Derivation and Characterization of Nonhuman Primate Embryonic Stem Cells

Christopher S. Navara1, Carrie Redinger1, Jocelyn Mich‐Basso1, Stacie Oliver1, Ahmi Ben‐Yehudah1, Carlos Castro1, Calvin Simerly1

1 University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 1A.1
DOI:  10.1002/9780470151808.sc01a01s1
Online Posting Date:  June, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Embryonic stem (ES) cells are a powerful research tool enabling the generation of mice with custom genetics, the study of the earliest stages of mammalian differentiation in vitro and, with the isolation of human ES cells, the potential of cell‐based therapies for a number of diseases including Parkinson's and Type 1 diabetes. ES cells isolated from nonhuman primates (nhpES cells) offer the opportunity to ethically test the developmental potential of primate ES cells in chimeric offspring. If these cells have similar potency to mouse ES cells, this may open a new era of primate models of human disease. Nonhuman primates are the perfect model system for the preclinical testing of ES cell–derived therapies. In this unit, we describe methods for the derivation and characterization of nonhuman primate ES cells. With these protocols, the investigator will be able to isolate nhpES cells and perform the necessary tests to confirm the pluripotent phenotype. Curr. Protoc. Stem Cell Biol. 1:1A.1.1‐1A.1.21. © 2007 by John Wiley & Sons, Inc.

Keywords: nonhuman primate; embryonic stem cells; Oct‐4; Nanog; Karyotype; Teratoma

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Deriving Nonhuman Primate Embryonic Stem Cells
  • Support Protocol 1: Immunocytochemistry of nhpES Cells
  • Support Protocol 2: Detection of Oct‐4, Nanog, Sox‐2, and Rex‐1 by RT‐PCR
  • Support Protocol 3: Karyotyping of Nonhuman Primate ES Cell Cultures
  • Support Protocol 4: Teratoma Formation in NOD‐SCID Mice
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Deriving Nonhuman Primate Embryonic Stem Cells

  Materials
  • 0.1% (w/v) gelatin in DPBS (Invitrogen, cat. no. 14190‐144)
  • Inactivated mouse embryonic fibroblasts (MEFs; Specialty Media, http://www.specialtymedia.com; also available from ATCC, cat. no. SCRC‐1040.2)
  • MEF medium (see recipe)
  • nhpES cell medium (see recipe)
  • Expanded non‐human primate blastocysts (Hewitson, )
  • Acidified Tyrode's medium (Chemicon)
  • TALP‐HEPES medium (see recipe)
  • Anti‐monkey serum produced in rabbit (Sigma, cat. no. M‐0278)
  • Mineral or silicon oil, embryo quality (Cooper Medical)
  • Guinea pig complement, lyophilized (Biomeda; store at –20°C until use)
  • Embryo‐quality H 2O (Sigma)
  • Fetal bovine serum (FBS; Invitrogen, cat. no. 16000‐044)
  • Dimethylsulfoxide (DMSO)
  • Liquid nitrogen
  • 6‐well tissue culture plate
  • Hamilton syringe with 20‐µl Unopette tip (Becton Dickinson) attached
  • 37°C slide warmer
  • 30‐mm organ culture dish (Fisher)
  • Dissecting microscope
  • 60‐mm non–tissue culture–treated petri dishes
  • Stripping pipet: “Stripper” pipetting instrument (Fig. ) and 125‐µm inner diameter plastic tips (MidAtlantic Diagnostics, http://www.midatlanticdiagnostics.com; cat. no. MXL3‐125)
  • Fine glass needle for passaging ES cells: pull a Pasteur pipet as thinly as possible while heating over Bunsen burner, such that a pair of needles with pointed sealed ends (mandatory) are produced, and bend according to preference for optimal access to the wells; alternatively, use commercially available stem cell knives (Swemed cat. no. 25111‐109M; http://www.swemed.com)
  • Cell scrapers
  • 15‐ml conical centrifuge tubes
  • 1‐ml cryovials
  • Mr. Frosty freezing containers (Fisher)

Support Protocol 1: Immunocytochemistry of nhpES Cells

  Materials
  • 0.1% (w/v) gelatin in DPBS
  • Inactivated mouse embryonic fibroblasts (MEFs; Specialty Media, http://www.specialtymedia.com; also available from ATCC, cat. no. SCRC‐1040.2)
  • MEF medium (see recipe)
  • Rhesus ES cells growing in culture (see protocol 1)
  • Dulbecco's phosphate‐buffered saline (DPBS, Ca2+‐ and Mg2+‐free; Invitrogen, cat. no. 14190‐144), prewarmed
  • DPBS containing 2% (v/v) formaldehyde
  • DPBS containing 0.1% (v/v) Triton X‐100
  • DPBS containing 0.3% (w/v) nonfat dry milk and 5% (v/v) normal goat serum
  • Primary antibodies against desired ES markers (perform all dilutions in DPBS containing 0.1% v/v Triton X‐100):
    • Mouse Oct‐4 [Santa Cruz Biotechnology (sc‐5276); use at 1:100 dilution]
    • Goat Nanog (R&D Systems; use at 1:20 dilution)
    • Mouse SSEA‐4 (Developmental Studies Hybridoma Bank; use at 1:5 dilution)
    • Mouse TRA‐1‐81 (Santa Cruz Biotechnology; use at 1:5 dilution)
    • Mouse TRA‐1‐60 (Santa Cruz Biotechnology; use at 1:5 dilution)
  • Secondary antibody against IgG of species in which primary antibody was raised, labeled with Alexa Fluor 488; use at 100:1 dilution in DPBS containing 0.1% Triton X‐100
  • 10 mg/ml RNase in DPBS containing 0.1% Triton X‐100
  • 5 µM TOTO‐3 (Invitrogen) in DPBS containing 0.1% Triton X‐100
  • Vectashield mounting medium (Vector)
  • Thermanox plastic coverslips (Ted Pella, Inc.)
  • 6‐well tissue culture plate
  • Humidified chamber (e.g., Tupperware box containing moistened paper towels)
  • Microscope slides

