Topoisomerase Assays

John L. Nitiss1,2, Eroica Soans1, Anna Rogojina1,2, Aman Seth1, Margarita Mishina1

1 Molecular Pharmacology Department, St. Jude Children's Research Hospital, Memphis, Tennessee, 2 Biopharmaceutical Sciences Department, University of Illinois College of Pharmacy at Rockford, Rockford, Illinois
Publication Name:  Current Protocols in Pharmacology
Unit Number:  Unit 3.3
DOI:  10.1002/0471141755.ph0303s57
Online Posting Date:  June, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Topoisomerases are nuclear enzymes that play essential roles in DNA replication, transcription, chromosome segregation, and recombination. All cells have two major forms of topoisomerases: type I enzymes, which make single‐stranded cuts in DNA, and type II enzymes, which cut and pass double‐stranded DNA. DNA topoisomerases are important targets of approved and experimental anti‐cancer agents. The protocols described in this unit are for assays used to assess new chemical entities for their ability to inhibit both forms of DNA topoisomerase. Included are an in vitro assay for topoisomerase I activity based on relaxation of supercoiled DNA, and an assay for topoisomerase II based on the decatenation of double‐stranded DNA. The preparation of mammalian cell extracts for assaying topoisomerase activity is described, along with a protocol for an ICE assay to examine topoisomerase covalent complexes in vivo, and an assay for measuring DNA cleavage in vitro. Curr. Protoc. Pharmacol. 57:3.3.1‐3.3.27. © 2012 by John Wiley & Sons, Inc.

Keywords: topoisomerase; topoisomerase I; topoisomerase II; camptothecin; etoposide; topoisomerase poison

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Assay of Topoisomerase I Activity
  • Basic Protocol 2: Assay of Topoisomerase II Activity
  • Support Protocol: Preparation of Mammalian Cell Extracts for Assaying Topoisomerase Activity
  • Basic Protocol 3: In Vivo Determination of Topoisomerase Covalent Complexes using the In‐Vivo Complex of Enzyme (ICE) Assay
  • Support Protocol: Preparation of Mouse Tissue for In Vivo Determination of Topoisomerase Covalent Complexes using the In Vivo Complex of Enzyme (ICE) Assay
  • Basic Protocol 4: Determination of DNA Cleavage by Purified Topoisomerase I
  • Basic Protocol 5: Determination of Inhibitor Effects on DNA Cleavage by Topoisomerase II using a Plasmid Linearization Assay
  • Alternate Protocol: Gel Electrophoresis Determination of Topoisomerase II Cleavage
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Assay of Topoisomerase I Activity

 Materials
  • 10× topoisomerase I reaction buffer (see recipe)
  • Substrate: plasmid DNA
  • Purified topoisomerase I or cell extract (see Support Protocol)
  • 5× loading dye (see recipe)
  • 0.8% agarose gel (Voytas, 2001)
  • Additional reagents and equipment for agarose gel electrophoresis, ethidium bromide staining, and gel photography (Voytas, 2001)

Basic Protocol 2: Assay of Topoisomerase II Activity

 Materials
  • 10× topoisomerase II reaction buffer (see recipe)
  • Substrate: kinetoplast DNA (Topogen, http://www.topogen.com)
  • Purified topoisomerase II (see Critical Parameters) or cell extract (see Support Protocol)
  • 5× loading dye (see recipe)
  • 0.8% agarose gel (Voytas, 2001)
  • Additional reagents and equipment for agarose gel electrophoresis, ethidium bromide staining, and gel photography (Voytas, 2001)

Support Protocol: Preparation of Mammalian Cell Extracts for Assaying Topoisomerase Activity

