A Homogeneous Assay to Assess GABA Transporter Activity

Karla K. Kopec1, Beth Ann McKenna1, Daniel Pauletti1

1 Cephalon, Inc., West Chester, Pennsylvania
Publication Name:  Current Protocols in Pharmacology
Unit Number:  Unit 1.32
DOI:  10.1002/0471141755.ph0132s30
Online Posting Date:  October, 2005
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes a convenient functional uptake assay for GABA transport into cell lines transiently transfected with GABA transporter‐1 (GAT‐1) and other GAT isoforms. This facile, homogeneous assay allows for the determination of Km, Vmax, and Ki values. The assay utilizes commercially available microtiter plates that contain scintillant embedded in the bottom of the wells. Whereas a signal is generated as the cell accumulates the labeled neurotransmitter, label in the medium is undetected. While GABA uptake is observed in several cell lines transfected with GAT‐1, Km values for GABA uptake may vary with the cell line. This indicates that the choice of cell line is an important consideration when conducting uptake assays.

Keywords: GABA; transporter; functional; uptake; GAT; transient; transfection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Measurement of GABA Uptake in Transiently Transfected Cell Lines
  • Alternate Protocol 1: Batch Transfection of Cell Lines for GABA Uptake Assay
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Measurement of GABA Uptake in Transiently Transfected Cell Lines

  Materials
  • Lennox broth (Fisher Scientific)
  • Carbenicillin (Sigma)
  • I.M.A.G.E. clone (ID no. 5264672) for GAT‐1 (Invitrogen); supplied as a frozen, glycerol stock
  • Mini‐prep and midi‐prep kits (Promega)
  • Sense oligomer: 5′‐GATATCCACCATGGCGACCAACGGCAGCAAG‐3′ (EcoRV restriction site underlined; consensus Kozak sequence in bold)
  • Antisense oligomer: 5′‐GAATTCCTAGATGTAGGCCTCCTTGC‐3′ (EcoRI restriction site underlined)
  • Gel filtration unit
  • Pfx polymerase kit (Invitrogen)
  • 0.8% SeaChem ME agarose gel (FMC; see Voytas, )
  • TAE buffer (see recipe)
  • Ethidium bromide
  • GENECLEAN II kit (Qbiogene)
  • TOPO TA cloning kit (Invitrogen)
  • LB agar plates ( appendix 2A)
  • EcoRV and EcoRI endonucleases (Promega)
  • pIRESpuro3 (Clontech)
  • High‐mass DNA ladder (Invitrogen)
  • T4 DNA ligase and 10× buffer
  • Hexammine cobalt III chloride (e.g., Sigma)
  • E. coli DH5α (Invitrogen)
  • Collagen‐coated Cytostar‐T scintillating microplates (see recipe)
  • Endotoxin‐free maxi prep kit (Qiagen)
  • COS‐7 cells (ATCC no. CRL‐1651)
  • Growth medium for cells, warmed to 37°C (see recipe)
  • Calcium‐ and magnesium‐free PBS (CMF‐PBS; e.g., Invitrogen)
  • 0.25% trypsin/0.1% EDTA solution
  • 0.4% trypan blue solution in CMF‐PBS
  • Opti‐MEM I serum‐free medium (Invitrogen)
  • Lipofectamine 2000 transfection reagent (Invitrogen)
  • Dulbecco's modified eagle medium (DMEM) with 4.5 g/liter glucose, with and without 1× L glutamine (add from 100 × L‐glutamine stock, e.g., Invitrogen)
  • GAT uptake buffer (see recipe) with and without 4× (3.2% v/v) dimethylsulfoxide (DMSO)
  • GAT‐1 inhibitor compounds (see recipe), e.g., CI‐966 (Tocris) and NO‐711 (Sigma)
  • GABA substrate for GAT‐1 (see recipe)
  • 10× GABA stop solution (see recipe)
  • Mini submarine electrophoresis unit
  • Hemacytometer
  • Multichannel pipettor
  • Cell washer (Labsystems; optional)
  • Jitterbug (Boekel Scientific; optional)
  • Plate sealer tape for 96‐well microtiter plates
  • Microtiter plate scintillation counter
  • Curve‐fitting software (e.g., Prism; GraphPad)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )
NOTE: All cell culture incubations are performed in a 37°C, 10% CO 2 humidified incubator.NOTE: Prior to conducting the uptake assays, all cell cultures are handled in a sterile field in a laminar flow biosafety cabinet. All materials coming into contact with cell cultures should be sterile.NOTE: Uptake assays are performed at 37°C using a plate warmer, and microtiter plates are handled at the bench.CAUTION: Radioactive material should be handled and disposed of appropriately, including microtiter plates and well contents.

