Tissue Expression Profiling Using Real‐Time PCR

Jay C. Strum1, Kevin M. Carrick1, Joan S. Stuart1, Shelby A. Martensen1

1 GlaxoSmithKline, Research Triangle Park, North Carolina
Publication Name:  Current Protocols in Pharmacology
Unit Number:  Unit 6.9
DOI:  10.1002/0471141755.ph0609s18
Online Posting Date:  November, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The recent development of real‐time PCR allows for the rapid and accurate quantitation of gene expression in cells and tissues. Real‐time PCR instrumentation is designed for the simultaneous quantitation of gene expression from a few samples up to 384 samples. The normal tissue expression profile of a gene can provide useful insights into its potential role in normal physiological processes. When combined with the tissue expression profile of the gene in diseased tissues, information concerning the potential role in pathological processes can be determined. This unit describes a protocol to determine the relative abundance of mRNA in a panel of human tissues using real‐time PCR.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Snap‐frozen human tissues derived from surgical specimens (e.g., The Cooperative Human Tissue Network, National Disease Research Interchange, or commercial sources such as TissueInformatics or Ardais)
  • Qiagen RNeasy Maxi kit (Qiagen) including:
    • Buffer RLT (lysis buffer)
    • 2‐mercaptoethanol (2‐ME)
    • Spin columns and collection tubes
    • Additional RNase‐free reagents
  • 10× transcription buffer (Ambion; cat. no. 8151G)
  • 2 U/µl RNase‐free DNase (Ambion)
  • Reagents for β‐actin master mix (Table 6.9.1)
  • Reagents for cDNA master mix (Table 6.9.2)
  • RiboGreen RNA Quantitation kit (Molecular Probes) including:
    • RiboGreen RNA Quantitation Reagent
    • 20× TE buffer, pH 8.0
    • 100 µg/ml ribosomal RNA standard
  • Reagents for 18S master mix (Table 6.9.3)
  • cDNA of known quantity (e.g., testis cDNA from Clontech)
  • Polytron homogenizer (Brinkmann)
  • GeneQuant II spectrophotometer (Amersham Pharmacia Biotech)
  • 75°C water bath
  • 96‐well optical plates and optical adhesive covers (Applied Biosystems)
  • Sorvall Legend RT centrifuge with Sorvall Heraeus plate carrier
  • ABI Prism 7700 Sequence Detection System (Applied Biosystems) including:
    • Built‐in thermal cycler
    • Laser to induce fluorescence
    • CCD (charge‐coupled device) detector
    • Real‐time sequence detection software
    • Primer Express primer‐design software
    • TaqMan reagents for fluorogenic 5′ nuclease assay (including 2× universal master mix)
  • Power Macintosh computer with 450 MHz or higher processor
  • 96‐well microtiter plates (Falcon)
  • Plate‐reader fluorometer (e.g., CytoFluor 2350; Millipore)
  • Thermal cycler (e.g., GeneAmp PCR System 9600; Applied Biosystems)
  • Additional reagents and equipment for formaldehyde gel electrophoresis (Brown and Mackey, )
    Table 6.9.1   Materials   β‐Actin Master Mix a   β‐Actin Master MixcDNA Conversion Reaction MixPreparation of 18S Master Mix

    Reagent Volume per reaction Final concentration
    2× Universal master mix (provided with ABI Prism 7700 system) 12.5 µl/well
    9 µM β‐Actin forward primer b 2.5 µl/well 900 nM
    9 µM β‐Actin reverse primer c 2.5 µl/well 900 nM
    1.5 µM β‐Actin probe d 2.5 µl/well 150 nM
    RNA sample 5.0 µl/well, 25 µl total volume
    Reagent e Volume per reaction Final concentration
    25 mM MgCl 2 40 µl 5 mM
    10× GeneAmp PCR buffer II 20 µl
    100 mM dNTP mix 2 µl 1 mM
    20 U/µl RNase inhibitor 5 µl 0.5 U/µL
    50 U/µl MuLV reverse transcriptase 10 µl 2.5 U/µL
    50 µM Random hexamers 10 µl 2.5 µM
    Total volume 87 µl
    Reagent Volume per reaction Final concentration
    2× Universal master mix (provided with ABI Prism 7700 system) 12.5 µl/well
    5 µM 18S forward primer f 0.2 µl/well 40 nM
    5 µM 18S reverse primer g 0.1 µl 20 nM
    2 µM 18S probe h 0.625 µl 50 nM
    H 2O 6.575 µl,
    20 µl total volume

     aThe probe and primer sequences here were designed specifically to detect genomic DNA.
     b5′‐TCACCCACACTGTGCCCATCTACGA‐3′.
     c5′‐CAGCGGAACCGCTCATTGCCAATGG‐3′.
     d5′‐ATGCCCTCCCCCATGCCATCCTGCGT‐3′ (with 5′‐reporter and 3′‐quencher; custom‐synthesized by Applied Biosystems).
    Table 6.9.2   Materials   β‐Actin Master Mix a   β‐Actin Master MixcDNA Conversion Reaction MixPreparation of 18S Master Mix

