Studies on Hepatitis C Virus Resistance to Inhibitors in Replicon Systems

Yongsen Zhao1, Mingjun Huang1

1 Achillion Pharmaceuticals, New Haven, Connecticut
Publication Name:  Current Protocols in Pharmacology
Unit Number:  Unit 13B.2
DOI:  10.1002/0471141755.ph13b02s50
Online Posting Date:  September, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Viruses evolve under selection pressure from a particular antiviral agent, resulting in the emergence of organisms that are not susceptible to the drug. This process is referred to as “virus resistance induction.” While conventional in vitro resistance studies are conducted using infectious viruses, the lack of a robust hepatitis C virus (HCV) infection system in cell culture makes such an approach impossible in this case. Instead, cell lines harboring a self‐replicating HCV RNA (or HCV replicon) are used for this purpose. The protocols detailed in this unit describe methods for studying HCV resistance to inhibitors, including the selection of replicon variants resistant to HCV inhibitors, characterization of these variants for their phenotypes and genotypes, and determination of the role of the mutation(s) identified in their genomes. The results from such studies are not only important for lead identification and confirmation of drug targets, but also aid in monitoring the appearance of resistant variants in clinical settings. Curr. Protoc. Pharmacol. 50:13B.2.1‐13B.2.20. © 2010 by John Wiley & Sons, Inc.

Keywords: HCV; replicon; resistance

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Selection of Resistant Hepatitis C Virus Replicon Variants
  • Basic Protocol 2: Isolation of Total RNA from Resistant Replicon Cellular Clones
  • Basic Protocol 3: Determination of Viral Adaptation
  • Basic Protocol 4: Determination of Replicon Sequences (Genotypic Analysis)
  • Basic Protocol 5: Reverse Genetic Study
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Selection of Resistant Hepatitis C Virus Replicon Variants

  Materials
  • Naïve HCV replicon cells carrying neo gene, e.g., Huh‐Luc/neo (licensed from ReBLikon GmbH)
  • Growth medium (see recipe)
  • Selection medium: growth medium containing 250 to 500 µg/ml of G418 (Cellgro, cat. no. 30‐234‐CI)
  • An HCV inhibitor (e.g., 2′‐C‐methyladenosine; Carbosynth, cat. no. NM07917)
  • Trypsin‐EDTA (Invitrogen, cat. no. 25200‐056)
  • 100‐mm tissue culture plates
  • 37°C humidified 5% CO 2
  • 48‐, 24‐, and 6‐well tissue culture plates
  • 1000‐µl pipet
NOTE: All equipment and solutions coming into contact with cells must be sterile, and proper sterile technique should be used in conducting all phases of these studies.

Basic Protocol 2: Isolation of Total RNA from Resistant Replicon Cellular Clones

  Materials
  • Resistant replicon cellular clones ( protocol 1)
  • Growth medium (see recipe)
  • HCV inhibitor (the inducing agent; e.g., 2′‐C‐methyladenosine; Carbosynth, cat. no. NM07917)
  • TRIzol reagent (Invitrogen, cat. no. 15596‐026)
  • Chloroform
  • Isopropyl alcohol
  • 75% ethanol, prepared from 200‐proof ethanol with RNase‐free water
  • RNase‐free water (HyClone, cat. no. SH30538.02)
  • 25‐cm2 tissue culture flasks
  • Microcentrifuge tubes
  • Microcentrifuge
NOTE: All materials used should be RNase‐free and separated from those used for non‐RNA experiments. Since the RNA isolated will be used later for PCR, standard procedures for prevention of plasmid contamination should also be utilized.

