Development and Use of IgM/J‐Chain Fusion Proteins for Characterization of Immunoglobulin Superfamily Ligand‐Receptor Interactions

Johannes U. Ammann1, John Trowsdale1

1 Department of Pathology, Division of Immunology, University of Cambridge, Cambridge
Publication Name:  Current Protocols in Protein Science
Unit Number:  Unit 19.24
DOI:  10.1002/0471140864.ps1924s75
Online Posting Date:  February, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Discovery of binding partners for immunoglobulin molecules expressed by cells of the immune system is an important topic of current research. However, many ligand‐receptor interactions are of low affinity, and hence detection is refractory to most established protocols. We evaluated fusion proteins based on human IgM as high avidity probes to screen for ligand‐receptor binding. We describe methods for cloning, expression, and quantification of IgM fusion proteins with J‐chain. Furthermore, we outline protocols to assess binding of IgM fusion proteins to cells and to plate‐bound proteins. Compared to standard IgG‐fusion proteins, IgM + J chain increased binding of a test interaction, PD‐L1 to PD‐1, up to 1000‐fold. Curr. Protoc. Protein Sci. 75:19.24.1‐19.24.11. © 2014 by John Wiley & Sons, Inc.

Keywords: immunoglobulin; ligand‐receptor interaction; fusion proteins; IgM

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Cloning, Expression, and Quantification of IgM Fusion Proteins for Detection of Weak Receptor‐Ligand Interactions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cloning, Expression, and Quantification of IgM Fusion Proteins for Detection of Weak Receptor‐Ligand Interactions

