Phage Display for Generating Peptide Reagents

Jennifer R. Brigati1, Tatiana I. Samoylova2, Prashanth K. Jayanna3, Valery A. Petrenko3

1 Division of Natural Sciences, Maryville College, Maryville, Tennessee, 2 Scott‐Ritchey Research Center, College of Veterinary Medicine, Auburn University, Auburn, Alabama, 3 Department of Pathobiology, Auburn University, Alabama
Publication Name:  Current Protocols in Protein Science
Unit Number:  Unit 18.9
DOI:  10.1002/0471140864.ps1809s51
Online Posting Date:  February, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit presents detailed protocols for selection and propagation of landscape phages, which are fusions of filamentous phage fd (or its close relatives M13 and f1) and foreign DNA that result in chimeric phage virions with foreign peptides (8 to 9 amino acids long) covering the entire surface of the phage particles. These landscape phages bind specifically to mammalian and bacterial cells, spores, or discrete molecular targets. Curr. Protoc. Protein Sci. 51:18.9.1‐18.9.27. © 2008 by John Wiley & Sons, Inc.

Keywords: phage display; landscape phage; affinity selection; major coat protein; diagnostic probe; detection; cell‐specific probes

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Selection of Phage Probes for Mammalian Cell Surface Molecules
  • Basic Protocol 2: Confirming Cell Specificity of Selected Phages
  • Basic Protocol 3: Selection of Bacteria‐ or Spore‐Binding Phages
  • Basic Protocol 4: Confirming Specificity of Selected Phages Using Phage‐Capture ELISA
  • Alternate Protocol 1: Confirming Specificity of Selected Phages Using Coprecipitation Assay
  • Basic Protocol 5: Selection of Phage Probes for Discrete Molecular Targets
  • Basic Protocol 6: Confirmation of Phage Selectivity Towards Their Molecular Targets: Phage‐Capture ELISA
  • Alternate Protocol 2: Confirmation of Phage Selectivity Towards Their Molecular Targets: Micropanning
  • Support Protocol 1: Preparation of Starved Cells
  • Support Protocol 2: Phage Titering
  • Support Protocol 3: Identification of Peptides Carried by Selected Phage Clones: PCR Amplification of Phage DNA Segment Encoding Foreign Fusion Peptides
  • Support Protocol 4: Propagation and Purification of Phage Clones
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Selection of Phage Probes for Mammalian Cell Surface Molecules

  Materials
  • Cell lines or primary cell cultures of interest (target cells)
  • Depletion cell lines or primary cell cultures (non‐target cells, see )
  • Cell culture growth media for chosen cell lines/primary cell cultures and corresponding serum‐free media
  • Landscape phage display library f8/8, 4 × 1012 virions/ml (∼109 clones) in blocking buffer
  • Blocking buffer: 0.5% (w/v) bovine serum albumin (BSA) in serum‐free growth medium (prepared fresh before use)
  • Washing buffer: 0.5% (w/v) BSA and 0.1% (v/v) Tween 20 in serum‐free growth medium (prepared fresh before use), cold
  • Elution buffer (see recipe), cold
  • 1 M Tris·Cl, pH 9.1 ( appendix 2E)
  • Lysis buffer (see recipe)
  • Starved E. coli K91BluKan cells ( protocol 9)
  • NZY broth (see recipe) containing 0.2 µg/ml tetracycline (add from 20 mg/ml tetracycline stock in 50% v/v glycerol/H 2O)
  • 20 mg/ml tetracycline in 50% (v/v) glycerol/H 2O (store at –20°C away from light)
  • TBS (see recipe)
  • 25‐cm2 cell culture flasks
  • Cell scrapers, sterile
  • Centricon 100‐kDa centrifugal filter devices (Millipore)
  • 125‐ml conical flasks
  • Additional reagents and equipment for cell culture ( appendix 3C), purification of phage clones by PEG/NaCl precipitation ( protocol 12), phage titering ( protocol 10), and identification of peptides displayed by phage clones ( protocol 11)