    Reagent Volume per reaction Final concentration
    2× Universal master mix (provided with ABI Prism 7700 system) 12.5 µl/well
    9 µM β‐Actin forward primer b 2.5 µl/well 900 nM
    9 µM β‐Actin reverse primer c 2.5 µl/well 900 nM
    1.5 µM β‐Actin probe d 2.5 µl/well 150 nM
    RNA sample 5.0 µl/well, 25 µl total volume
    Reagent e Volume per reaction Final concentration
    25 mM MgCl 2 40 µl 5 mM
    10× GeneAmp PCR buffer II 20 µl
    100 mM dNTP mix 2 µl 1 mM
    20 U/µl RNase inhibitor 5 µl 0.5 U/µL
    50 U/µl MuLV reverse transcriptase 10 µl 2.5 U/µL
    50 µM Random hexamers 10 µl 2.5 µM
    Total volume 87 µl
    Reagent Volume per reaction Final concentration
    2× Universal master mix (provided with ABI Prism 7700 system) 12.5 µl/well
    5 µM 18S forward primer f 0.2 µl/well 40 nM
    5 µM 18S reverse primer g 0.1 µl 20 nM
    2 µM 18S probe h 0.625 µl 50 nM
    H 2O 6.575 µl,
    20 µl total volume

     eReagents are available from Applied Biosystems.
    Table 6.9.3   Materials   β‐Actin Master Mix a   β‐Actin Master MixcDNA Conversion Reaction MixPreparation of 18S Master Mix

    Reagent Volume per reaction Final concentration
    2× Universal master mix (provided with ABI Prism 7700 system) 12.5 µl/well
    9 µM β‐Actin forward primer b 2.5 µl/well 900 nM
    9 µM β‐Actin reverse primer c 2.5 µl/well 900 nM
    1.5 µM β‐Actin probe d 2.5 µl/well 150 nM
    RNA sample 5.0 µl/well, 25 µl total volume
    Reagent e Volume per reaction Final concentration
    25 mM MgCl 2 40 µl 5 mM
    10× GeneAmp PCR buffer II 20 µl
    100 mM dNTP mix 2 µl 1 mM
    20 U/µl RNase inhibitor 5 µl 0.5 U/µL
    50 U/µl MuLV reverse transcriptase 10 µl 2.5 U/µL
    50 µM Random hexamers 10 µl 2.5 µM
    Total volume 87 µl
    Reagent Volume per reaction Final concentration
    2× Universal master mix (provided with ABI Prism 7700 system) 12.5 µl/well
    5 µM 18S forward primer f 0.2 µl/well 40 nM
    5 µM 18S reverse primer g 0.1 µl 20 nM
    2 µM 18S probe h 0.625 µl 50 nM
    H 2O 6.575 µl,
    20 µl total volume

     f5′‐CGCCGCTAGAGGTGAAATTCT‐3′
     g5′‐CATTCTTGGCAAATGCTTTCG‐3′
     h5′‐ACCGGCGCAAGACGGACCAGA‐3′ (with 5′‐reporter and 3′‐quencher; custom‐synthesized by Applied Biosystems).
CAUTION: Human tissue is a biohazard and should be handled according to the occupational Safety and Health Administration (OSHA) regulations for blood‐borne pathogens (29CFR1910‐1030). This document is available at http://www.osha_slc.gov/OshStd_data/1910_1030.html. Institutional guidelines must be strictly followed.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Brown, T. and Mackey, K. 1997. Analysis of RNA by northern and slot blot hybridization. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 4.9.1‐4.9.16. John Wiley & Sons, New York.
   Bustin, S.A. 2000. Absolute quantification of mRNA using real‐time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25:169‐193.
   Wolfsberg, T.G. and Madden, T.L. 1999. Sequence similarity searching using the BLAST family of proteins. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 19.3.1‐19.3.29. John Wiley & Sons, New York.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library