Basic Protocol 3: Determination of Viral Adaptation

  Materials
  • Naive Huh‐7 cells licensed from ReBLikon GmbH
  • Growth medium (see recipe)
  • Phosphate‐buffered saline (PBS; Cellgro, cat. no. 21‐030‐CM)
  • Trypsin‐EDTA (Cellgro, cat. no. 25‐053‐CI)
  • Cytomix (see recipe)
  • 200 mM of ATP stock (Sigma, cat. no. A‐2383): adjust pH to 7.6 with KOH, sterilize by filtration, and store in aliquots up to 1 year at –20°C
  • 200 mM of glutathione stock, reduced (Aldrich, cat. no. G‐4705): adjust pH to 7.6 with KOH, sterilize by filtration, and store in aliquots up to 1 year at –20°C
  • Replicon RNA: total RNA isolated from a resistant replicon cellular clone ( protocol 2)
  • Selection medium: growth medium containing 250 to 500 µg/ml of G418 (Cellgro, cat. no. 30‐234‐CI)
  • 75‐cm2 tissue culture flasks
  • 37°C humidified 5% CO 2 incubator
  • 50‐ml conical tubes
  • Hemacytometer
  • Centrifuge
  • Microcentrifuge tubes
  • Electroporation cuvette with 0.4‐cm gap (Molecular BioProducts, cat. no. 5540)
  • Gene Pulser apparatus (Bio‐Rad)
NOTE: Unless indicated otherwise, all transfection steps are performed at room temperature.NOTE: All equipment and solutions coming into contact with cells must be sterile and proper sterile technique used at all times.NOTE: All materials used for electroporation should be kept separate from those used for the experiments where RNase is not employed.

Basic Protocol 4: Determination of Replicon Sequences (Genotypic Analysis)

  Materials
  • Total RNA isolated from replicon cells ( protocol 2)
  • SuperScript First‐Strand Synthesis System for RT‐PCR kit (Invitrogen, cat. no. 11904‐018) containing:
    • 10 mM dNTP mixture (10 mM each dATP, dCTP, dGTP, dTTP)
    • 10× RT buffer
    • 25 mM MgCl 2
    • 0.1 M DTT
    • SuperScript II Reverse Transcriptase
    • RNase H
  • HCV‐specific primer for the strain used
  • RNase, DNase‐free distilled H 2O
  • RNasin
  • Advantage GC 2 PCR kit (BD Biosciences Clontech, cat. no. 639119) containing:
    • 5× GC 2 buffer
    • GC melt
    • 10 mM dNTP mixture
    • PCR‐grade water
    • GC 2 polymerase
  • PCR primers designed for an appropriate HCV strain and gene (see an exemplary primer set for amplification of subgenomic replicons derived from HCV 1b Con‐1 strain in Table 13.2.2)
  • Loading buffer (Invitrogen, cat. no. 10816‐015)
  • 1% agarose gel containing 1 µg/ml ethidium bromide
  • PCR purification kit (Qiagen, cat. no. 28106)
  • 70°, 42°, 45°, 37°C incubators
  • Microcentrifuge tubes
  • Microcentrifuge
  • 0.2‐ml PCR tubes
  • Thermal cycler
  • Electrophoresis apparatus
  • UV light source
  • Lasergene software (DNASTAR)
  • Additional reagents and equipment for isolating total RNA from resistant cells ( protocol 2)
    Table 3.0.2   MaterialsOligonucleotide Primer Sequences

