Transposon Ds‐Mediated Insertional Mutagenesis in Rice (Oryza sativa)

Yuan Hu Xuan1, Chul Min Kim2, Byoung Il Je2, Jing Miao Liu2, Tian Ya Li1, Gang‐Seob Lee3, Tae‐Ho Kim4, Chang‐Deok Han2

1 College of Plant Protection, Shenyang Agricultural University, Shenyang, Liaoning, 2 Division of Applied Life Science (BK21 program), Plant Molecular Biology & Biotechnology Research Center (PMBBRC), Gyeongsang National University, Jinju, 3 Biosafty Division, Department of Agricultural Biotechnology, National Institute of Agricultural Science (NIAS), RDA, Jeonju, 4 Genomics Division, Department of Agricultural Biotechnology, National Institute of Agricultural Science (NIAS), RDA, Jeonju
Publication Name:  Current Protocols in Plant Biology
Unit Number:   
DOI:  10.1002/cppb.20030
Online Posting Date:  September, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Rice (Oryza sativa) is the most important consumed staple food for a large and diverse population worldwide. Since databases of genomic sequences became available, functional genomics and genetic manipulations have been widely practiced in rice research communities. Insertional mutants are the most common genetic materials utilized to analyze gene function. To mutagenize rice genomes, we exploited the transpositional activity of an Activator/Dissociation (Ac/Ds) system in rice. To mobilize Ds in rice genomes, a maize Ac cDNA was expressed under the CaMV35S promoter, and a gene trap Ds was utilized to detect expression of host genes via the reporter gene GUS. Conventional transposon‐mediated gene‐tagging systems rely on genetic crossing and selection markers. Furthermore, the activities of transposases have to be monitored. By taking advantage of the fact that Ds becomes highly active during tissue culture, a plant regeneration system employing tissue culture was employed to generate a large Ds transposant population in rice. This system overcomes the requirement for markers and the monitoring of Ac activity. In the regenerated populations, more than 70% of the plant lines contained independent Ds insertions and 12% expressed GUS at seedling stages. This protocol describes the method for producing a Ds‐mediated insertional population via tissue culture regeneration systems. © 2016 by John Wiley & Sons, Inc.

Keywords: rice; Ac/Ds transposable elements; gene trap; mutagenesis; plant regeneration

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Ac/Ds Plasmid Construction and Agrobacterium‐Mediated Transformation
  • Basic Protocol 2: Selection of Transgenic Plants Homozygous for Ac and Ds
  • Basic Protocol 3: Regeneration of Transgenic Plants Carrying Ac/Ds Elements
  • Basic Protocol 4: Cloning Ds Flanking Sequences from Regenerated Plants
  • Basic Protocol 5: GUS Staining of Ds Insertional Mutants
  • Support Protocol 1: Growing Rice Plants on Paddy Soil
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Ac/Ds Plasmid Construction and Agrobacterium‐Mediated Transformation

  Materials
  • Oryza sativa Dongjing cultivar seeds
  • Sterilization solution: 1.2% sodium hypochlorite containing one to two drops [per 50 ml] of Triton X‐100
  • NB medium (see recipe)
  • Agrobacterium strain (LBA4404)
  • pBI221 plasmids carrying the transposable element Ac or Ds (Chin et al., ; also see introduction to this protocol)
  • AAM medium (see recipe)
  • N6‐AS medium (see recipe)
  • 250 mg/liter cefotaxim (Sigma, cat. no. 1097909) in sterile H 2O
  • N6‐CH medium (see recipe)
  • N6‐7‐CH medium (see recipe)
  • N6S3‐CH‐I medium (see recipe)
  • N6S3‐CH‐II medium (see recipe)
  • Half strength Murashige and Skoog (MS) medium (see recipe)
  • Shaker
  • Additional reagents and equipment for electoporation (Shaw, )