Alternate Protocol 1: Batch Transfection of Cell Lines for GABA Uptake Assay

  Materials
  • HEK‐293 cells (ATCC no. CRL‐1573)
  • 0.4% trypan blue solution
  • HEK‐293 growth medium
  • GAT plasmid DNA
  • Opti‐MEM I serum‐free medium (Invitrogen)
  • Lipofectamine 2000 transfection reagent (Invitrogen)
  • Serum‐free DMEM with 4.5 g/liter glucose, without glutamine
  • Poly‐L‐ornithine hydrobromide and laminin (see recipe)
  • Calcium‐ and magnesium‐free PBS (CMF‐PBS)
  • 0.25% trypsin/0.1% EDTA
  • Hemacytometer
  • 100 × 20–mm dishes, tissue‐culture treated (Falcon)
  • Cytostar‐T scintillating microplates (Amersham Biosciences)
NOTE: All cell culture incubations are performed in a 37°C, 10% CO 2 humidified incubator.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Borden, L.A., Smith, K.E., Hartig, P.R., Branchek, T.A., and Weinshank, R.L. 1992. Molecular heterogeneity of the gamma‐aminobutyric acid transport system. J. Biol. Chem. 267:21098‐21104.
   Borden, L.A., Dhar, T.G.M., Smith, K.E., Weinshank, R.L., Branchek, T.A., and Gluchowski, C. 1994. Tiagabine, SK&F 89976‐A, CI‐966, and NNC‐711 are selective for the cloned GABA transporter GAT‐1. Eur. J. Pharmacol. 269:219‐224.
   Braestrup, C., Nielsen, E.B., Sonnewald, U., Knutsen, L.J.S., Andersen, K.E., Jansen, J.A., Frederiksen, K., Andersen, P.H., Mortensen, A., and Suzdak, P.D. 1990. (R)‐N‐[4,4‐Bis(3‐methyl‐2‐thienyl)but‐en‐l‐yl]nipecotic acid binds with high affinity to the brain gamma‐aminobutyric acid uptake carrier. J. Neurochem. 54:639‐647.
   Corey, J.L., Guastella, J., Davidson, N., and Lester, H.A. 1994. GABA uptake and release by a mammalian cell line stably expressing a cloned rat brain GABA transporter. Mol. Membr. Biol. 11:23‐30.
   Gadea, A. and Lopez‐Colome, A.M. 2001. Glial transporters for glutamate, glycine, and GABA: II. GABA transporters. J. Neurosci. Res. 63:461‐468.
   Law, R.M., Stafford, A., and Quick, M.W. 2000. Functional regulation of gamma‐aminobutyric acid transporters by direct tyrosine phosphorylation. J. Biol. Chem. 275:23986‐23991.
   Sarap, A., Larrson, O.M., and Schousboe, A. 2003. GABA transporters and GABA‐transaminase as drug targets. Curr. Drug Targets CNS Neurol. Disord. 2:269‐277.
   Schousboe, A., Sarap, A., Larrson, O.M., and White, H.S. 2004. GABA transporters as drug targets for modulation of GABAergic activity. Biochem. Pharmacol. 68:1557‐1563.
   Sitte, H.H., Singer, E.A., and Scholze, P. 2002. Bi‐directional transport of GABA in human embryonic kidney (HEK) cells stably expressing the rat GABA transporter GAT‐1. Br. J. Pharmacol. 135:93‐102.
   Voytas, D., 1988. Agarose gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.5.1‐2.5.9. John Wiley & Sons, Hoboken, N.J.
   Yamauchi, A., Uchida, S., Kwon, H.M., Preston, A.S., Robey, R.B., Garcia‐Perez, A., Burg, M.B., and Handler, J.S. 1992. Cloning of a Na(+)‐ and Cl(−)‐dependent betaine transporter that is regulated by hypertonicity. J. Biol. Chem. 267:649‐652.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library