Overexpression of Membrane Proteins Using Pichia pastoris

Olivier Bornert1, Fatima Alkhalfioui1, Christel Logez1, Renaud Wagner1

1 Institut de Recherche de l'Ecole de Biotechnologie de Strasbourg, University of Strasbourg—CNRS, Illkirch, France
Publication Name:  Current Protocols in Protein Science
Unit Number:  Unit 29.2
DOI:  10.1002/0471140864.ps2902s67
Online Posting Date:  February, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Among the small number of expression systems validated for the mass production of eukaryotic membrane proteins (EMPs), the methylotrophic yeast Pichia pastoris stands as one of the most efficient hosts. This system has been used to produce crystallization‐grade proteins for a variety of EMPs, from which high‐resolution 3D structures have been determined. This unit describes a set of guidelines and instructions to overexpress membrane proteins using the P. pastoris system. Using a G protein–coupled receptor (GPCR) as a model EMP, these protocols illustrate the necessary steps, starting with the design of the DNA sequence to be expressed, through the preparation and analysis of samples containing the corresponding membrane protein of interest. In addition, recommendations are given on a series of experimental parameters that can be optimized to substantially improve the amount and/or the functionality of the expressed EMPs.

Keywords: Pichia pastoris; recombinant expression; membrane proteins; G protein–coupled receptors; membrane preparation; immunodetection; ligand binding

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Designing and Cloning a P. pastoris Expression Vector
  • Basic Protocol 2: Integrative Transformation of P. pastoris and Selection of Recombinant Clones
  • Basic Protocol 3: Culturing Transformed P. pastoris for Membrane Protein Expression
  • Basic Protocol 4: Yeast Cell Lysis and Membrane Preparation
  • Basic Protocol 5: Analysis of Membranes Expressing a GPCR: Immunoblot and Immunodetection
  • Alternate Protocol 1: Analysis of Membranes Expressing a GPCR: Dot‐Blot Immunodetection
  • Basic Protocol 6: Ligand‐Binding Analysis of Membranes Expressing a GPCR
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Designing and Cloning a P. pastoris Expression Vector

  Materials
  • cDNA template containing the full‐length ADRA1A_HUMAN encoding gene (Missouri S&T cDNA Resource Center, cat. no. AR0A1A0001)
  • ADRA1A‐specific forward primer bearing an additional 5′ adapter specifically designed to introduce a BamHI restriction site (5′‐GGATCCATGGTGTTTCTCTCGGGAAATGCTTCCGAC‐3′), and a similar reverse primer, bearing a 5′ adapter introducing SpeI (5′‐ACTAGTGACTTCCTCCCCGTTCTCACTGAGGGAGAT‐3′)
  • High‐fidelity DNA polymerase, e.g., Phusion (Finnzyme), and its specific buffer
  • dNTP mix, 2.5 mM each
  • Sterile water
  • Commercially available loading dye, e.g., 6× DNA loading dye from Fermentas
  • 1% (w/v) agarose gels supplemented with ethidium bromide (0.5 µg/ml)
  • Nucleic acid extraction and purification kit, e.g., NucleoSpin kit (Macherey‐Nagel)
  • Standard restriction enzymes and their related buffers, e.g., BamHI and SpeI and PmeI
  • T4 DNA ligase, e.g., Rapid DNA ligation kit from Fermentas
  • SOC medium (see recipe)
  • E. coli competent cells, e.g., TOP10 chemically competent cells from Invitrogen
  • Liquid and agar plates of LB medium (see recipe) supplemented with 50 µg/ml kanamycin
  • 80% (v/v) glycerol, autoclave‐sterilized
  • Thermal cycler
  • 1.5‐ and 2‐ml microcentrifuge tubes
  • 37°C incubator
  • 37°C shaking incubator
  • Cryotubes
  • −20°C and −80°C freezers
  • Additional reagents and equipment for polymerase chain reaction ( appendix 4J), DNA separation and visualization, UV spectrophotometry, and E. coli culturing (Struhl, ), and agarose gel electrophoresis ( appendix 4F)

Basic Protocol 2: Integrative Transformation of P. pastoris and Selection of Recombinant Clones