Basic Protocol 2: Selection of Transgenic Plants Homozygous for Ac and Ds

  Materials
  • Leaves of transgenic rice plants ( protocol 1)
  • Liquid N 2
  • Lysis buffer (see recipe)
  • 25:24:1 (v/v/v) phenol:chloroform:isoamyl alcohol (see recipe)
  • Isopropanol
  • 70% ethanol
  • TE buffer: 10 mM Tris·Cl (pH 8.0)/1 mM disodium EDTA (pH 7.5)
  • 10 g/liter RNase A stock solution
  • Restriction enzyme EcoRI
  • Denaturation solution: 1.5 M NaCl/0.5 M NaOH
  • Neutralization solution: 1 M Tris·Cl (pH 8.0)/1.5 M NaCl
  • 10× SSC (see recipe)
  • Pre‐hybridization solution (see recipe)
  • GUS DNA fragment, isolated from pCAMBIA1381 vector (http://www.cambia.org/daisy/cambia/585)
  • Random primers (available from most molecular biology suppliers)
  • Klenow fragment of DNA polymerase (available from most molecular biology suppliers)
  • Isotope: 32P‐dATP (BMS, http://bmskorea.co.kr/)
  • Probe synthesis buffers: 1× A buffer (90 mM HEPES (pH 6.6) and 10 mM MgCl 2), 1× B buffer (2 mM DTT, 3 mM dNTP (‐dATP), 0.2 mM BSA)
  • Washing solution I: 2 × SSC, 0.1% SDS
  • Washing solution II: 0.2 × SSC, 0.1% SDS
  • Four‐base restriction enzyme: NlaIII, HaeIII, or BfaI
  • T4 DNA ligase and ligation buffer (NEB)
  • rTaq polymerase buffer (TaKaRa)
  • rTaq polymerase (TaKaRa): 1 U per reaction
  • 10 mM dNTP mix (10 mM each dNTP)
  • Primers for iPCR amplification of Ds 5′ flanking sequences:
  • Ds5‐1, CCGTTTACCGTTTTGTATATCCCG
  • Ds5‐2, CGTTCCGTTTTCGTTTTTTACC
  • Ds5‐3, GTACGGAATTCTC CCATCCT
  • Ds502, ATACGATAACGGTCGG
  • Ds5I‐1, TAATCGGGATGATCCCGTTCGTT
  • Ds5I‐2, ATGACTG CAATATGGCCAGC
  • Ds5I‐3, TTCTAATTCGGGATGACTGC
  • Primers for iPCR amplification of Ds 3′ flanking sequences:
  • Ds3I‐105, AAACGAACGGGATAAATACGG
  • Ds3I‐150, GGTTAAAGTCGAAATCGGACG
  • Glass mortar and pestle
  • Microcentrifuge
  • UV transilluminator
  • Nylon membrane for blotting (Amersham)
  • UV cross‐linker
  • Hybridization bags
  • 65ºC hybridization oven
  • X‐ray film
  • 16ºC water bath
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), Southern blotting (Brown, ), and phenol extraction/ethanol precipitation of DNA (Moore and Dowhan, ), and the polymerase chain reaction (PCR; Kramer and Coen, )

Basic Protocol 3: Regeneration of Transgenic Plants Carrying Ac/Ds Elements

  Materials
  • Seeds of transgenic rice plants carrying Ac and Ds T‐DNAs ( protocol 1)
  • Sterilization solution: 1.2% sodium hypochlorite containing one to two drops [per 50 ml] of Triton X‐100
  • NB medium (see recipe)
  • N6‐7‐CH medium (see recipe)
  • N6S3‐CH‐I medium (see recipe)
  • N6S3‐CH‐II medium (see recipe)
  • Half strength Murashige and Skoog (MS) medium (see recipe)

Basic Protocol 4: Cloning Ds Flanking Sequences from Regenerated Plants

  Materials
  • Tris⋅Cl, pH 8.3
  • KCl
  • MgCl 2
  • 0.2 mM dNTP mix: 0.2 mM each of dATP, dCTP, dGTP, and dTTP
  • Primers for TAIL‐PCR (Table 20.3.0)
  • Ac primers:
  • AC1543a, TTCTTGGTGAAATGCTGCCATAC
  • AC1031, ATAAGATTGGCCAAGTTGATGTC
  • rTaq polymerase (TaKaRa)
  • Thermal cycler
  • Additional reagents and equipment for PCR (Kramer and Coen, ) and agarose gel electrophoresis (Voytas, )
Table 0.3.3   MaterialsPrimers for TAIL‐PCR