    Nucleoside position b
    Application Primer name Sequence Start End Orientation
    cDNA synthesis HCV‐27 5′ ACTTGATCTGCAGAGAGGCCAGTATCAG 3′ 9605 9578 Reverse
    PCR HCV‐6 5′ AAAAGGGAAAAAAACAGGATGGCCTATTGG 3′ 9426 9397 Reverse
    HCV‐16 5′ AGCTCGACAGGCCGCAGCGGCCTTCAAGTAAC 3′ 8513 8482 Reverse
    HCV‐3 5′ ATGGGCTCTTCATACGGATTCC 3′ 8157 8178 Forward
    HCV‐15 5′ GTGGCTGTTTGCAGCAACCCGATTGCCTTCTGTTTG 3′ 5560 5525 Reverse
    HCV‐13 5′ CAGCGGCGAGGCAGGACTGGTAGG 3′ 4797 4820 Forward
    HCV‐23 5′ GGCGACACTCCACCATAGATCACTCCCCTG 3′ 1634 1663 Forward
    Sequencing HCV‐26 5′ CGAAGCCGCTTGGAATAAGGCCGG 3′ 2877 2900 Forward
    HCV‐11 5′ GCGTATATGTCTAAGGCACATGG 3′ 4137 4159 Forward
    HCV‐21 5′ GGCACTCATCACATATTATGAT 3′ 4296 4275 Reverse
    HCV‐22 5′ TGATCGACTGCAATACATGTGTC 3′ 4693 4715 Forward
    HCV‐17 5′ GATGAGATGGAAGAGTGCGCCTCA 3′ 5457 5480 Forward
    HCV‐15 5′ GTGGCTGTTTGCAGCAACCCGATTGCCTTCTGTTTG 3′ 5560 5525 Reverse
    HCV‐18 5′ ACTGATTTCAAGACCTGGCTCCAG 3′ 6306 6329 Forward
    HCV‐19 5′ TCACATGTCCGGTGATCTGTGCTCCACATG 3′ 6459 6430 Reverse
    HCV‐20 5′ TGCATTGATGGGCAGCTTGGTTTCCTCCGC 3′ 7673 7644 Reverse
    HCV‐1 5′ AAGCGAGGAGGCTAGTGAGGAC 3′ 7565 7586 Forward
    HCV‐3 5′ ATGGGCTCTTCATACGGATTCC 3′ 8157 8178 Forward
    HCV‐6 5′ AAAAGGGAAAAAAACAGGATGGCCTATTGG 3′ 9426 9397 Reverse

     bAll numbers given refer to the position of the corresponding nucleotide of a complete HCV genome (HCV Con‐1; GenBank accession number AJ238799).
NOTE: Usually a primer annealing to the 3′ untranslated region is used in the cDNA synthesis step so any viral gene can be subsequently amplified. Sometimes, a gene‐specific primer is chosen in the cDNA synthesis step to increase the success rate of PCR amplification.NOTE: The standard procedures for prevention of plasmid contamination and cross‐contamination should be implemented during cDNA synthesis and PCR amplification.