  Materials
  • Purified expression vector (from protocol 1)
  • Restriction enzyme PmeI and its specific buffer
  • Sterile water
  • 24:24:1 (v/v/v) chloroform:phenol:isoamyl alcohol
  • Chloroform
  • 100% (v/v) ethanol, ice‐cold
  • 3 M sodium acetate, pH 4.8
  • 70% (v/v) ethanol, ice‐cold
  • 1% (w/v) agarose gel supplemented with ethidium bromide ( appendix 4F)
  • YPD medium (see recipe)
  • A fresh SMD1163 colony streaked on a YPD plate (see recipe for YPD plates)
  • 1 M HEPES, pH 8
  • 1 M dithiothreitol (DTT)
  • Ice‐cold sterile water
  • 1 M sorbitol, ice‐cold
  • MD plates (see recipe)
  • YPD plates supplemented with 0.1 and 0.25 mg/ml geneticin sulfate (G418 sulfate)
  • 37°C incubator
  • Centrifuge
  • Vortex mixer
  • −20°C freezer
  • 30°C shaking incubator
  • Spectrophotometer
  • Sterile 0.2‐cm electroporation cuvettes
  • Electroporation instrument, e.g., Gene Pulser system from BioRad Scraper, sterile
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 4F)
NOTE: All materials and solutions must be sterile.

Basic Protocol 3: Culturing Transformed P. pastoris for Membrane Protein Expression

  Materials
  • BMGY medium (see recipe)
  • Recombinant clones (from protocol 2) freshly streaked on a YPD agar plate
  • BMMY medium (see recipe)
  • Phosphate‐buffered saline (PBS; appendix 2E)
  • 500‐ml baffled‐flasks
  • 30°C shaking incubator
  • Spectrophotometer

Basic Protocol 4: Yeast Cell Lysis and Membrane Preparation

  Materials
  • Yeast cell pellet (from protocol 3)
  • TNE buffer (see recipe)
  • Acid‐washed glass beads (425‐ to 600‐µm diameter; Sigma‐Aldrich)
  • 4 M urea
  • NaOH
  • TN buffer (see recipe)
  • High‐speed benchtop homogenizer (e.g., FastPrep 24 from MP Biomedicals)
  • 26‐ml polycarbonate bottles for ultracentrifuge
  • Ultracentrifuge equipped with an appropriate fixed‐angle rotor
  • Dounce or Potter homogenizer
  • Additional reagents and equipment for the determination of protein concentration (unit 3.4), e.g., BCA assay

Basic Protocol 5: Analysis of Membranes Expressing a GPCR: Immunoblot and Immunodetection

  Materials
  • Membrane preparation samples (from protocol 4)
  • Blocking buffer (see recipe)
  • Monoclonal anti‐FLAG antibody from mouse (Sigma‐Aldrich)
  • Blotting buffer (see recipe)
  • HRP‐conjugated anti‐mouse IgG antibody
  • ECL immunoblotting reagents (e.g., ECL Prime kit from GE Healthcare used in this protocol)
  • Nitrocellulose membrane
  • Orbital shaker
  • Plastic wrap
  • Amersham Hyperfilm ECL
  • Additional reagents and equipment for SDS‐PAGE (unit 10.1) and electrotransfer of proteins (unit 10.7)

Alternate Protocol 1: Analysis of Membranes Expressing a GPCR: Dot‐Blot Immunodetection

  • Phosphate‐buffered saline (PBS; appendix 2E)
  • Membrane preparation samples (from protocol 4)
  • Nitrocellulose membrane
  • Microfiltration‐blotting device (e.g., Bio‐Dot apparatus from Bio‐Rad)

