Ligand‐Directed Profiling of Organelles with Internalizing Phage Libraries

Andrey S. Dobroff1, Roberto Rangel1, Liliana Guzman‐Roja1, Carolina C. Salmeron2, Juri G. Gelovani3, Richard L. Sidman4, Cristian G. Bologa5, Tudor I. Oprea5, C. Jeffrey Brinker6, Renata Pasqualini7, Wadih Arap7

1 These authors contributed equally to this work, 2 Division of Molecular Medicine, Department of Internal Medicine, University of New Mexico School of Medicine, Albuquerque, New Mexico, 3 Department of Biomedical Engineering, Wayne State University, Detroit, Michigan, 4 Department of Neurology, Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts, 5 Translational Informatics Division, Department of Internal Medicine, University of New Mexico School of Medicine, Albuquerque, New Mexico, 6 Department of Chemical and Nuclear Engineering, The University of New Mexico Cancer Center, Albuquerque, New Mexico, 7 These authors contributed equally as senior authors to this work
Publication Name:  Current Protocols in Protein Science
Unit Number:  Unit 30.4
DOI:  10.1002/0471140864.ps3004s79
Online Posting Date:  February, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Phage display is a resourceful tool to, in an unbiased manner, discover and characterize functional protein‐protein interactions, create vaccines, and engineer peptides, antibodies, and other proteins as targeted diagnostic and/or therapeutic agents. Recently, our group has developed a new class of internalizing phage (iPhage) for ligand‐directed targeting of organelles and to identify molecular pathways within live cells. This unique technology is suitable for applications ranging from fundamental cell biology to drug development. This unit describes the methods for generating and screening the iPhage display system, and explains how to select and validate candidate internalizing homing peptide. © 2015 by John Wiley & Sons, Inc.

Keywords: intracellular targeting; intracellular receptors; mammalian cells; organelles; penetratin; phage display; proteomics; peptides

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of iPHAGE Library
  • Basic Protocol 2: Screening, Selection, and Receptor Validation of Candidate iPHAGE Clones
  • Reagents and Solutions
  • Commentary
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of iPHAGE Library

  Materials
  • Electrocompetent DH5α competent cells (Life Technologies)
  • Super Optimal Broth with Catabolite repression (SOC; see recipe)
  • Luria‐Bertani (LB) medium and agar plates (see recipe)
  • Tetracycline stock (see recipe)
  • Qiagen Plasmid Maxi Kit
  • 10 mM Tris·Cl, pH 8.0 ( appendix 2E)
  • Cesium chloride (CsCl, Fisher Scientific)
  • 10 mg/ml ethidium bromide (EtBr) solution (BioRad; also see appendix 2E)
  • Isoamyl alcohol (Fisher Scientific)
  • 3 M sodium acetate (Sigma; also see appendix 2E)
  • 100% and 70% ethanol (Fisher Scientific)
  • Oligonucleotides encoding the penetratin peptide:
    • Penetratin Forward 5′‐CACAAGCTTTGCCAACGTCCCTCGACAGATAAAGATTTGGTTCCAAAACGGCGCATGAAGTGGAAGAAGCCTGCAGCACA‐3′
    • Penetratin Reverse 5′‐ TGTGCTGCAGGCTTCTTCCACTTCATGCGCCGGTTTTGGAACCAAATCTTTATCTGTCGAGGGACGTTGGCAAAGCTTGTG‐3′
  • 10 U/μl HindIII endonuclease (Fermentas)
  • 10 U/μl U PstI endonuclease (10U/μl, Fermentas)
  • f88/4 and fUSE5 phage plasmids (available upon request from the University of Missouri; (http://www.biosci.missouri.edu/smithgp/PhageDisplayWebsite/PhageDisplayWebsiteIndex.html)
  • QIAquick Gel Extraction Kit (Qiagen)