Basic Protocol 2: Confirming Cell Specificity of Selected Phages

  Materials
  • Phage clones (from protocol 1) and control phage clones
  • Cell lines or primary cell cultures of interest (target cells)
  • Control cell lines or primary cell cultures (non‐target cells)
  • Cell culture media for chosen cell lines/primary cell cultures and corresponding serum‐free media
  • Blocking buffer: 0.5% (w/v) bovine serum albumin (BSA) in serum‐free growth medium (prepared fresh before use)
  • Washing buffer: 0.5% (w/v) BSA and 0.1% (v/v) Tween 20 in serum‐free growth medium (prepared fresh before use), cold
  • Elution buffer (see recipe)
  • 1 M Tris·Cl, pH 9.1 ( appendix 2E)
  • Lysis buffer (see recipe)
  • 25‐cm2 tissue culture flasks
  • Cell scrapers, sterile
  • 15‐ml conical centrifuge tubes
  • Centrifuge
  • Additional reagents and equipment for cell culture ( appendix 3C) and amplification and purification of phage clones ( protocol 12)

Basic Protocol 3: Selection of Bacteria‐ or Spore‐Binding Phages

  Materials
  • Spores or vegetative bacterial cells (the procedure is adapted to a wide range of bacteria; the authors' laboratory was successful in identifying phage probes for, e.g., S. typhimurium and spores of B. anthracis Sterne)
  • Blocking solution: Tris‐buffered saline (TBS; see recipe) containing 1% (w/v) bovine serum
  • TBS (see recipe) containing 0.5% (v/v) Tween 20
  • Phage library f8/8, 4 × 1012 virions/ml (∼109 clones) in TBS (see recipe) containing 0.1% (w/v) BSA and 0.5% (v/v) Tween 20
  • Elution buffer (see recipe)
  • Tris‐buffered saline (TBS; see recipe)
  • 1 M Tris·Cl, pH 9.1 ( appendix 2E)
  • Lysis buffer (see recipe)
  • Starved E. coli K91BluKan cells ( protocol 9)
  • NZY broth (see recipe) containing 0.2 µg/ml tetracycline (add from 20 mg/ml tetracycline stock in 50% v/v glycerol/H 2O)
  • 20 mg/ml tetracycline in 50% (v/v) glycerol/H 2O (store at –20°C away from light)
  • 35‐mm petri dish or 96‐well EIA/RIA flat bottom, high‐binding plate (Costar)
  • Centrifuge
  • Centricon 100‐kDa centrifugal filter devices (Millipore)
  • 2‐ml tubes, sterile
  • 125‐ml conical flask
  • Rocking shaker (Research Products International)
  • Additional reagents and equipment for purification of phage clones by PEG/NaCl precipitation ( protocol 12) and phage titering ( protocol 10)

Basic Protocol 4: Confirming Specificity of Selected Phages Using Phage‐Capture ELISA

  Materials
  • Freshly grown bacteria or spores
  • Blocking solution: Tris‐buffered saline (TBS; see recipe) containing 0.1% (w/v) BSA
  • TBS (see recipe) containing 0.5% (v/v) Tween 20
  • Candidate phage clones isolated as in protocol 3, 1 × 1012 virions/ml
  • Biotinylated anti‐fd IgG (0.12 µg/ml; prepared according to Barbas et al., , or custom prepared by QED Bioscience Inc., http://www.qedbio.com)
  • 1.25 µg/ml alkaline phosphatase/streptavidin conjugate (Invitrogen) in APSA diluent (see recipe)
  • p‐nitrophenylphosphate solution (see recipe)
  • Costar flat‐bottom EIA/RIA 96‐well high‐binding plate
  • Platform rocker
  • Spectrophotometer with microtiter plate reader

Alternate Protocol 1: Confirming Specificity of Selected Phages Using Coprecipitation Assay

  • Candidate phage clones isolated using protocol 3
  • 20% (v/v) Tween 20
  • Freshly grown bacteria or spores
  • Elution buffer (see recipe)
  • 1 M Tris·Cl, pH 9.1 ( appendix 2E)
  • Costar flat‐bottom EIA/RIA high‐binding 96‐well plate
  • 70°C water bath
  • Centrifuge
  • Additional reagents and equipment for titering phages ( protocol 10)