Basic Protocol 6: Ligand‐Binding Analysis of Membranes Expressing a GPCR

  Materials
  • Membrane preparation samples (from protocol 4)
  • Ice‐cold binding buffer (see recipe)
  • Prasozin
  • [3H]‐Prasozin (Perkin Elmer, cat. no. NET823250UC)
  • Filter buffer (see recipe)
  • Ice‐cold wash buffer (see recipe)
  • Scintillation cocktail (e.g., Ultima Gold scintillation fluid from Perkin Elmer)
  • Low‐protein‐binding polyethylene tubes (e.g., MiniSorp tubes from Nunc)
  • Shaking incubator
  • GF/B grade glass‐fiber filters (the format will depend on the filtration apparatus employed)
  • Manifold vacuum filtration apparatus or larger harvester (e.g., 48‐sample semi‐auto harvester from Brandel)
  • Scintillation vials (e.g., 6.5‐ml vials from Symport)
  • Scintillation counter
  • Software (e.g., Prism4 from GraphPad Software or KaleidaGraph from Synergy Software)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Alkhalfioui, F., Logez, C., Bornert, O., and Wagner, R. 2011. Expression systems: Pichia pastoris. In Production of Membrane Proteins—Strategies for Expression and Isolation (A.S. Robinson, ed.) pp. 75‐108. Wiley‐VCH, Weinheim, Germany.
   Aller, S.G. and Unger, V.M. 2006. Projection structure of the human copper transporter CTR1 at 6‐Å resolution reveals a compact trimer with a novel channel‐like architecture. Proc. Natl. Acad. Sci. U.S.A. 103:3627‐3632.
   Aller, S.G., Yu, J., Ward, A., Weng, Y., Chittaboina, S., Zhuo, R., Harrell, P.M., Trinh, Y.T., Zhang, Q., Urbatsch, I.L., and Chang, G. 2009. Structure of P‐glycoprotein reveals a molecular basis for poly‐specific drug binding. Science 323:1718‐1722.
   André, N., Cherouati, N., Prual, C., Steffan, T., Zeder‐Lutz, G., Magnin, T., Pattus, F., Michel, H., Wagner, R., and Reinhart, C. 2006. Enhancing functional production of G protein‐coupled receptors in Pichia pastoris to levels required for structural studies via a single expression screen. Protein Sci. 15:1115‐1126.
   Bernier, V., Lagacé, M., Bichet, D.G., and Bouvier, M. 2004. Pharmacological chaperones: Potential treatment for conformational diseases. Trends Endocrinol. Metab. 15:222‐228.
   Binda, C., Newton‐Vinson, P., Hubalek, F., Edmondson, D.E., and Mattevi, A. 2002. Structure of human monoamine oxidase B, a drug target for the treatment of neurological disorders. Nat. Struct. Biol. 9:22‐26.
   Bylund, D.B. 2007. Characterization of Adrenoceptors. Curr. Protoc. Pharmacol. 36:1.5.1‐1.5.18.
   Cereghino, J.L. and Cregg, J.M. 2000. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol. Rev. 24:45‐66.
   Cereghino, G.P.L., Cereghino, J.L., Ilgen, C., and Cregg, J.M. 2002. Production of recombinant proteins in fermenter cultures of the yeast Pichia pastoris. Curr. Opin. Biotechnol. 13:329‐332.
   Cohen, E., Goldshleger, R., Shainskaya, A., Tal, D.M., Ebel, C., Le Maire, M., and Karlish, S.J.D. 2005. Purification of Na, K‐ATPase expressed in Pichia pastoris reveals an essential role of phospholipid‐protein interactions. J. Biol. Chem. 280:16610‐16618.
   Cos, O., Ramón, R., Montesinos, J.L., and Valero, F. 2006. Operational strategies, monitoring and control of heterologous protein production in the methylotrophic yeast Pichia pastoris under different promoters: A review. Microb. Cell Fact. 5:17.
   Cregg, J.M. and Madden, K.R. 1987. Development of yeast transformation systems and construction of methanol‐utilization‐defective mutants of Pichia pastoris gene disruption. Biol. Res. Yeasts II:1‐18.