  • 0.8% and 2% agarose gels (Voytas, )
  • Quanti‐Marker 1 Kb (Bioexpress)
  • 1 U/μl T4 DNA ligase (Life Technologies) and 5× ligation buffer
  • QIAprep Spin Miniprep Kit (Qiagen)
  • f88/4 forward sequencing primer: 5′‐GCTCCTTTCGCTTTCTTCCCTTCC‐3′
  • f88/4 reverse sequencing primer: 5′‐TCAGGGGAGTAAACAGGAGACAAG‐3′
  • 10 U/μl XbaI endonuclease (Fermentas)
  • 10 U/μl BamHI endonuclease (Fermentas)
  • 30% (v/v) glycerol in LB liquid medium (see recipe for LB)
  • MC1061 E. coli competent cells (the MC1061 E. coli strain can be obtained from Dr. George Smith of the University of Missouri)
  • Liquid N 2
  • Streptomycin stock (see recipe)
  • SOB medium (see recipe)
  • 10% and 50% (v/v) glycerol
  • High‐copy plasmid DNA (e.g., pUC19)
  • 10 U/μl SfiI endonuclease (Fermentas)
  • Insert library template (see text above step 40, under “Prepare the insert”)
  • Library sense primer 5′‐CACTCGGCCGACG‐3′
  • Library antisense primer 5′‐TTCGGCCCCAGCGGC‐3′
  • Dimethylsulfoxide (DMSO, Sigma)
  • 10 mM dNTPs (Life Technologies)
  • GoTaq DNA polymerase (5 U/μl; Promega; includes 5× buffer and 25 mM MgCl 2 solution)
  • QIAquick Nucleotide Removal Kit (Qiagen)
  • 10 U/μl BglI endonuclease (Fermentas)
  • PEG‐NaCl solution (see recipe)
  • Phosphate‐buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, cat. no. BP2438‐20)
  • K91/kan E. coli (can be obtained from Dr. George Smith at the University of Missouri)
  • Kanamycin stock (see recipe)
  • 0.5‐ml microcentrifuge tubes
  • 0.1‐cm electroporation cuvette (0.1‐cm gap; BioRad)
  • Gene Pulser II Electroporation System (BioRad)
  • 37°C shaking bacterial incubator
  • 2‐liter Erlenmeyer flasks
  • Refrigerated centrifuge
  • UV/vis spectrophotometer
  • Ultracentrifuge tubes (Thermo Fisher Scientific, cat. no. 03905)
  • Analytical balance
  • Ultracentrifuge
  • 18‐G needles
  • Handheld UV lamp (Fisher Scientific, cat. no. 95000602)
  • 18‐G needle (Thermo Fisher Scientific)
  • 1‐ml syringe (Thermo Fisher Scientific)
  • 50‐ml screw‐cap polypropylene tubes (e.g., BD Falcon)
  • 100°, 50°, 22°C, and 16°C water baths
  • Ultraviolet transilluminator
  • Thermal cycler
  • ECM 630 High Throughput Electroporation System (BTX Harvard Apparatus; optional)
  • HT 100 Plate Handler (BTX Harvard Apparatus; optional)
  • 96‐well high‐throughput electroporation plates (Multi‐well Electroporation Plate; BTX Harvard Apparatus, cat. no. 450450)
  • 2‐liter baffled Fernbach flasks (Sigma‐Aldrich, cat. no. CLS44462L)
  • 400‐ and 500‐ml centrifuge bottles
  • Additional reagents and equipment for electroporation (unit 5.10; Chen et al., ), polyacrylamide gel electrophoresis (PAGE) of nucleic acids (Andrus and Kuimelis, ), and DNA sequencing (Ausubel et al., , Chapter 7)

Basic Protocol 2: Screening, Selection, and Receptor Validation of Candidate iPHAGE Clones

  Materials
  • Kaposi Sarcoma 1767 cell line
  • Complete MEM medium (see recipe)
  • iPhage library ( protocol 1)
  • Phosphate‐buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific, cat. no. BP2438‐20)
  • 0.05 % Trypsin‐EDTA (1×, Life Technologies)
  • Hypotonic buffer (see recipe)
  • 2.5× mitochondrial stabilization (MS) buffer (see recipe)
  • K91/kan E. coli (can be obtained from Dr. George Smith at the University of Missouri)
  • Terrific broth (TB, see recipe)
  • Kanamycin stock (see recipe)
  • Luria‐Bertani (LB) medium and agar plates (see recipe)
  • Tetracycline stock (see recipe)
  • 1 M Isopropyl β‐D‐1‐thiogalactopyranoside (IPTG) stock (Sigma)