 Materials
  • Cells of interest growing in tissue culture: e.g., HeLa (ATCC #CCL‐2.2) or K562 (ATCC #HB‐84)
  • Phosphate‐buffered saline (PBS; see recipe), room temperature and ice cold
  • PBS (see recipe) containing 5 mM EDTA
  • Low‐salt extraction buffer (see recipe), ice cold
  • High‐salt extraction buffer: low‐salt extraction buffer containing 0.35 M KCl
  • 15‐ml centrifuge tubes
  • Hemacytometer (or automated cell counter)
  • Refrigerated centrifuge
  • Dounce homogenizer with loose pestle, precooled
  • Phase‐contrast microscope
  • Additional reagents and equipment for measuring protein concentration (appendix 3A)

Basic Protocol 3: In Vivo Determination of Topoisomerase Covalent Complexes using the In‐Vivo Complex of Enzyme (ICE) Assay

 Materials
  • Cells of interest: e.g., HeLa (ATCC #CCL‐2.2) or K562 (ATCC #HB‐84)
  • Test compound(s)
  • 1% (w/v) Sarkosyl in 1× TE buffer (see appendix 2A for TE buffer)
  • CsCl solution: add 75 g of CsCl (molecular biology grade) to 50 ml H2O; if necessary, warm to completely dissolve the CsCl (stable indefinitely at room temperature)
  • 70% ethanol
  • 1× TE buffer, pH 7.5 (appendix 2A)
  • 25 mM sodium phosphate buffer, pH 6.5 (appendix 2A)
  • PBS‐T: 1× phosphate‐buffered saline (see recipe) containing 0.01% (v/v) Tween 20
  • Blocking solution: 5% (w/v) instant non‐fat dry milk (Nestle, Carnation) in PBS‐T
  • Primary antibody, e.g.:
    • Rabbit anti‐ human TOPIIα IgG antibody (Bethyl Laboratories, cat. no. BL 983)
    • Mouse anti‐human TOPIIβ IgG antibody (BD Transduction Laboratories, cat. no. 611493)
  • Secondary antibodies:
    • For rabbit primary antibody: ECL anti‐rabbit IgG, horse peroxidase‐linked antibody from donkey (Amersham, cat. no. NA934V)
    • For mouse primary antibody: ECL anti‐mouse IgG, horse peroxidase‐linked antibody from donkey (Amersham, cat. no. NA934V)
  • Amersham ECL Plus Western Blotting Detection Reagents (GE Healthcare, cat. no. RPN2132)
  • 100‐mm culture dishes
  • 14‐ml polypropylene round‐bottom tubes
  • 1‐ml latex‐free syringe with 25‐G 5/8 in. needle (Becton Dickinson)
  • 3‐ml latex‐free syringe with a 16‐G 1/2 in. precision‐glide needle (Becton Dickinson)
  • OptiSeal tubes for ultracentrifugation (Beckman Coulter)
  • Beckman ultracentrifuge with NVt90 rotor, or equivalent
  • Sharp blade
  • 65°C water bath
  • Trans Blot nitrocellulose membrane (BioRad, cat. no. 162‐0115)
  • Slot‐format filter paper (BioRad, cat. no. 162‐0161)
  • Slot blotting apparatus (Bio‐Dot SF apparatus, BioRad, cat. no. 170‐6542)
  • Hoefer Red orbital shaker, or equivalent
  • Additional reagents and equipment for quantitation of DNA (Desjardins and Conklin, 2011; Gallagher, 2011)

Support Protocol: Preparation of Mouse Tissue for In Vivo Determination of Topoisomerase Covalent Complexes using the In Vivo Complex of Enzyme (ICE) Assay

 Materials
  • Mouse tissue sample
  • 1% (w/v) Sarkosyl in 1× TE buffer (see appendix 2A for TE buffer)
  • 2‐ml tissue grinder (Wheaton)
  • 14‐ml polypropylene round‐bottom tube
  • 1‐ml latex‐free syringe with 25‐G 5/8 in. needle (Becton Dickinson)
  • Additional reagents and equipment for ICE Assay (Basic Protocol 3)