   Cregg, J. M., Tolstorukov, I., Kusari, A., Sunga, A. J., Madden, K., and Chappell, T. 2010. Expression of recombinant genes in the yeast Pichia pastoris. Curr. Protoc. Essential Lab. Techn. 4:13.2.1‐13.2.14.
   Eckart, M.R. and Bussineau, C.M. 1996. Quality and authenticity of heterologous proteins synthesized in yeast. Curr. Opin. Biotechnol. 7:525‐530.
   Elion, E. A., Marina, P., and Yu, L. 2007. Constructing recombinant DNA molecules by PCR. Curr. Protoc. Mol. Biol. 78:3.17.1‐3.17.12.
   Fischer, G., Kosinska‐Eriksson, U., Aponte‐Santamaria, C., Palmgren, M., Geijer, C., Hedfalk, K., Hohmann, S., de Groot, B.L., Neutze, R., and Lindkvist‐Petersson, K. 2009. Crystal structure of a yeast aquaporin at 1.15 Å reveals a novel gating mechanism. PLOS Biol. 7:e100130.
   Grinna, L.S. and Tschopp, J.F. 1989. Size distribution and general structural features of N‐linked oligosaccharides from the methylotrophic yeast, Pichia pastoris. Yeast 5:107‐115.
   Grunewald, S., Haase, W., Molsberger, E., Michel, H., and Reilander, H. 2004. Production of the human D2S receptor in the methylotrophic yeast P. pastoris. Receptors Channels 10:37‐50.
   Hamilton, S.R. and Gerngross, T.U. 2007. Glycosylation engineering in yeast: The advent of fully humanized yeast. Curr. Opin. Biotechnol. 18:387‐392.
   Hartner, F.S. and Glieder, A. 2006. Regulation of methanol utilisation pathway genes in yeasts. Microb. Cell Fact. 5:39.
   Haviv, H., Cohen, E., Lifshitz, Y., Tal, D.M., Goldshleger, R., and Karlish, S.J.D. 2007. Stabilization of Na+,K+‐ATPase purified from Pichia pastoris membranes by specific interactions with lipids. Biochemistry 46:12855‐12867.
   Horsefield, R., Nordén, K., Fellert, M., Backmark, A., Tornroth‐Horsefield, S., Terwisscha van Scheltinga, A.C., Kvassman, J., Kjellbom, P., Johanson, U., and Neutze, R. 2008. High‐resolution x‐ray structure of human aquaporin 5. Proc. Natl. Acad. Sci. U.S.A. 105:13327‐13332.
   Li, P., Anumanthan, A., Gao, X.G., Ilangovan, K., Suzara, V.V., Düzgünes, N., and Renugopalakrishnan, V. 2007. Expression of recombinant proteins in Pichia pastoris. Appl. Biochem. Biotechnol. 142:105‐124.
   Lifshitz, Y., Petrovich, E., Haviv, H., Goldshleger, R., Tal, D.M., Garty, H., and Karlish, S.J.D. 2007. Purification of the human α2 isoform of Na, K‐ATPase expressed in Pichia pastoris. Stabilization by lipids and FXYD1. Biochemistry 46:14937‐14950.
   Long, S.B., Campbell, E.B., and MacKinnon, R. 2005. Crystal structure of a mammalian voltage‐dependent Shaker family K+ channel. Science 309:897‐903.
   Long, S.B., Tao, X., Campbell, E.B., and MacKinnon, R. 2007. Atomic structure of a voltage dependent K+ channel in a lipid membrane‐like environment. Nature 450:376‐382.
   Lundstrom, K., Wagner, R., Reinhart, C., Desmyter, A., Cherouati, N., Magnin, T., Zeder‐Lutz, G., Courtot, M., Prual, C., André, N., Hassaine, G., Michel, H., Cambillau, C., and Pattus, F. 2006. Structural genomics on membrane proteins : Comparison of more than 100 GPCRs in 3 expression systems. J. Struct. Funct. Genomics 7:77‐91.
   Martinez Molina, D., Wetterholm, A., Kohl, A., McCarthy, A.A., Niegowski, D., Ohlson, E., Hammarberg, T., Eshaghi, S., Haeggstrom, J.Z., and Nordlund, P. 2007. Structural basis for synthesis of inflammatory mediators by human leukotriene C4 synthase. Nature 448:613‐617.
   Opekarova, M. and Tanner, W. 2003. Specific lipid requirements of membrane protein—a putative bottleneck in heterologous expression. Biochim. Biophys. Acta 1610:11‐22.
   Parcej, D.N. and Eckhardt‐Strelau, L. 2003. Structural characterization of neuronal voltage‐sensitive K+ channels heterologously expressed in Pichia pastoris. J. Mol. Biol. 333:103‐116.