Basic Protocol 5: Selection of Phage Probes for Discrete Molecular Targets

  Materials
  • 1 to 10 µg/ml purified target in TBS (see recipe for TBS)
  • Blocking solution: Tris‐buffered saline (TBS; see recipe) containing 1% (w/v) bovine serum
  • TBS (see recipe) containing 0.5% (v/v) Tween 20
  • Landscape phage display library f8/8, 4 × 1012 virions/ml (∼109 clones) in TBS (see recipe) containing 0.1% (w/v) BSA and 0.5% (v/v) Tween 20
  • Elution buffer (see recipe)
  • 1 M Tris·Cl, pH 9.1 ( appendix 2E)
  • Starved E. coli K91BluKan cells ( protocol 9)
  • NZY broth (see recipe) containing 0.2 µg/ml tetracycline (add from 20 mg/ml tetracycline stock in 50% v/v glycerol/H 2O)
  • 20 mg/ml tetracycline in 50% (v/v) glycerol/H 2O (store at –20°C away from light)
  • 96‐well EIA/RIA flat bottom, high‐binding plate (Costar)
  • Humidified box: e.g., a plastic container with water‐moistened paper towels on the bottom
  • Centricon 100‐kDa centrifugal filter devices (Millipore)
  • Rocking shaker (Research Products International)
  • Additional reagents and equipment for purification of phage clones by PEG/NaCl precipitation ( protocol 12) and phage titering ( protocol 10), and identification of peptides carried by selected phage clones ( protocol 11)

Basic Protocol 6: Confirmation of Phage Selectivity Towards Their Molecular Targets: Phage‐Capture ELISA

  Materials
  • 1 to 10 µg/ml purified target in TBS (see recipe for TBS)
  • Individual phage clones in TBS, ∼1013 virions/ml
  • Blocking solution: Tris‐buffered saline (TBS; see recipe) containing 1% (w/v) bovine serum
  • TBS (see recipe) containing 0.5% (v/v) Tween 20
  • Primary antibodies: 0.66 µg/ml rabbit anti‐fd phage IgG antibodies (prepared according to Barbas et al., , or custom prepared by QED Bioscience Inc., http://www.qedbio.com), in APSA diluent (see recipe for APSA diluent)
  • Secondary antibodies: 0.24 µg/ml goat anti‐rabbit IgG antibodies conjugated with alkaline phosphatase (Jackson Immunoresearch), in APSA diluent (see recipe for APSA diluent)
  • p‐nitrophenyl phosphate solution (see recipe)
  • 96‐well EIA/RIA flat‐bottom, high‐binding polystyrene plate (Costar)
  • Humidified box: e.g., a plastic container with water moistened paper towels on the bottom
  • Rocking shaker (e.g., Research Products International)
  • ELISA plate washer
  • Spectrophotometer with kinetic microtiter plate reader
  • Graphing software (e.g., MS Excel)

Alternate Protocol 2: Confirmation of Phage Selectivity Towards Their Molecular Targets: Micropanning

  • Elution buffer (see recipe)
  • 1 M Tris·Cl, pH 9.1 ( appendix 2E)
  • Additional reagents and equipment for titering phage ( protocol 10)

Support Protocol 1: Preparation of Starved Cells

  Materials
  • Culture of E. coli K91BluKan (available on request from George Smith, University of Missouri, Columbia; )
  • NZY broth (see recipe) containing 100 µg/ml kanamycin
  • NZY broth (see recipe)
  • 80 mM NaCl, autoclaved
  • NAP buffer (see recipe)
  • 13‐ml snap‐cap tubes (Sarstedt)
  • Shaking incubator
  • 300 ml Nephelo Culture Flask, Triple Baffled with side‐arm (12 × 130 mm; Bellco Biotechnology, Inc.)
  • Spectrophotometer
  • Oak Ridge centrifuge tubes, sterile
  • Refrigerated centrifuge with Beckman JA‐18 rotor (or equivalent)
  • 125‐ml conical flask