  • PEG‐NaCl solution (see recipe)
  • 30% (v/v) glycerol in LB medium (30% glycerol‐LB)
  • pIIIseq Forward: 5′‐AGCAAGCTGATAAACCGATACAATT‐3′ (desalted)
  • pIIIseq Reverse: 5′‐CCCTCATAGTTAGCGTAACGATCT‐3′ (desalted)
  • 10 mM dNTPs (Life Technologies)
  • GoTaq DNA polymerase (5 U/μl; Promega; includes 5× buffer and 25 mM MgCl 2 solution)
  • Dimethylsulfoxide (DMSO)
  • 4% agarose gel (Voytas, )
  • Cell proliferation kit (MTT or WST‐1 assays, Roche)
  • 2 mM EDTA in PBS
  • Minimal essential medium (MEM), plain
  • Protein extraction buffer (see recipe)
  • CarboxyLink Immobilization Kit (Thermo Scientific)
  • Synthetic peptides used for elution (5 mM in column buffer; purchased from Polypeptide Labs or CPC Scientific; selection of which peptide to use depends on the iPhage screening)
  • Column buffer (see recipe)
  • Elution buffer (column buffer with 5 mM peptide)
  • Glycine buffer (see recipe)
  • 0.05% sodium azide‐PBS (see recipe)
  • 50 mM octylglucoside in PBS
  • BCA protein assay kit (Thermo Scientific)
  • 0.1%, 1%, and 2% bovine serum albumin (BSA) in PBS
  • 4× NuPAGE LDS sample buffer (Life Technologies) containing 10% (v/v) 2‐mercaptoethanol
  • Novex 4‐20% Tris‐glycine gel (Life Technologies)
  • Coomassie blue stain (SimplyBlue SafeStain, Life Technologies; also see unit 10.5; Echan and Speicher, )
  • Desired antibody (polyclonal or monoclonal) for immunocapture, and isotype control
  • 75‐ and 175‐cm2 tissue culture flasks (BD Biosciences)
  • 0.22‐ and 0.45‐μm syringe filters (Millipore)
  • 15‐ and 50‐ml conical centrifuge tubes (e.g., BD Falcon)
  • Refrigerated centrifuge and tabletop centrifuge
  • Dounce homogenizer (Fisher Scientific) with loose‐ and tight‐fitting pestles
  • 2‐ml microcentrifuge tubes
  • UV/vis spectrophotometer
  • 96‐well U‐bottom plates (BD Biosciences)
  • 96‐well PCR plates (Eppendorf)
  • Thermal cycler
  • 96‐well microplates, flat bottom (BD Biosciences)
  • Phase‐contrast microscope
  • 175‐cm2 tissue culture flasks
  • Rocking platform
  • 3‐kDa Slide‐A‐Lyzer cassettes (Pierce)
  • 3‐kDa spin column concentrators (Thermo Scientific)Stainless‐steel scalpel blade (Fisher Scientific)
  • Protein A‐coated 96‐well plates (Thermo Scientific)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and staining of gels (unit 10.5; Echan and Speicher, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Andrus, A. and Kuimelis, R. G. 2000. Polyacrylamide gel electrophoresis (PAGE) of synthetic nucleic acids. Curr. Protoc. Nucl. Acid Chem. 1:10.4.1‐10.4.10.
  Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.). 2014. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
  Arap, W., Pasqualini, R., and Ruoslahti, E. 1998. Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 279:377‐380.
  Arap, W., Haedicke, W., Bernasconi, M., Kain, R., Rajotte, D., Krajewski, S., Ellerby, H.M., Bredesen, D.E., Pasqualini, R., and Ruoslahti, E. 2002. Targeting the prostate for destruction through a vascular address. Proc. Natl. Acad. Sci. U.S.A. 99:1527‐1531.
  Ashley, C.E., Carnes, E.C., Phillips, G.K., Padilla, D., Durfee, P.N., Brown, P.A., Hanna, T.N., Liu, J., Phillips, B., Carter, M.B., Carroll, N.J., Jiang, X., Dunphy, D.R., Willman, C.L., Petsev, D.N., Evans, D.G., Parikh, A.N., Chackerian, B., Wharton, W., Peabody, D.S., and Brinker, C.J. 2011. The targeted delivery of multicomponent cargos to cancer cells by nanoporous particle‐supported lipid bilayers. Nat. Mater. 10:389‐397.