Basic Protocol 5: Reverse Genetic Study

  Materials
  • QuikChange II Site‐Directed Mutagenesis kit (Stratagene, cat. no. 200523) containing:
    • 10× reaction buffer
    • dNTP mix
    • PfuUltra High‐Fidelity DNA polymerase
    • Dpn I restriction enzyme
    • Competent cells
  • Plasmid encoding a transient naïve replicon, pFK I341 PI‐Luc/NS3‐3′/ET (licensed from ReBLikon GmbH, Mainz, Germany)
  • Primers for introducing D168V point mutation:
    • Forward primer: GG GTT GCG AAG GCG GTG GTC TTT GTA CCC GTC GAG TCT
    • Reverse primer: complementary sequence of the forward primer
  • Double‐distilled water
  • SOC medium (Invitrogen, cat. no. 15544‐034)
  • 100‐mm LB‐agar plate containing 100 µg/ml ampicillin
  • Mini‐Plasmid Purification kit (Qiagen, cat. no. 27106)
  • 0.2‐ml PCR tubes
  • Thermal cycler
  • Microcentrifuge
  • 37° and 42°C incubators
  • 37°C shaking incubator
  • Additional reagents and equipment for evaluation of anti‐HCV activity in transient replicons (see unit 13.1)
NOTE: Standard procedures for prevention of plasmid contamination and cross contamination should be implemented during PCR amplification.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Eldrup, A.B., Allerson, C.R., Bennett, C.F., Bera, S., Bhat, B., Bhat, N., Bosserman, M.R., Brooks, J., Burlein, C., Carroll, S.S., Cook, P.D., Getty, K.L., MacCoss, M., McMasters, D.R., Olsen, D.B., Prakash, T.P., Prhavc, M., Song, Q., Tomassini, J.E., and Xia, J. 2004. Structure‐activity relationship of purine ribonucleosides for inhibition of hepatitis C virus RNA‐dependent RNA polymerase. J. Med. Chem. 47:2283‐2295.
   Kieffer, T.L., Sarrazin, C., Miller, J.S., Welker, M.W., Forestier, N., Reesink, H.W., Kwong, A.D., and Zeuzem, S. 2007. Telaprevir and pegylated interferon‐alpha‐2a inhibit wild‐type and resistant genotype 1 hepatitis C virus replication in patients. Hepatology 46:631‐639.
   Lin, C., Lin, K., Luong, Y.P., Rao, B.G., Wei, Y.Y., Brennan, D.L., Fulghum, J.R., Hsiao, H.M., Ma, S., Maxwell, J.P., Cottrell, K.M., Perni, R.B., Gates, C.A., and Kwong, A.D. 2004. In vitro resistance studies of hepatitis C virus serine protease inhibitors, VX‐950 and BILN 2061: Structural analysis indicates different resistance mechanisms. J. Biol. Chem. 279:17508‐17514.
   Lin, C., Kwong, A.D., and Perni, R.B. 2006. Discovery and development of VX‐950, a novel, covalent, and reversible inhibitor of hepatitis C virus NS3.4A serine protease. Infect. Disord. Drug Targets 6:3‐16.
   Lohmann, V., Korner, F., Koch, J., Herian, U., Theilmann, L., and Bartenschlager, R. 1999. Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285:110‐113.
   Martell, M., Esteban, J.I., Quer, J., Genesca, J., Weiner, A., Esteban, R., Guardia, J., and Gomez, J. 1992. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: Quasispecies nature of HCV genome distribution. J. Virol. 66:3225‐3229.
   McCown, M.F., Rajyaguru, S., Kular, S., Cammack, N., and Najera, I. 2009. GT‐1a or GT‐1b subtype specific resistance profiles for HCV inhibitors telaprevir or HCV‐796. Antimicrob. Agents Chemother. 53:2129‐2132.
   Neumann, A.U., Lam, N.P., Dahari, H., Gretch, D.R., Wiley, T.E., Layden, T.J., and Perelson, A.S. 1998. Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon‐alpha therapy. Science 282:103‐107.
   Richman, D.D. 2000. The impact of drug resistance on the effectiveness of chemotherapy for chronic hepatitis B. Hepatology 32:866‐867.
   Sarrazin, C., Kieffer, T.L., Bartels, D., Hanzelka, B., Muh, U., Welker, M., Wincheringer, D., Zhou, Y., Chu, H.M., Lin, C., Weegink, C., Reesink, H., Zeuzem, S., and Kwong, A.D. 2007. Dynamic hepatitis C virus genotypic and phenotypic changes in patients treated with the protease inhibitor telaprevir. Gastroenterology 132:1767‐1777.
   Thompson, A.J. and McHutchison, J.G. 2009. Antiviral resistance and specifically targeted therapy for HCV (STAT‐C). J. Viral Hepat. 16:377‐387.
   Trozzi, C., Bartholomew, L., Ceccacci, A., Biasiol, G., Pacini, L., Altamura, S., Narjes, F., Muraglia, E., Paonessa, G., Koch, U., De Francesco, R., Steinkuhler, C., and Migliaccio, G. 2003. In vitro selection and characterization of hepatitis C virus serine protease variants resistant to an active‐site peptide inhibitor. J. Virol. 77:3669‐3679.
   Vrolijk, J.M., Kaul, A., Hansen, B.E., Lohmann, V., Haagmans, B.L., Schalm, S.W., and Bartenschlager, R. 2003. A replicon‐based bioassay for the measurement of interferons in patients with chronic hepatitis C. J. Virol. Methods 110:201‐209.
   Yang, W., Zhao, Y., Fabrycki, J., Hou, X., Nie, X., Sanchez, A., Phadke, A., Deshpande, M., Agarwal, A., and Huang, M. 2008. Selection of replicon variants resistant to ACH‐806, a novel hepatitis C virus inhibitor with no cross‐resistance to NS3 protease and NS5B polymerase inhibitors. Antimicrob. Agents Chemother. 52:2043‐2052.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library