Basic Protocol 4: Determination of DNA Cleavage by Purified Topoisomerase I

 Materials
  • Oligonucleotides (custom‐synthesized):
    • 5′‐GATCTAAAAGACTTGGAAAAATTTTTAAAAAAGATC‐3′ (upper strand)
    • 5′‐GATCTTTTTTAAAAATTTTTCCAAGTCTTTTAGATC‐3′ (lower strand)
  • [α‐32P]cordycepin 5000 Ci/mmol (Perkin‐Elmer Product BLU26250UC)
  • Terminal deoxynucleotidyl transferase (TdT) labeling kit (Stratagene)
  • 10× topoisomerase I cleavage buffer (see recipe)
  • 50 U/µl purified topoisomerase I (Topogen; also see Critical Parameters; 1 U topoisomerase I is the quantity of enzyme that will relax 200 ng pUC18 DNA in 30 min)
  • Compounds to be tested
  • 5% (w/v) SDS
  • Formamide loading buffer (see recipe)
  • 30‐ to 40‐cm denaturing 16% polyacrylamide/7 M urea sequencing gel prepared as described in Slatko and Albright (1992); also see Albright and Slatko (2001); electrophoresis of DNA on sequencing gels requires a large vertical gel apparatus, a high‐voltage power supply, and a darkroom for developing autoradiograms (or a phosphoimager)
  • Sephadex G‐25 spin columns (GE Healthcare)
  • Scintillation vials, scintillation fluid, and counter
  • 95°C heating block
  • 400‐µl microcentrifuge tubes
  • 25°C water bath
  • Whatman 3MM filter paper
  • Additional reagents and equipment for sequencing by denaturing polyacrylamide gel electrophoresis (Slatko and Albright, 1992; Albright and Slatko, 2001)

CAUTION: Radioactive materials require special handling; all supernatants must be considered radioactive waste and disposed of appropriately.

Basic Protocol 5: Determination of Inhibitor Effects on DNA Cleavage by Topoisomerase II using a Plasmid Linearization Assay

 Materials
  • 10× topoisomerase II reaction buffer
  • Supercoiled plasmid DNA (see Critical Parameters)
  • Test compound(s)
  • Positive control (e.g., etoposide, mAMSA)
  • 4 to 20 U/µl purified topoisomerase II (see Critical Parameters)
  • 10% (w/v) SDS
  • 250 mM tetrasodium EDTA, pH 8.0
  • 4 mg/ml stock solution of proteinase K: dilute to 0.8 mg/ml before use
  • 20 mM ATP (diluted with H2O from purchased stock solution; store up to 6 months in small aliquots at −20°C)
  • 5× loading dye (see recipe)
  • 0.8% agarose gel (Voytas, 2001)
  • Restriction enzyme appropriate for cutting plasmid once, to linearize plasmid
  • 10 mg/ml ethidium bromide stock solution: store at room temperature, protected from light
  • Gel densitometer
  • Additional reagents and equipment for performing agarose gel electrophoresis, ethidium bromide staining, and gel photography (Voytas, 2001)

Alternate Protocol: Gel Electrophoresis Determination of Topoisomerase II Cleavage