  Ashley, C.E., Carnes, E.C., Epler, K.E., Padilla, D.P., Phillips, G.K., Castillo, R.E., Wilkinson, D.C., Wilkinson, B.S., Burgard, C.A., Kalinich, R.M., Townson, J.L., Chackerian, B., Willman, C.L., Peabody, D.S., Wharton, W., Brinker, C.J. 2012. Delivery of small interfering RNA by peptide‐targeted mesoporous silica nanoparticle‐supported lipid bilayers. ACS Nano 6:2174‐2188.
  Ballard, V.L., Holm, J.M., and Edelberg, J.M. 2006. Quantitative PCR‐based approach for rapid phage display analysis: A foundation for high throughput vascular proteomic profiling. Physiol. Genomics 26:202‐208.
  Barnhart, K.F., Christianson, D.R., Hanley, P.W., Driessen, W.H., Bernacky, B.J., Baze, W.B., Wen, S., Tian, M., Ma, J., Kolonin, M.G., Saha, P.K., Do, K.A., Hulvat, J.F., Gelovani, J.G., Chan, L., Arap, W., and Pasqualini, R. 2011. A peptidomimetic targeting white fat causes weight loss and improved insulin resistance in obese monkeys. Sci. Transl. Med. 3:108ra112.
  Bratkovic, T. 2010. Progress in phage display: Evolution of the technique and its applications. Cell. Mol. Life Sci. 67:749‐767.
  Cardó‐Vila, M., Zurita, A.J., Giordano, R.J., Sun, J., Rangel, R., Guzman‐Rojas, L., Anobom, C.D., Valente, A.P., Almeida, F.C., Lahdenranta, J., Kolonin, M.G., Arap, W., and Pasqualini, R. 2008. A ligand peptide motif selected from a cancer patient is a receptor‐interacting site within human interleukin‐11. PLoS One 3:e3452.
  Chen, S., Gray, D., Ma, J., and Subramanian, S. 1998. Production of recombinant proteins in mammalian cells. Curr. Protoc. Protein Sci. 12:5.10.1‐5.10.41.
  Davis, M.E., Chen, Z., Shin, D.M. 2008. Nanoparticle therapeutics: An emerging treatment modality for cancer. Nat. Rev. Drug. Discov. 7:771‐782.
  Delehanty, J.B., Boeneman, K., Bradburne, C.E., Robertson, K., Bongard, J.E., and Medintz, I.L. 2010. Peptides for specific intracellular delivery and targeting of nanoparticles: Implications for developing nanoparticle‐mediated drug delivery. Therapeut. Deliv. 1:411‐433.
  Dias‐Neto, E., Nunes, D.N., Giordano, R.J., Sun, J., Botz, G.H., Yang, K., Setubal, J.C., Pasqualini, R., and Arap, W. 2009. Next‐generation phage display: Integrating and comparing available molecular tools to enable cost‐effective high‐throughput analysis. PLoS One 4:e8338.
  Duchrow, T., Shtatland, T., Guettler, D., Pivovarov, M., Kramer, S., and Weissleder, R. 2009. Enhancing navigation in biomedical databases by community voting and database‐driven text classification. BMC Bioinform. 10:317.
  Echan, L.A. and Speicher, D.W. 2002. Protein detection in gels using fixation. Curr. Protoc. Protein Sci. 29:10.5.1‐10.5.18.
  Epler, K., Padilla, D., Phillips, G., Crowder, P., Castillo, R., Wilkinson, D., Wilkinson, B., Burgard, C., Kalinich, R., Townson, J., Chackerian, B., Willman, C., Peabody, D., Wharton, W., Brinker, C. J., Ashley, C., and Carnes, E. 2012. Targeted delivery of protein toxins: Delivery of ricin toxin A‐chain by peptide‐targeted mesoporous silica nanoparticle‐supported lipid bilayers. Adv. Healthcare Mater. 1:241‐241.
