rice (Oryza sativa L.) by Agrobacterium‐mediated transformation. Curr. Protoc. Plant Biol. 1:235‐246.
  Jiang, W., Zhou, H., Bi, H., Fromm, M., Yang, B., and Weeks, D.P. 2013. Demonstration of CRISPR/Cas9/sgRNA‐mediated targeted gene modification in Arabidopsis, tobacco, sorghum and rice. Nucleic Acids Res. 41:e188. doi: 10.1093/nar/gkt780.
  Kramer, M.F. and Coen, D.M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Kuscu, C., Arslan, S., Singh, R., Thorpe, J., and Adli, M. 2014. Genome‐wide analysis reveals characteristics of off‐target sites bound by the Cas9 endonuclease. Nat. Biotechnol. 32:677‐683. doi: 10.1038/nbt.2916.
  Li, J.F., Norville, J.E., Aach, J., McCormack, M., Zhang, D., Bush, J., Church, G.M., and Sheen, J. 2013. Multiplex and homologous recombination‐mediated genome editing in Arabidopsis and Nicotiana benthamiana using guide RNA and Cas9. Nat. Biotechnol. 31:688‐691. doi: 10.1038/nbt.2654.
  Li, Z., Liu, Z.B., Xing, A., Moon, B.P., Koellhoffer, J.P., Huang, L., Ward, R.T., Clifton, E., Falco, S.C., and Cigan, A.M. 2015. Cas9‐Guide RNA directed genome editing in soybean. Plant Physiol. 169:960‐970. doi: 10.1104/pp.15.00783.
  Liang, Z., Zhang, K., Chen, K., and Gao, C. 2014. Targeted mutagenesis in Zea mays using TALENs and the CRISPR/Cas System. J. Genet. Genomics 41:63‐68. doi: 10.1016/j.jgg.2013.12.001.
  Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013. RNA‐guided human genome engineering via Cas9. Science 339:823‐826. doi: 10.1126/science.1232033.
  Nekrasov, V., Staskawicz, B., Weigel, D., Jones, J.D., and Kamoun, S. 2013. Targeted mutagenesis in the model plant Nicotiana benthamiana using Cas9 RNA‐guided endonuclease. Nat. Biotechnol. 31:691‐693. doi: 10.1038/nbt.2655.
  Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., and Zhang, F. 2013. Double nicking by RNA‐guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380‐1389. doi: 10.1016/j.cell.2013.08.021.
  Shan, Q., Wang, Y., Li, J., and Gao, C. 2014. Genome editing in rice and wheat using the CRISPR/Cas system. Nat. Protoc. 9:2395‐2410. doi: 10.1038/nprot.2014.157.
  Shan, Q., Wang, Y., Li, J., Zhang, Y., Chen, K., Liang, Z., Zhang, K., Liu, J., Xi, J.J., Qiu, J.L., and Gao, C. 2013. Targeted genome modification of crop plants using a CRISPR‐Cas system. Nat. Biotechnol. 31:686‐688. doi: 10.1038/nbt.2650.
  Shukla, V.K., Doyon, Y., Miller, J.C., DeKelver, R.C., Moehle, E.A., Worden, S.E., Mitchell, J.C., Arnold, N.L., Gopalan, S., Meng, X., Choi, V.M., Rock, J.M., Wu, Y.Y., Katibah, G.E., Zhifang, G., McCaskill, D., Simpson, M.A., Blakeslee, B., Greenwalt, S.A., Butler, H.J., Hinkley, S.J., Zhang, L., Rebar, E.J., Gregory, P.D., and Urnov, F.D. 2009. Precise genome modification in the crop species Zea mays using zinc‐finger nucleases. Nature 459:437‐441. doi: 10.1038/nature07992.
  Townsend, J.A., Wright, D.A., Winfrey, R.J., Fu, F., Maeder, M.L., Joung, J.K., and Voytas, D.F. 2009. High‐frequency modification of plant genes using engineered zinc‐finger nucleases. Nature 459:442‐445. doi: 10.1038/nature07845.
  Tsai, S.Q., Wyvekens, N., Khayter, C., Foden, J.A., Thapar, V., Reyon, D., Goodwin, M.J., Aryee, M.J., and Joung, J.K. 2014. Dimeric CRISPR RNA‐guided FokI nucleases for highly specific genome editing. Nat. Biotechnol. 32:569‐576. doi: 10.1038/nbt.2908.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Voytas, D.F. 2013. Plant genome engineering with sequence‐specific nucleases. Annu. Rev. Plant Biol. 64:327‐350. doi: 10.1146/annurev‐arplant‐042811‐105552.
  Wang, K. and Frame, B. 2009. Biolistic gun‐mediated maize genetic transformation. Methods Mol. Biol. 526:29‐45. doi: 10.1007/978‐1‐59745‐494‐0_3.
  Wang, Y., Cheng, X., Shan, Q., Zhang, Y., Liu, J., Gao, C., and Qiu, J.L. 2014. Simultaneous editing of three homoeoalleles in hexaploid bread wheat confers heritable resistance to powdery mildew. Nat. Biotechnol. 32:947‐951. doi: 10.1038/nbt.2969.
  Woodman, M.E. 2008. Direct PCR of intact bacteria (colony PCR). Curr. Protoc. Microbiol. 9:A.3D.1‐A.3D.6. doi: 10.1002/9780471729259.mca03ds9.
  Yoo, S.D., Cho, Y.H., and Sheen, J. 2007. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2:1565‐1572. doi: 10.1038/nprot.2007.199.
  Zhang, K., Liu, J., Zhang, Y., Yang, Z., and Gao, C. 2015. Biolistic genetic transformation of a wide range of Chinese elite wheat (Triticum aestivum L.) varieties. J. Genet. Genomics 42:39‐42. doi: 10.1016/j.jgg.2014.11.005.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Supplementary Material