 Materials
  • Substrate: plasmid DNA (e.g., pUC18 or pBluescript)
  • EcoRI restriction endonuclease (additional restriction endonuclease, e.g., BamHI is optional)
  • Formamide loading buffer (see recipe)
  • 0.8% agarose gels (Voytas, 2001)
  • TE buffer, pH 8.0 (appendix 2A)
  • 5 mM dCTP, dGTP, and dTTP
  • 5 U/µl Klenow fragment of DNA polymerase I and 10× Klenow buffer
  • 10 mCi/ml [α‐32P] dATP (800 Ci/mmol; Perkin‐Elmer)
  • 10× topoisomerase II reaction buffer (see recipe)
  • Compounds to be tested
  • 20 to 40 U/µl purified topoisomerase II
  • 5% (w/v) SDS containing 1 mg/ml proteinase K
  • 5× loading dye (see recipe)
  • Sephadex G‐25 spin column (GE Healthcare)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, 2001), purification of DNA by phenol/chloroform/isoamyl alcohol extraction and ethanol precipitation (appendix 3C), and autoradiography (Voytas and Ke, 2001)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 3.3.1 Reactions of DNA topoisomerases. DNA topoisomerases catalyze the interconversion of different topological forms of DNA, such as the knotting and unknotting of DNA and catenation and decatenation of DNA rings. Type I topoisomerases are able to unknot or decatenate single‐stranded knots and catenanes, but are unable to carry out these reactions on intact double‐stranded DNA. (A) Both type I and type II topoisomerases can relax supercoiled DNA. Type II topoisomerases are able to carry out (B) the knotting/unknotting of intact double‐stranded DNA and (C) the catenation/decatenation of intact double‐stranded DNA.
  •  FigureFigure 3.3.2 Gels obtained from topoisomerase I activity assays. Yeast topoisomerase I was purified from yeast cells expressing wild‐type yeast Top1 from the Gal1 promoter. (A) Lane λ, λ HindIII molecular weight markers; lane S, 0.1 µg pUC18 plasmid with no added protein; other lanes contain decreasing amounts of purified protein. Samples were electrophoresed on a 1.0% agarose gel. (B) The same conditions as in panel A, lane 4, were used, but increasing concentrations of ethidium bromide were added (from 100 ng/ml to 2 µg/ml ethidium bromide). Ethidium bromide is not an inhibitor of Top1, but because it intercalates and unwinds DNA, carrying out the reaction in the presence of ethidium bromide introduces positive supercoils in the DNA, which can be relaxed by Top1. Therefore, one might erroneously conclude that ethidium bromide inhibits Top1. Approaches to distinguish effects of intercalation are discussed in detail by Bailly (Bailly, 2001).
  •  FigureFigure 3.3.3 Topoisomerase II decatenation assay. Different amounts of purified yeast topoisomerase II were added to reactions that contained 0.2 µg kinetoplast DNA as a substrate. Lane M, λ HindIII molecular weight markers; lane S, substrate DNA; lane 1, substrate and 5 ng purified yeast topoisomerase II; lane 2, substrate and 50 ng purified yeast topoisomerase II; lane 3, substrate and 100 ng purified yeast topoisomerase II; lane 4, substrate and 200 ng purified yeast topoisomerase II; lane 5, substrate and 500 ng purified yeast topoisomerase II; lane 6, substrate and 1 µg purified yeast topoisomerase II. The fluorescence just below the well in lane S is due to the catenated kinetoplast DNA that fails to enter the gel; the decatenated product is clearly seen in lanes 1 to 5. Samples were electrophoresed on a 0.8% agarose gel.
  •  FigureFigure 3.3.4 ICE assay of Top2 covalent complexes. HeLa cells were treated with various etoposide concentrations for 1 hr. The ICE assay was performed as described in Basic Protocol 3, and the slot blots of DNA recovered from the pellet after CsCl centrifugation, probed with an antibody directed against Top2 α, are shown in panel (A). The signal arises from Top2 that covalently associates with DNA. Panel (B) shows a quantitation of the signal from the blot shown in panel A.
  •  FigureFigure 3.3.5 Schematic representation of in vitro cleavage of a double‐stranded oligonucleotide by topoisomerase I. The annealed oligonucleotides are shown; “*L” indicates the cordycepin label. Note that only the top strand is labeled. Upon addition of topoisomerase I and camptothecin, a specific cleavage by topoisomerase I occurs. The oligonucleotide is designed so that cleavage occurs specifically at the site indicated by the arrow. The topoisomerase I protein is trapped on the DNA upon addition of SDS, and the strands are separated by the addition of formamide. If no topoisomerase I cleavage occurs, the only product observed on a sequencing gel is the 37‐nucleotide labeled substrate (the top strand). Topoisomerase I cleavage results in a smaller oligonucleotide. Note that the oligonucleotide that has protein covalently bound is unlabeled, so it will not be detected.
  •  FigureFigure 3.3.6 Plasmid DNA cleavage with purified Top2. The plasmid cleavage assay was carried out with 2 µg of purified yeast Top2 (a very high concentration). Lanes: λ HindIII markers; Sc, substrate with no added protein; L, pUC18 linearized with a restriction enzyme; and increasing concentrations of etoposide as indicated on the figure. Note that a band that has the same electrophoretic mobility as linear DNA is absent without etoposide, but clearly seen when 1 µg/ml of etoposide is added. The linear DNA is seen with 3 µg/ml etoposide, and decreases in intensity as more etoposide is added. Samples containing ≥ 3 µg/ml of etoposide show smearing of DNA that arises from cleaving the DNA at multiple sites. This smearing is readily interpretable when purified Top2 is used; however, care must be taken with crude enzyme preparations that may contain contaminating nuclease activity.
  •  FigureFigure 3.3.7 DNA cleavage with purified Top2. DNA cleavage assays were carried out using 32P end‐labeled pUC18 DNA. Cleavage was carried out in the absence of inhibitor (lane marked 0), in the presence of 0.2 µg/ml mAMSA or 1.0 µg/ml mAMSA. Enzyme concentrations added ranged from 2 units (50 ng) to 25 units (1.25 µg).