  Giordano, R.J., Cardó‐Vila, M., Lahdenranta, J., Pasqualini, R., and Arap, W. 2001. Biopanning and rapid analysis of selective interactive ligands. Nat. Med. 7:1249‐1253.
  Giordano, R.J., Lahdenranta, J., Zhen, L., Chukwueke, U., Petrache, I., Langley, R.R., Fidler, I.J., Pasqualini, R., Tuder, R.M., and Arap W. 2008. Targeted induction of lung endothelial cell apoptosis causes emphysema‐like changes in the mouse. J. Biol. Chem. 283:29447‐29460.
  Giordano, R.J., Cardó‐Vila, M., Salameh, A., Anobom, C.D., Zeitlin, B.D., Hawke, D.H., Valente, A.P., Almeida, F.C., Nör, J.E., Sidman, R.L., Pasqualini, R., and Arap, W. 2010. From combinatorial peptide selection to drug prototype (I): Targeting the vascular endothelial growth factor receptor pathway. Proc. Natl. Acad. Sci. U.S.A. 107:5112‐5117.
  Hajitou, A., Trepel, M., Lilley, C.E., Soghomonyan, S., Alauddin, M.M., Marini, F.C. III, Restel, B.H., Ozawa, M.G., Moya, C.A., Rangel, R., Sun, Y., Zaoui, K., Schmidt, M., von Kalle, C., Weitzman, M.D., Gelovani, J.G., Pasqualini, R., and Arap, W. 2006. A hybrid vector for ligand‐directed tumor targeting and molecular imaging. Cell 125:5825‐5832.
  Hajitou, A., Rangel, R., Trepel, M., Soghomonyan, S., Gelovani, J.G., Alauddin, M.M., Pasqualini, R., and Arap, W. 2007. Design and construction of targeted AAVP vectors for mammalian cell transduction. Nat. Protoc. 2:523‐531.
  Hardy, B., Battler, A., Weiss, C., Kudasi, O., and Raiter, A. 2008. Therapeutic angiogenesis of mouse hind limb ischemia by novel peptide activating GRP78 receptor on endothelial cells. Biochem. Pharmacol. 75:891‐899.
  Higgins, L.M., Lambkin, I., Donnelly, G., Byrne, D., Wilson, C., Dee, J., Smith, M., and O'Mahony, D.J. 2004. In vivo phage display to identify M cell‐targeting ligands. Pharm. Res. 21:695‐705.
  Kolonin, M.G., Saha, P.K., Chan, L., Pasqualini, R., and Arap, W. 2004. Reversal of obesity by targeted ablation of adipose tissue. Nat. Med. 10:625‐632.
  Kolonin, M.G., Sun, J., Do, K.A., Vidal, C.I., Ji, Y., Baggerly, K.A., Pasqualini, R., and Arap, W. 2006a. Synchronous selection of homing peptides for multiple tissues by in vivo phage display. FASEB J. 20:979‐981.
  Kolonin, M.G., Bover, L., Sun, J., Zurita, A.J., Do, K.A., Lahdenranta, J., Cardó‐Vila, M., Giordano, R.J., Jaalouk, D.E., Ozawa, M.G., Moya, C.A., Souza, G.R., Staquicini, F.I., Kunyiasu, A., Scudiero, D.A., Holbeck, S.L., Sausville, E.A., Arap, W., and Pasqualini, R. 2006b. Ligand‐directed surface profiling of human cancer cells with combinatorial peptide libraries. Cancer Res. 66:34‐40.
  Laakkonen, P., Porkka, K., Hoffman, J.A., and Ruoslahti, E. 2002. A tumor‐homing peptide with a targeting specificity related to lymphatic vessels. Nat. Med. 8:751‐755.
  Mathias S.L., Hines‐Kay J., Yang J.J., Zahoransky‐Kohalmi G., Bologa C.G., Ursu O., and Oprea T.I. 2013. The CARLSBAD database: A confederated database of chemical bioactivities. Database bat044.
  Mintz, P.J., Kim, J., Do, K.A., Wang, X., Zinner, R.G., Cristofanilli, M., Arap, M.A., Hong, W.K., Troncoso, P., Logothetis, C.J., Pasqualini, R., and Arap, W. 2003. Fingerprinting the circulating repertoire of antibodies from cancer patients. Nat. Biotechnol. 21:57‐63.