Primer names Sequences
Specific primers for the Ds 5′ end Ds5‐1 CCGTTTACCGTTTTGTATATCCCG
Ds5‐2 CGTTCCGTTTTCGTTTTTTACC
Ds5‐3 GTACGGAATTCTC CCATCCT
Ds502 ATACGATAACGGTCGG
Specific primers for the Ds 3′ end Ds3‐1 CCGACCGGATCGTATCGGT
Ds3‐2 TTAACCCGACCGGATCGTATCGGTTTCG
Ds3‐3 GTTTCGTTACCGGTATATCCCGTTTCG
Ds3‐4 GTTAAATATGAAAATGAAAACGGTAGAGG
Ds3‐5 ATGAAA ACGGTAGAGG
Ds3‐6 ACCGTTTTCATCC
Arbitrary degenerate (AD) primers cggc1 GVCTYCGWSSGC
SAD11 NTCAGSTWTSGWGWT
SW41 AGWGHAGSAHCADAAS
BAD5, WTCCASNTGSNACG
DRM‐CG2 GCNGNWCGWCGWG
CST1 GTANTCGWAWNCST
CTG1 GWWGGTSCWASWCTG
AMS2(GAG3) GWSIDRAMSCTGCTC
geeky1 GKYKGCKGCNGC
DRM‐AG1 GNGWSASTNGAGC
BAD8 GTGASNTGSWATGG
DRM‐NC GSCNCSGWNCC
AD10 TTGIAGNACIANAGG
AD20 TCTTICGNACITNGGA
W4 AGWGNAGWANCANAGA
AD‐1 NTCGASTWTSGWGTT
AD‐2 A NGTCGASWGANAWGAA
AD‐2B NGTCGASWGANAWGTT
AD‐2 C NGTCGASWGANAWAGA
AD‐2D NGTCGASWGANAWTGT
AD‐3 WGTGNAGWANCANAGA
AD‐4 STTNTASTNCTNTGC
AD‐5 WCAGNTGWTNGTNCTG

Basic Protocol 5: GUS Staining of Ds Insertional Mutants

  Materials
  • GUS solution (see recipe)
  • Plants of interest
  • 70% ethanol
  • 50‐ml conical tubes (e.g., Corning Falcon)