Videos

Literature Cited

Literature Cited
    Albright, L.M. and Slatko, B.E. 2001. Denaturing polyacrylamide gel electrophoresis. Curr. Protoc. Nucleic Acid Chem. 00:A.3B.1‐A.3B.5.
    Anderson, V.E., Zaniewski, R.P., Kaczmarek, F.S., Gootz, T.D., and Osheroff, N. 1999. Quinolones inhibit DNA religation mediated by Staphylococcus aureus topoisomerase IV. Changes in drug mechanism across evolutionary boundaries. J. Biol. Chem. 274:35927‐35932.
    Andoh, T. and Ishida, R. 1998. Catalytic inhibitors of DNA topoisomerase II. Biochim. Biophys. Acta 1400:155‐171.
    Austin, C.A., Sng, J.H., Patel, S., and Fisher, L.M. 1993. Novel HeLa topoisomerase II is the II beta isoform: Complete coding sequence and homology with other type II topoisomerases. Biochim. Biophys. Acta 1172:283‐291.
    Austin, C.A., Marsh, K.L., Wasserman, R.A., Willmore, E., Sayer, P.J., Wang, J.C., and Fisher, L.M. 1995. Expression, domain structure, and enzymatic properties of an active recombinant human DNA topoisomerase II beta. J. Biol. Chem. 270:15739‐15746.
    Bailly, C. 2001. DNA relaxation and cleavage assays to study topoisomerase I inhibitors. Methods Enzymol. 340:610‐623.
    Bonven, B.J., Gocke, E., and Westergaard, O. 1985. A high affinity topoisomerase I binding sequence is clustered at DNAase I hypersensitive sites in Tetrahymena R‐chromatin. Cell 41:541‐551.
    Burden, D.A. and Osheroff, N. 1999. In vitro evolution of preferred topoisomerase II DNA cleavage sites. J. Biol. Chem. 274:5227‐5235.
    Burden, D.A., Froelich‐Ammon, S.J., and Osheroff, N. 2001. Topoisomerase II‐mediated cleavage of plasmid DNA. Methods Mol Biol. 95:283‐289.
    Desjardins, P.R. and Conklin, D. S. 2011. Microvolume quantitation of nucleic acids. Curr. Protoc. Mol. Biol. 93:A.3J.1‐A.3J.16.
    Dexheimer, T.S. and Pommier, Y. 2008. DNA cleavage assay for the identification of topoisomerase I inhibitors. Nat. Protoc. 3:1736‐1750.
    Drake, F.H., Zimmerman, J.P., McCabe, F.L., Bartus, H.F., Per, S.R., Sullivan, D.M., Ross, W.E., Mattern, M.R., Johnson, R.K., Crooke, S.T. et al. 1987. Purification of topoisomerase II from amsacrine‐resistant P388 leukemia cells: Evidence for two forms of the enzyme. J. Biol. Chem. 262:16739‐16747.
    Drake, F.H., Hofmann, G.A., Mong, S.M., Bartus, J.O., Hertzberg, R.P., Johnson, R.K., Mattern, M.R., and Mirabelli, C.K. 1989. In vitro and intracellular inhibition of topoisomerase II by the antitumor agent merbarone. Cancer Res. 49:2578‐2583.
    Drlica, K. and Malik, M. 2003. Fluoroquinolones: Action and resistance. Curr. Topics Med. Chem. 3:249‐282.
    Fujimori, A., Harker, W.G., Kohlhagen, G., Hoki, Y., and Pommier, Y. 1995. Mutation at the catalytic site of topoisomerase I in CEM/C2, a human leukemia cell line resistant to camptothecin. Cancer Res. 55:1339‐1346.