Support Protocol 2: Phage Titering

  Materials
  • Tris‐buffered saline (TBS; see recipe)
  • Starved E. coli K91BluKan cells ( protocol 9)
  • NZY broth (see recipe) containing 0.2 µg/ml tetracycline
  • NZY plates containing 20 µg/ml tetracycline (see recipe)
  • Small sterile culture tubes

Support Protocol 3: Identification of Peptides Carried by Selected Phage Clones: PCR Amplification of Phage DNA Segment Encoding Foreign Fusion Peptides

  Materials
  • Phage‐infected bacteria (on titering plate; see protocol 10)
  • 10 pmol/µl sense and antisense primers (Integrated DNA Technologies):
  • f8s‐20: 5′‐CAAAGCCTCCGTAGCCGTTG‐3′ (mol. wt., 6078; GC content, 60%; T m = 59.5°C)
  • f8as‐20: 5′‐CATTCCACAGACAGCCCTCA‐3′ (mol. wt., 5991; GC content, 55%; T m = 58°C)
  • 5 U/µl Taq DNA polymerase and 10× Mg‐free Taq buffer (Promega)
  • 25 mM MgCl 2
  • 2.5 mM deoxynucleoside triphosphates (dNTPs); prepare from 100 mM dATP, dCTP, dGTP, and dTTP stocks
  • DNase‐free H 2O
  • QIAquick PCR Purification Kit (Qiagen)
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 4F)

Support Protocol 4: Propagation and Purification of Phage Clones

  Materials
  • Phage‐infected bacteria (on titering plate; see protocol 10)
  • NZY broth (see recipe) containing 20 µg/ml tetracycline (add from 20 mg/ml tetracycline stock in 50% v/v glycerol/H 2O)
  • PEG/NaCl (see recipe)
  • Tris‐buffered saline (TBS; see recipe), pH 7.5
  • 125‐ml conical flask
  • Shaking incubator
  • Oak Ridge centrifuge tubes
  • Refrigerated centrifuge with Beckman JA‐17 rotor (or equivalent)
  • Spectrophotometer
  • Additional reagents and equipment for phage titering ( protocol 10)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Barbas, C.F. III, Barton, D.R., Scott, J.K., and Silverman, G.J. 2001. Phage Display: A Laboratory Manual,. p. 736. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
   Barry, M.A., Dower, W.J., and Johnston, S.A. 1996. Toward cell‐targeting gene therapy vectors: selection of cell‐binding peptides from random peptide‐presenting phage libraries. Nat Med. 2:299‐305.
   Goodson, R.J., Doyle, M.V., Kaufman, S.E., and Rosenberg, S. 1994. High‐affinity urokinase receptor antagonists identified with bacteriophage peptide display. Proc. Natl. Acad. Sci. U.S.A. 91:7129‐7133.
   Mandava, S., Makowski, L., Devarapalli, S., Uzubell, J., and Rodi, D. 2004. RELIC: A bioinformatics server for combinatorial peptide analysis and identification of protein‐ligand interaction sites. Proteomics 4:1439‐1460.
   Petrenko, V.A. 2007. Landscape phage as a molecular recognition interface for detection devices: Review. Microelectronics J. In press.
   Petrenko, V.A. and Brigati, J.R. 2007. Phage as biospecific probes. In Immunoassay and other Bioanalytical Techniques (J.M. Van Emon, ed.) CRC Press, Boca Raton, Fla.
   Petrenko, V.A. and Smith, G.P. 2005. Vectors and modes of display In Phage Display in Biotechnology and Drug Discovery (S. Sidhu, ed.) pp. 714. CRC Press, Boca Raton, Fla.
   Petrenko, V.A., Smith, G.P., Gong, X., and Quinn, T. 1996. A library of organic landscapes on filamentous phage. Protein Eng. 9:797‐801.
   Samoylova, T.I., Petrenko, V.A., Morrison, N.E., Globa, L.P., Baker, H.J., and Cox, N.R. 2003. Phage probes for malignant glial cells. Mol. Cancer Ther. 2:1129‐1137.
   Zwick, M.B., Menendez, A., Bonnycastle, L.L.C., and J.K. Scott. 2001. Analysis of phage‐borne peptides. In Phage Display: A Laboratory Manual. pp. 18.1‐18.25. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library