Support Protocol 1: Growing Rice Plants on Paddy Soil

  Materials
  • Rice seeds of interest
  • Soil (SeoulBio Inc., ‘BAROKER’)
  • Seedling trays (SeoulBio Inc.)
  • Dark plastic film
  • Lightweight white fabric
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  An, S., Park, S., Jeong, D.H., Lee, D.Y., Kang, H.G., Yu, J.H., Hur, J., Kim, S.R., Kim, Y.H., and Lee, M. 2003. Generation and analysis of end sequence database for T‐DNA tagging lines in rice. Plant Physiol. 133:2040‐2047. doi: 10.1104/pp.103.030478.
  Brown, T. 1999. Southern blotting. Curr. Protoc. Mol. Biol. 00:2.9.1‐2.9.20.
  Chen, S., Jin, W., Wang, M., Zhang, F., Zhou, J., Jia, Q., Wu, Y., Liu, F., and Wu, P. 2003. Distribution and characterization of over 1000 T‐DNA tags in rice genome. Plant J. 36:105‐113. doi: 10.1046/j.1365‐313X.2003.01860.x.
  Chern, C.G., Fan, M.J., Yu, S.M., Hour, A.L., Lu, P.C., Lin, Y.C., Wei, F.J., Huang, S.C., Chen, S., and Lai, M.H. 2007. A rice phenomics study—phenotype scoring and seed propagation of a T‐DNA insertion‐induced rice mutant population. Plant Mol. Biol. 65:427‐438. doi: 10.1007/s11103‐007‐9218‐z.
  Chin, H.G., Choe, M.S., Lee, S.H., Park, S.H., Park, S.H., Koo, J.C., Kim, N.Y., Lee, J.J., Oh, B.G., Yi, G.H., Kim, S.C., Choi, H.C., Cho, M.J., and Han, C.D. 1999. Molecular analysis of rice plants harboring an Ac/Ds transposable element‐mediated gene trapping system. Plant J. 19:615‐623. doi: 10.1046/j.1365‐313X.1999.00561.x.
  Fu, F.F., Ye, R., Xu, S.P., and Xue, H.W. 2009. Studies on rice seed quality through analysis of a large‐scale T‐DNA insertion population. Cell Res. 19:380‐391. doi: 10.1038/cr.2009.15.
  Hsing, Y.I., Chern, C.G., Fan, M.J., Lu, P.C., Chen, K.T., Lo, S.F., Sun, P.K., Ho, S.L., Lee, K.W., and Wang, Y.C. 2007. A rice gene activation/knockout mutant resource for high throughput functional genomics. Plant Mol. Biol. 63:351‐364. doi: 10.1007/s11103‐006‐9093‐z.
  Je, B.I., Piao, H.L., Park, S.J., Park, S.H., Kim, C.M., Xuan, Y.H., Park, S.H., Huang, J., Choi, Y.D., An, G., Wong, H.L., Fujioka, S., Kim, M.C., Shimamoto, K., and Han, C.D. 2010. RAV‐Like1 maintains brassinosteroid homeostasis via the coordinated activation of BRI1 and biosynthetic genes in rice. Plant Cell 22:1777‐1791. doi: 10.1105/tpc.109.069575.
  Jeon, J.S., Lee, S., Jung, K.H., Jun, S.H., Jeong, D.H., Lee, J., Kim, C., Jang, S., Lee, S., and Yang, K. 2000. T‐DNA insertional mutagenesis for functional genomics in rice. Plant J. 22:561‐570. doi: 10.1046/j.1365‐313x.2000.00767.x.
  Jeong, D.H., An, S., Kang, H.G., Moon, S., Han, J.J., Park, S., Lee, H.S., An, K., and An, G. 2002. T‐DNA insertional mutagenesis for activation tagging in rice. Plant Physiol. 130:1636‐1644. doi: 10.1104/pp.014357.
  Jeong, D.H., An, S., Park, S., Kang, H.G., Park, G.G., Kim, S.R., Sim, J., Kim, Y.O., Kim, M.K., and Kim, S.R. 2006. Generation of a flanking sequence‐tag database for activation‐tagging lines in japonica rice. Plant J. 45:123‐132. doi: 10.1111/j.1365‐313X.2005.02610.x.
  Jiang, S.Y., Bachmann, D., La, H., Ma, Z., Venkatesh, P.N., Ramamoorthy, R., and Ramachandran, S. 2007. Ds insertion mutagenesis as an efficient tool to produce diverse variations for rice breeding. Plant Mol. Biol. 65:385‐402. doi: 10.1007/s11103‐007‐9233‐0.
  Johnson, A.A., Hibberd, J.M., Gay, C., Essah, P.A., Haseloff, J., Tester, M., and Guiderdoni, E. 2005. Spatial control of transgene expression in rice (Oryza sativa L.) using the GAL4 enhancer trapping system. Plant J. 41:779‐789. doi: 10.1111/j.1365‐313X.2005.02339.x.
  Kim, C.M., Je, B.I., Piao, H.L., Park, S.J., Kim, M.J., Park, S.H., Park, J.Y., Park, S.H., Lee, E.K., Chon, N.S., Won, Y.J., Lee, G.H., Nam, M.H., Yun, D.W., Lee, M.C., Cha, Y.S., Lee, K.H., Eun, M.Y., and Han, C.D. 2002. Reprogramming of the activity of the activator/dissociation transposon family during plant regeneration in rice. Mol. Cells 14:231‐237.