    Gallagher, S.R. 2011. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 93:A.3D.1‐A.3D.14.
    Gallagher, S., Winston, S.E., Fuller, S.A., and Hurrell, J.G. 2008. Immunoblotting and immunodetection. Curr. Protoc. Mol. Biol. 44:10.18.1‐10.18.10.
    Guichard, S., Terret, C., Hennebelle, I., Lochon, I., Chevreau, P., Fretigny, E., Selves, J., Chatelut, E., Bugat, R., and Canal, P. 1999. CPT‐11 converting carboxylesterase and topoisomerase activities in tumour and normal colon and liver tissues. Br. J. Cancer 80:364‐370.
    Halligan, B.D., Edwards, K.A., and Liu, L.F. 1985. Purification and characterization of a type II DNA topoisomerase from bovine calf thymus. J. Biol. Chem. 260:2475‐2482.
    Hanai, R., Caron, P.R., and Wang, J.C. 1996. Human TOP3: a single‐copy gene encoding DNA topoisomerase III. Proc. Natl. Acad. Sci. U.S.A. 93:3653‐3657.
    Jannatipour, M., Liu, Y.X., and Nitiss, J.L. 1993. The top2‐5 mutant of yeast topoisomerase II encodes an enzyme resistant to etoposide and amsacrine. J. Biol. Chem. 268:18586‐18592.
    Jensen, L.H., Nitiss, K.C., Rose, A., Dong, J., Zhou, J., Hu, T., Osheroff, N., Jensen, P.B., Sehested, M., and Nitiss, J.L. 2000. A novel mechanism of cell killing by anti‐topoisomerase II bisdioxopiperazines. J. Biol. Chem. 275:2137‐2146.
    Kaufmann, S.H. 1998. Cell death induced by topoisomerase‐targeted drugs: More questions than answers. Biochim. Biophys. Acta 1400:195‐211.
    Kawasaki, K., Minoshima, S., Nakato, E., Shibuya, K., Shintani, A., Schmeits, J.L., Wang, J., and Shimizu, N. 1997. One‐megabase sequence analysis of the human immunoglobulin lambda gene locus. Genome Res. 7:250‐261.
    Kim, R.A. and Wang, J.C. 1992. Identification of the yeast TOP3 gene product as a single strand‐specific DNA topoisomerase. J. Biol. Chem. 267:17178‐17185.
    Knab, A.M., Fertala, J., and Bjornsti, M.A. 1995. A camptothecin‐resistant DNA topoisomerase I mutant exhibits altered sensitivities to other DNA topoisomerase poisons. J. Biol. Chem. 270:6141‐6148.
    Leppard, J.B. and Champoux, J.J. 2005. Human DNA topoisomerase I: Relaxation, roles, and damage control. Chromosoma 114:75‐85.
    Li, T.K. and Liu, L.F. 2001. Tumor cell death induced by topoisomerase‐targeting drugs. Annu. Rev. Pharmacol. Toxicol. 41:53‐77.
    Marini, J.C., Miller, K.G., and Englund, P.T. 1980. Decatenation of kinetoplast DNA by topoisomerases. J. Biol. Chem. 255:4976‐4979.
    McClendon, A.K. and Osheroff, N. 2007. DNA topoisomerase II, genotoxicity, and cancer. Mutat. Res. 623:83‐97.
    Nitiss, J.L. 2009a. DNA topoisomerase II and its growing repertoire of biological functions. Nat. Rev. Cancer 9:327‐337.
    Nitiss, J.L. 2009b. Targeting DNA topoisomerase II in cancer chemotherapy. Nat. Rev. Cancer 9:338‐350.
    Nitiss, J.L. 2009c. Targeting DNA topoisomerase II in cancer chemotherapy. Nat. Rev. Cancer 9:338‐350.