  Mintz, P.J., Cardo‐Vila, M., Ozawa, M.G., Hajitou, A., Rangel, R., Guzman‐Rojas, L., Christianson, D.R., Arap, M.A., Giordano, R.J., Souza, G.R., Easley, J., Salameh, A., Oliviero, S., Brentani, R.R., Koivunen, E., Arap, W., and Pasqualini, R. 2009. An unrecognized intracellular adapter protein released from the cytoplasm into the tumor microenvironment. Proc. Natl. Acad. Sci. U.S.A. 106:2182‐2187.
  Molek, P., Strukelj, B. and Bratkovic, T. 2011. Peptide phage display as a tool for drug discovery: Targeting membrane receptors. Molecules 16:857‐887.
  Pasqualini, R. and Ruoslahti, E. 1996. Organ targeting in vivo using phage display peptide libraries. Nature 380:364‐366.
  Pasqualini, R., Koivunen, E., Kain, R., Lahdenranta, J., Sakamoto, M., Stryhn, A., Ashum, R.A., Shapiro, L.H., Arap, W., and Ruoslahti, E. 2000. Aminopeptidase N is a receptor for tumor‐homing peptides and a target for inhibiting angiogenesis. Cancer Res. 60:722‐727.
  Paulo, C.S.O., Neves, R.P.D., and Ferreira, L.S. 2011. Nanoparticles for intracellular‐targeted drug delivery. Nanotechnology 22:494002.
  Rangel, R., Guzman‐Rojas, L., le Roux, L.G., Staquicini, F.I., Hosoya, H., Barbu, E.M., Ozawa, M.G., Nie, J., K.D., Langley, R.R., Sage, E.H., Koivunen, E., Gelovani, J.G., Lobb, R.R., Sidman, R.L., Pasqualini, R., and Arap, W. 2012. Combinatorial targeting and discovery of ligand‐receptors in organelles of mammalian cells. Nat. Commun. 3:788.
  Sambrook J.J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual, Vol. 1, 3rd ed. pp. 1.65‐1.68. Cold Spring Harbor Press, cold Spring Harbor, New York.
  Smith, G.P. 1985. Filamentous fusion phage: Novel expression vectors that display cloned antigens on the virion surface. Science 228:1315‐1317.
  Smith, G.P. and Scott, J.K. 1993. Libraries of peptides and proteins displayed on filamentous phage. Methods Enzymol. 217:228‐257.
  Smith, G.P. and Petrenko, V.A. 1997. Phage display. Chem. Rev. 97:391‐410.
  Staquicini, F.I., Cardó‐Vila, M., Kolonin, M.G., Trepel, M., Edwards, J.K., Nunes, D.N., Sergeeva, A., Efstathiou, E., Sun, J., Almeida, N.F., Tu, S.M., Botz, G.H., Wallace, M.J., O'Connell, D.J., Krajewski, S., Gershenwald, J.E., Molldrem, J.J., Flamm, A.L., Koivunen, E., Pentz, R.D., Dias‐Neto, E., Setubal, J.C., Cahill, D.J., Troncoso, P., Do, K.A., Logothetis, C.J., Sidman, R.L., Pasqualini, R., and Arap, W. 2011. Vascular ligand‐receptor mapping by direct combinatorial selection in cancer patients. Proc. Natl. Acad. Sci. U.S.A. 108:18637‐18642.
  Thie, H., Meyer, T., Schirrmann, T., Hust, M., and Dübel, S. 2008. Display derived therapeutic antibodies. Curr Pharm. Biotechnol. 9:439‐446.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Zhang, L., Giraudo, E., Hoffman, J.A., Hanahan, D., and Ruoslahti, E. 2006. Lymphatic zip codes in premalignant lesions and tumors. Cancer Res. 66:5696‐5706.
  Zhang, G., Annan, R.S., Carr, S.A. and Neubert, T.A. 2010. Overview of peptide and protein analysis by mass spectrometry. Curr. Protoc. Protein Sci. 62:16.1:16.1.1‐16.1.30.
Key References
  Rangel et al., 2012. See above.
  First paper to describe and validate the iPhage technology.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library