  Kim, C.M., Piao, H.L., Park, S.J., Chon, N.S., Je, B.I., Sun, B., Park, S.H., Park, J.Y., Lee, E.J., Kim, M.J., Chung, W.S., Lee, K.H., Lee, Y.S., Lee, J.J., Won, Y.J., Yi, G., Nam, M.H., Cha, Y.S., Yun, D.W., Eun, M.Y., and Han, C.D. 2004. Rapid, large‐scale generation of Ds transposant lines and analysis of the Ds insertion sites in rice. Plant J. 39:252‐263. doi: 10.1111/j.1365‐313X.2004.02116.x.
  Kolesnik, T., Szeverenyi, I., Bachmann, D., Kumar, C.S., Jiang, S., Ramamoorthy, R., Cai, M., Ma, Z.G., Sundaresan, V., and Ramachandran, S. 2004. Establishing an efficient Ac/Ds tagging system in rice: Large‐scale analysis of Ds flanking sequences. Plant J. 37:301‐314. doi: 10.1046/j.1365‐313X.2003.01948.x.
  Kramer, M.F. and Coen, D.M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Larmande, P., Gay, C., Lorieux, M., Périn, C., Bouniol, M., Droc, G., Sallaud, C., Perez, P., Barnola, I., and Biderre‐Petit, C. 2008. Oryza Tag Line, a phenotypic mutant database for the Genoplante rice insertion line library. Nucleic Acids Res. 36:D1022‐D1027. doi: 10.1093/nar/gkm762.
  Lee, S., Kim, J., Son, J.S., Nam, J., Jeong, D.H., Lee, K., Jang, S., Yoo, J., Lee, J., and Lee, D.Y. 2003. Systematic reverse genetic screening of T‐DNA tagged genes in rice for functional genomic analyses: MADS‐box genes as a test case. Plant Cell Physiol. 44:1403‐1411. doi: 10.1093/pcp/pcg156.
  Lee, G.S., Park, S.H., Yun, D.W., Ahn, B.O., Kim, C.K., Han, C.D., Yi, G.H., Park, D.S., Eun, M.Y., and Yoon, U.H. 2010. Current status of Ac/Ds mediated gene tagging systems for study of rice functional genomics in Korea. J. Plant Biotechnol. 37:125‐132. doi: 10.5010/JPB.2010.37.2.125.
  Lee, S., Kim, SA., Lee, J., Guerinot, M.L., and An, G. 2010a. Zinc deficiency‐inducible OsZIP8 encodes a plasma membrane‐localized zinc transporter in rice. Mol. Cells 29:551‐558. doi: 10.1007/s10059‐010‐0069‐0.
  Lee, S., Jeong, H.J., Kim, S.A., Lee, J., Guerinot, M.L., and An, G. 2010b. OsZIP5 is a plasma membrane zinc transporter in rice. Plant Mol. Biol. 73:507‐517. doi: 10.1007/s11103‐010‐9637‐0.
  Lee, Y.S., Jeong, D.H., Lee, D.Y., Yi, J., Ryu, C.H., Kim, S.L., Jeong, H.J., Choi, S.C., Jin, P., and Yang, J. 2010. OsCOL4 is a constitutive flowering repressor upstream of Ehd1 and downstream of OsphyB. Plant J. 63:18‐30. doi: 10.1111/j.1365‐313X.2010.04226.x.
  Liang, D., Wu, C., Li, C., Xu, C., Zhang, J., Kilian, A., Li, X., Zhang, Q., and Xiong, L. 2006. Establishment of a patterned GAL4‐VP16 transactivation system for discovering gene function in rice. Plant J. 46:1059‐1072. doi: 10.1111/j.1365‐313X.2006.02747.x.
  Lorieux, M., Blein, M., Lozano, J., Bouniol, M., Droc, G., Diévart, A., Périn, C., Mieulet, D., Lanau, N., and Bès, M. 2012. In‐depth molecular and phenotypic characterization in a rice insertion line library facilitates gene identification through reverse and forward genetics approaches. Plant Biotechnol. J. 10:555‐568. doi: 10.1111/j.1467‐7652.2012.00689.x.
  Miyao, A. and Hirochika, H. 2004. In silico mutant screening of rice using the mutant panel database. Plant Cell Physiol. 45:S38‐S38.
  Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1.1‐2.1.10.
  Park, S.J., Piao, H.L., Xuan, Y.H., Park, S.H., Je, B.I., Kim, C.M., Lee, E.J., Park, S.H., Ryu, B., Lee, K.H., Lee, G.H., Nam, M.H., Yeo, U.S., Lee, M.C., Yun, D.W., Eun, M.Y., and Han, C.D. 2006. Analysis of intragenic Ds transpositions and excision events generating novel allelic variation in rice. Mol. Cells 21:284‐293.
  Park, S.H., Kim, C.M., Je, B.I., Park, S.H., Park, S.J., Piao, H.L., Xuan, Y.H., Choe, M.S., Satoh, K,. Kikuchi, S., Lee, K.H., Cha, Y.S., Ahn, B.O., Ji, H.S., Yun, D.W., Lee, M.C., Suh, S.C., Eun, M.Y., and Han, C.D. 2007. A Ds‐insertion mutant of OSH6 (Oryza sativa Homeobox 6) exhibits outgrowth of vestigial leaf‐like structures, bracts, in rice. Planta 227:1‐12. doi: 10.1007/s00425‐007‐0576‐1.