    Nitiss, J.L. and Beck, W.T. 1996. Antitopoisomerase drug action and resistance. Eur. J. Cancer 32A:958‐966.
    Pommier, Y. 2006. Topoisomerase I inhibitors: Camptothecins and beyond. Nat. Rev. Cancer 6:789‐802.
    Pommier, Y., Pourquier, P., Fan, Y., and Strumberg, D. 1998. Mechanism of action of eukaryotic DNA topoisomerase I and drugs targeted to the enzyme. Biochim. Biophys. Acta 1400:83‐105.
    Pommier, Y., Barcelo, J.M., Rao, V.A., Sordet, O., Jobson, A.G., Thibaut, L., Miao, Z.H., Seiler, J.A., Zhang, H., Marchand, C., Agama, K., Nitiss, J.L., and Redon, C. 2006. Repair of topoisomerase I‐mediated DNA damage. Prog. Nucleic Acid Res. Mol. Biol. 81:179‐229.
    Pommier, Y., Leo, E., Zhang, H., and Marchand, C. 2010. DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chem. Biol. 17:421‐433.
    Postow, L., Crisona, N.J., Peter, B.J., Hardy, C.D., and Cozzarelli, N.R. 2001. Topological challenges to DNA replication: Conformations at the fork. Proc. Natl. Acad. Sci. U.S.A. 98:8219‐8226.
    Reid, R.J.D., Benedetti, P., and Bjornsti, M.A. 1998. Yeast as a model organism for studying the actions of DNA topoisomerase‐ targeted drugs. Biochim. Biophys. Acta 1400:289‐300.
    Rogojina, A.T., Li, Z., Nitiss, K.C., and Nitiss, J.L. 2007. "Using yeast tools to dissect the action of anticancer drugs: Mechanisms of enzyme inhibition and cell killing by agents targeting DNA topoisomerases". In Yeast as Tool in Cancer Research (J.L. Nitiss and J. Heitman, eds.) pp. 409‐427. Springer, New York.
    Rubin, E., Pantazis, P., Bharti, A., Toppmeyer, D., Giovanella, B., and Kufe, D. 1994. Identification of a mutant human topoisomerase I with intact catalytic activity and resistance to 9‐nitro‐camptothecin. J. Biol. Chem. 269:2433‐2439.
    Schoeffler, A.J. and Berger, J.M. 2008. DNA topoisomerases: Harnessing and constraining energy to govern chromosome topology. Q. Rev. Biophys. 41:41‐101.
    Slatko, B. and Albright, L.M. 1992. Denaturing gel electrophoresis for sequencing. Curr. Protoc. Mol. Biol. 17:7.6.1‐7.6.13.
    Stewart, L., Ireton, G.C., Parker, L.H., Madden, K.R., and Champoux, J.J. 1996. Biochemical and biophysical analyses of recombinant forms of human topoisomerase I. J. Biol. Chem. 271:7593‐7601.
    Tanizawa, A., Kohn, K.W., Kohlhagen, G., Leteurtre, F., and Pommier, Y. 1995. Differential stabilization of eukaryotic DNA topoisomerase I cleavable complexes by camptothecin derivatives. Biochemistry 34:7200‐7206.
    Tewey, K.M., Chen, G.L., Nelson, E.M., and Liu, L.F. 1984. Intercalative antitumor drugs interfere with the breakage‐reunion reaction of mammalian DNA topoisomerase II. J. Biol. Chem. 259:9182‐9187.
    Vos, S.M., Tretter, E.M., Schmidt, B.H., and Berger, J.M. 2011. All tangled up: How cells direct, manage and exploit topoisomerase function. Nat. Rev. Mol. Cell Biol. 12:827‐841.