  Materials
  • Human IgM DNA
  • SigpIg+ vector (R&D)
  • Raji cells (ATCC #CCL‐86)
  • Primers:
    • Forward: AACTCGAGCGCCACCATGAAGAACCATTTGCTTTTCTG;
    • Backward: TTGGTACCTTAGTCAGGATAGCAGGCATCT
  • HEK‐293 (ATCC #CRL‐1573) and HEK293‐T cells
  • Tranfection reagent such as PEI
  • Puromycin (e.g., Sigma‐Aldrich)
  • DMEM (e.g., from Sigma‐Aldrich)
  • G418 (e.g., from PAA)
  • PMSF (e.g., from Sigma‐Aldrich)
  • Sodium azide (e.g., from Sigma‐Aldrich)
  • Anti‐human IgMµ‐fragment‐specific antibody (e.g., Sigma‐Aldrich, cat. no. I2386)
  • 1× Phosphate‐buffered saline (PBS; e.g., from PAA)
  • Tween 20 (e.g., from Sigma‐Aldrich)
  • Nonfat milk powder
  • Anti‐human IgM‐HRP‐coupled antibody (e.g., from Sigma‐Aldrich)
  • ABTS HRP substrate solution (e.g., from Sigma‐Aldrich)
  • Mouse CD3+ primary T cells (see Smith et al., )
  • Anti‐CD3 and anti‐CD28 (see Smith et al., )
  • Fetal bovine serum (FBS)
  • Biotinylated anti‐human IgM heavy chain‐specific (e.g., from Jackson Immunoresearch) or biotinylated anti‐human IgG Fc‐specific antibody (e.g., from Jackson Immunoresearch)
  • Streptavidin‐PE (e.g., from Invitrogen)
  • Anti‐rat CD4 antibody (Clone OX‐68)
  • Bovine serum albumin (BSA)
  • Biotinylated detection antibody (e.g., biotinylated anti‐human Fc and biotinylated anti‐human IgM)
  • Reagents for the time‐resolved fluorescence immunoassay system (e.g., DELIFA system from PerkinElmer) as recommended by the manufacturer
  • 25‐cm2 tissue culture flasks
  • EIA/RIA 96‐well plates (e.g., from Costar) for the ELISA assay
  • Centrifuge
  • ELISA plate reader reading at 405 nm
  • 37°C, 5% CO 2 incubator
  • Flow cytometer
  • Nunc Maxisorp 96‐well plates for the time‐resolved fluorescence immunoassay (e.g., from ThermoFisher Scientific)
  • Shaking platform
  • Plate reader able to detect Eu3+‐chelate complexes using a time‐resolved fluorescence protocol such as the Fusion plate reader from PerkinElmer
  • Additional reagents and equipment for standard molecular biology techniques (Ausubel et al., )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ammann, J.U. , Jahnke, M. , Dyson, M.R. , Kaufman, J. , and Trowsdale, J. 2012. Detection of weak receptor‐ligand interactions using IgM and J‐chain‐based fusion proteins. Eur. J. Immunol. 42:1354‐1356.
   Ausubel, F.M. , Brent, R. , Kingston, R.E. , Moore, D.D. , Seidman, J.G. , Smith, J.A. , and Struhl, K. (eds.). 2014. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
   Brown, M.H. 2002. Detection of low‐affinity ligand‐receptor interactions at the cell surface with fluorescent microspheres. Curr. Protoc. Immunol. 48:18.2.1‐18.2.6.
   Butte, M.J. , Peña‐Cruz, V. , Kim, M. , Freeman, G.J. , and Sharpe, A.H. 2008. Interaction of human PD‐L1 and B7‐1. Mol. Immunol. 45:3567‐3572.
   Chapple, S.D.J. , Crofts, A.M. , Shadbolt, S.P. , McCafferty, J. , and Dyson, M.R. 2006. Multiplexed expression and screening for recombinant protein production in mammalian cells. BMC Biotechnol. 6:49.
   Ehrhardt, C. , Schmolke, M. , Matzke, A. , Knoblauch, A. , Will, C. , Wixler, V. , and Ludwig, S. 2006. Polyethylenimine, a cost‐effective transfection reagent. Signal Transduct. 6:179‐184.
   Fazel, S. , Wiersma, E.J. , and Shulman, M.J. 1997. Interplay of J chain and disulfide bonding in assembly of polymeric IgM. Int. Immunol. 9:1149‐1158.
   Iwase, T. , Saito, I. , Takahashi, T. , Chu, L. , Usami, T. , Mestecky, J. , and Moro, I. 1993. Early expression of human J chain and mu chain gene in the fetal liver. Cell Struct. Funct. 18:297‐302.
   Mitoma, J. , Bao, X. , Petryanik, B. , Schaerli, P. , Gauguet, J. , Yu, S. , Kawashima, H. , Saito, H. , Ohtsubo, K. , Marth, J.D. , Khoo, K. , von Andrian, U.H. , Lowe, J.B. , and Fukuda, M. 2007. Critical functions of N‐glycans in L‐selectin‐mediated lymphocyte homing and recruitment. Nat. Immunol. 8:409‐418.
   Niles, M.J. , Matsuuchi, L. , and Koshland, M.E. 1995. Polymer IgM assembly and secretion in lymphoid and nonlymphoid cell lines: Evidence that J chain is required for pentamer IgM synthesis. Proc. Natl. Acad. Sci. U.S.A. 92:2884‐2888.
   Smith, I.A. , Knezevic, B.R. , Ammann, J.U. , Rhodes, D.A. , Aw, D. , Palmer, D.B. , Mather, I.H. , and Trowsdale, J. 2010. BTN1A1, the mammary gland butyrophilin, and BTN2A2 are both inhibitors of T cell activation. J. Immunol. 184:3514‐3525.
   Symersky, J. , Novak, J. , McPherson, D.T. , DeLucas, L. , and Mestecky, J. 2000. Expression of the recombinant human immunoglobulin J chain in Escherichia coli. Mol. Immunol. 37:133‐140.
   van der Merwe, P.A. , and Barclay, A.N. 1994. Transient intercellular adhesion: The importance of weak protein‐protein interactions. Trends Biochem. Sci. 19:354‐358.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library