  Park, S.H., Jun, N.S., Kim, C.M., Oh, T.Y., Huang, J., Xuan, Y.H., Park, S.J., Je, B.I., Piao, H.L., Park, S.H., Cha, Y.S., Ahn, B.O., Ji, H.S., Lee, M.C., Suh, S.C., Nam, M.H., Eun, M.Y., Yi, G., Yun, D.W., and Han, C.D. 2007. Analysis of gene‐trap Ds rice populations in Korea. Plant Mol. Biol. 65:373‐384. doi: 10.1007/s11103‐007‐9192‐5.
  Ryu, C.H., You, J.H., Kang, H.G., Hur, J., Kim, Y.H., Han, M.J., An, K., Chung, B.C., Lee, C.H., and An, G. 2004. Generation of T‐DNA tagging lines with a bidirectional gene trap vector and the establishment of an insertion‐site database. Plant Mol. Biol. 54:489‐502. doi: 10.1023/B:PLAN.0000038257.93381.05.
  Sallaud, C., Meynard, D., Van Boxtel, J., Gay, C., Bès, M., Brizard, J., Larmande, P., Ortega, D., Raynal, M., and Portefaix, M. 2003. Highly efficient production and characterization of T‐DNA plants for rice (Oryza sativa L.) functional genomics. Theor. Appl. Genet. 106:1396‐1408.
  Sallaud, C., Gay, C., Larmande, P., Bès, M., Piffanelli, P., Piégu, B., Droc, G., Regad, F., Bourgeois, E., and Meynard, D. 2004. High throughput T‐DNA insertion mutagenesis in rice: A first step towards in silico reverse genetics. Plant J. 39:450‐464. doi: 10.1111/j.1365‐313X.2004.02145.x.
  Shaw, C.H. 1995 Introduction of cloning plasmids into Agrobacterium tumefaciens. Methods Mol. Biol. 49:33‐37.
  Skarnes, W.C. 1990. Entrapment vectors: A new tool for mammalian genetics. Nat. Biotechnol. 8:827‐831. doi: 10.1038/nbt0990‐827.
  Sundaresan, V. 1996. Horizontal spread of transposon mutagenesis: New uses for old elements. Trends Plant Sci. 1:184‐190. doi: 10.1016/1360‐1385(96)10022‐4.
  Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J.D.G., Dean, C., Ma, H., and Martienssen, R. 1995 Patterns of gene action in plant development revealed by enhancer trap and gene trap transposable elements. Genes Dev. 9, 1797‐1810. doi: 10.1101/gad.9.14.1797.
  Upadhyaya, N.M., Zhu, Q.H., Zhou, X.R., Eamens, A.L., Hoque, M.S., Ramm, K., Shivakkumar, R., Smith, K.F., Pan, S.T., and Li, S. 2006. Dissociation (Ds) constructs, mapped Ds launch pads and a transiently‐expressed transposase system suitable for localized insertional mutagenesis in rice. Theor. Appl. Genet. 112:1326‐1341. doi: 10.1007/s00122‐006‐0235‐0.
  van Enckevort, L.E.J., Droc, G., Piffanelli, P., Greco, R., Gagneur, C., Weber, C., González, V.M., Cabot, P., Fornara, F., and Berri, S. 2005. EU‐OSTID: A collection of transposon insertional mutants for functional genomics in rice. Plant Mol. Biol. 59:99‐110. doi: 10.1007/s11103‐005‐8532‐6.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Walbot, V. 2000. Saturation mutagenesis using maize transposons. Curr. Opin. Plant Biol. 3:103‐107. doi: 10.1016/S1369‐5266(99)00051‐5.
  Wu, C., Li, X., Yuan, W., Chen, G., Kilian, A., Li, J., Xu, C., Li, X., Zhou, D.X., and Wang, S. 2003. Development of enhancer trap lines for functional analysis of the rice genome. Plant J. 35:418‐427. doi: 10.1046/j.1365‐313X.2003.01808.x.
  Wu, J.L., Wu, C., Lei, C., Baraoidan, M., Bordeos, A., Madamba, M.R., Ramos‐Pamplona, M., Mauleon, R., Portugal, A., Ulat, V.J., Bruskiewich, R., Wang, G., Leach, J., Khush, G., and Leung, H. 2005. Chemical‐ and irradiation‐induced mutants of indica rice IR64 for forward and reverse genetics. Plant Mol. Biol. 59:85‐97. doi: 10.1007/s11103‐004‐5112‐0.
  Zhang, J., Li, C., Wu, C., Xiong, L., Chen, G., Zhang, Q., and Wang, S. 2006. RMD: A rice mutant database for functional analysis of the rice genome. Nucleic Acids Res. 34:D745‐D748. doi: 10.1093/nar/gkj016.
  Zhang, J., Guo, D., Chang, Y., You, C., Li, X., Dai, X., Weng, Q., Zhang, J., Chen, G., and Li, X. 2007. Non‐random distribution of T‐DNA insertions at various levels of the genome hierarchy as revealed by analyzing 13 804 T‐DNA flanking sequences from an enhancer‐trap mutant library. Plant J. 49:947‐959. doi: 10.1111/j.1365‐313X.2006.03001.x.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library