    Voytas, D. 2001. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
    Voytas, D. and Ke, N. 2001. Detection and quantitation of radiolabeled proteins and DNA in gels and blots. Curr. Protoc. Mol. Biol. 48:A.3A.1‐A.3A.10.
    Walker, J.V. and Nitiss, J.L. 2002. DNA topoisomerase II as a target for cancer chemotherapy. Cancer Invest. 20:570‐589.
    Wallis, J.W., Chrebet, G., Brodsky, G., Rolfe, M., and Rothstein, R. 1989. A hyper‐recombination mutation in S. cerevisiae identifies a novel eukaryotic topoisomerase. Cell 58:409‐419.
    Wang, J.C. 1996. DNA topoisomerases. Annu. Rev. Biochem. 65:635‐692.
    Wang, J.C. 1998. Moving one DNA double helix through another by a type II DNA topoisomerase: The story of a simple molecular machine. Q. Rev. Biophys. 31:107‐144.
    Wang, J.C. 2002. Cellular roles of DNA topoisomerases: A molecular perspective. Nat. Rev. Mol. Cell Biol. 3:430‐440.
    Wasserman, R.A., Austin, C.A., Fisher, L.M., and Wang, J.C. 1993. Use of yeast in the study of anticancer drugs targeting DNA topoisomerases: Expression of a functional recombinant human DNA topoisomerase II alpha in yeast. Cancer Res. 53:3591‐3596.
    Worland, S.T. and Wang, J.C. 1989. Inducible overexpression, purification, and active site mapping of DNA topoisomerase II from the yeast Saccharomyces cerevisiae. J. Biol. Chem. 264:4412‐4416.
    Zhang, A.L., Lyu, Y.L., Lin, C.P., Zhou, N., Azarova, A.M., Wood, L.M., and Liu, L.F. 2006. A protease pathway for the repair of topoisomerase II‐DNA covalent complexes. J. Biol. Chem. 281:35997‐36003.
    Zhang, H., Barcelo, J.M., Lee, B., Kohlhagen, G., Zimonjic, D.B., Popescu, N.C., and Pommier, Y. 2001. Human mitochondrial topoisomerase I. Proc. Natl. Acad. Sci. U.S.A. 98:10608‐10613.
    Zhelkovsky, A.M. and Moore, C.L. 1994. Overexpression of human DNA topoisomerase I in insect cells using a baculovirus vector. Protein Expr. Purif. 5:364‐370.
 Key References
    Bjornsti, M.A. and Osheroff, N (eds.). DNA Topoisomerase Protocols: Volume I: DNA Topology and Enzymes Methods in Molecular Biology, Vol. 94, 1999 Print ISBN: 978‐0‐89603‐444‐0. Humana Press, Totowa, N.J.
    Bjornsti, M.A. and Osheroff, N (eds.). DNA Topoisomerase Protocols: Volume II: Enzymology and Drugs Methods in Molecular Biology, Vol. 95, 1999 Print ISBN: 978‐0‐89603‐512‐6. Humana Press, Totowa, N.J.

Detailed protocols for many different aspects of DNA topoisomerases.

    Nitiss, J.L. 2009a. See above.
    Wang, J.C. 2002. See above.

Introduction and current status of the biology and biochemistry of DNA topoisomerases.

    Nitiss, J.L. 2009. See above.
    Pommier, Y. 2006. See above.

Introduction to drugs targeting DNA topoisomerases

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library