   Reina, C., Padoani, G., Carotti, C., Merico, A., Tripodi, G., Ferrari, P., and Popolo, L. 2007. Expression of the α3/β1 isoform of human Na,K‐ATPase in the methylotrophic yeast Pichia pastoris.FEMS Yeast Res. 7:585‐594.
   Reinhart, C. and Krettler, C. 2006. Expression of membrane proteins in yeasts. In Structural Genomics and Rational Drug Design in Membrane Proteins (K. Lundstrom, ed.) pp. 115‐152. Marcel Dekker, New York.
   Sarramegna, V., Talmont, F., Seree de Roch, M., Milon, A., and Demange, P. 2002. Green fluorescent protein as a reporter of human µ‐opioid receptor overexpression and localization in the methylotrophic yeast Pichia pastoris. J. Biotechnol. 99:23‐39.
   Sarramegna, V., Talmont, F., Demange, P., and Milon, A. 2003. Heterologous expression of G‐protein‐coupled receptors: comparison of expression systems fron the standpoint of large‐scale production and purification. Cell Mol. Life Sci. 60:1529‐1546.
   Shukla, A.K., Haase, W., Reinhart, C., and Michel, H. 2007. Heterologous expression and comparative characterization of the human neuromedin U subtype II receptor using the methylotrophic yeast Pichia pastoris and mammalian cells. Int. J. Biochem. Cell Biol. 39:931‐942.
   Struhl, K. 2000. Subcloning of DNA fragments. Curr. Protoc. Mol. Biol. 13:3.16.1‐3.16.2.
   Tao, X., Avalos, J.L., Chen, J., and MacKinnon, R. 2009. Crystal structure of the eukaryotic strong inward‐rectifier K+ channel Kir2.2 at 3.1 Å resolution. Science 326:1668‐1674.
   Tate, C.G., Haase, J., Baker, C., Boorsma, M., Magnani, F., Vallis, Y., and Williams, D.C. 2003. Comparison of seven different heterologous protein expression systems for the production of the serotonin transporter. Biochim. Biophys. Acta 1160:141‐153.
   Tornroth‐Horsefield, S., Wang, Y., Hedfalk, K., Johanson, U., Karlsson, M., Tajkhorshid, E., Neutze, R., and Kjellbom, P. 2006. Structural mechanism of plant aquaporin gating. Nature 439:688‐694.
   Weiss, H.M., Haase, W., Michel, H., and Reilander, H. 1995. Expression of functional mouse 5‐HT5A serotonin receptor in the methylotrophic yeast Pichia pastoris: Pharmacological characterization and localization. FEBS Lett. 377:451‐456.
   Weiss, H.M., Haase, W., Michel, H., and Reilander, H. 1998. Comparative biochemical and pharmacological characterization of the mouse 5HT5A 5‐hydroxytryptamine receptor and the human β2‐adrenergic receptor produced in the methylotrophic yeast Pichia pastoris. Biochem. J. 330:1137‐1147.
   White, C.E., Hunter, M.J., Meininger, D.P., White, L.R., and Komives, E.A. 1995. Large‐scale expression, purification and characterization of small fragments of thrombomodulin: The roles of the sixth domain and of methionine 388. Protein Eng. 8:1177‐1187.
   Whittaker, M.M. and Whittaker, J.W. 2005. Construction and characterization of Pichia pastoris strains for labeling aromatic amino acids in recombinant proteins. Protein Expr. Purif. 41:266‐274.
   Wood, M.J. and Komives, E.A. 1999. Production of large quantities of isotopically labeled protein in Pichia pastoris by fermentation. J. Biomol. NMR 13:149‐159.
   Yurugi‐Kobayashi, T., Asada, H., Shiroishi, M., Shimamura, T., Funamoto, S., Katsuta, N., Ito, K., Sugawara, T., Tokuda, N., Tsujimoto, H., Murata, T., Nomura, N., Haga, K., Haga, T., Iwata, S., and Kobayashi, T. 2009. Comparison of functional non‐glycosylated GPCRs expression in Pichia pastoris. Biochem. Biophys. Res. Commun. 380:271‐276.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library