Support Protocol 2: Detection of Oct‐4, Nanog, Sox‐2, and Rex‐1 by RT‐PCR

  Materials
  • One 70% confluent well of a 6‐well plate of nhpES cells ( protocol 1)
  • TRIzol Reagent (Invitrogen)
  • Chloroform (minimum 99%; Sigma)
  • Isopropanol
  • 75% ethanol in nuclease‐free water
  • Nuclease‐free water (ISC Bioexpress; http://www.bioexpress.com)
  • DNA‐free Kit (Ambion) containing:
    • 10× DNase I buffer
    • recombinant DNase I (rDNase I)
    • DNase Inactivation Reagent
  • Reverse Transcription System (Promega) containing:
    • 25 mM MgCl 2
    • 5× reverse transcription buffer
    • 10 mM dNTP mixture
    • Recombinant RNasin ribonuclease inhibitor
    • Reverse transcriptase
    • Oligo(dT) primer
  • Biolase PCR Kit (Bioline) containing:
    • Biolase Taq DNA Polymerase
    • 10× NH 4 Buffer
    • 50 mM MgCl 2 Solution
    • 2× PolyMate Additive
  • 10 mM dNTP mix (Roche Applied Science)
  • PCR primers for rhesus EC markers:
    • Oct‐4:
    • forward: 5′‐CGACCATCTGCCGCTTTGAG‐3′
    • reverse: 5′‐CCCCCTGTCCCCCATTCCTA‐3′
    • Nanog:
    • forward: 5′‐CTGTGATTTGTGGGCCTGAA‐3′
    • reverse: 5′‐TGTTTGCCTTTGGGACTGGT‐3′
    • Rex‐1:
    • forward: 5′‐GCGTACGCAAATTAAAGTCCAGA‐3′
    • reverse: 5′‐CAGCATCCTAAACAGCTCGCAGAAT‐3′
    • Sox2:
    • forward: 5′‐CCCCCGGCGGCAATAGCA‐3′
    • reverse: 5′‐TCGGCGCCGGGGAGATACAT‐3′
  • Cell scrapers
  • 15‐ml conical tubes
  • Refrigerated centrifuge
  • Automatic pipettors and filtered pipet tips designated for RNA work (RNase‐free; Molecular BioProducts; http://www.mbpinc.com/html/index.html
  • 0.6‐ml microcentrifuge tubes, sterile and RNase free (Molecular BioProducts; http://www.mbpinc.com/html/index.html)
  • 0.2‐ml PCR reaction tubes (ISC Bioexpress, http://www.bioexpress.com)
  • Thermal cycler (e.g., PTC‐200 Peltier Thermal Cycler; MJ Research)
  • Additional reagents and equipment for isolating ES cells ( protocol 1), nucleic acid quantitation (Gallagher and Desjardins, ) and agarose gel electrophoresis (Voytas, )
NOTE: Use nuclease‐free water to prepare all reagents. All tubes and pipets must be RNase‐free. Always wear gloves while handling samples. Do not leave tubes open any longer than absolutely necessary. Before each use, wipe gloves and pipets with RNase Away (Molecular BioProducts; http://www.mbpinc.com/html/index.html).

Support Protocol 3: Karyotyping of Nonhuman Primate ES Cell Cultures

  Materials
  • nhpES cells cultures in log‐phase growth in 6‐well plates ( protocol 1)
  • Dulbecco's phosphate‐buffered saline (DPBS, Ca2+‐ and Mg2+‐free; Invitrogen, cat. no. 14190‐144)
  • TrypLE cell dissociation enzyme (Invitrogen)
  • nhpES cell medium (see recipe)
  • 1 µg/ml ethidium bromide working solution (see recipe)
  • 10 µg/ml KaryoMAX Colcemid solution (Invitrogen)
  • Hypotonic solution: 0.075 M KCl, 37°C
  • Fixative: 1:3 (v/v) acetic acid/methanol
  • 0.025% trypsin in DPBS (prepare from 0.5% trypsin stock, see recipe)
  • 2% (v/v) fetal bovine serum (Invitrogen, cat. no. 16000‐044) in DPBS
  • Giemsa stain solution: KaryoMAX Giemsa Stain (Invitrogen) diluted to 6% in Gurr's buffer, pH 6.8 (see below)
  • Gurr's buffer, pH 6.8: dissolve one Gurr's buffer tablet in 1 liter distilled H 2O
  • 15‐ml conical centrifuge tubes
  • Inverted microscope
  • Fine glass needle for dissecting ESC colonies: pull a Pasteur pipet as thinly as possible while heating over Bunsen burner, such that a pair of needles with pointed sealed ends (mandatory) are produced, and bend according to preference for optimal access to the wells; alternatively, use commercially available stem cell knives (Swemed cat. no. 25111‐109M; http://www.swemed.com)
  • Centrifuge
  • Glass microscope slides
  • Beaker of hot water for adjusting humidity/temperature conditions
  • Slide warmer
  • Coplin jars
  • Cytovision Workstation and Genus software (Applied Imaging) or bright‐field microscope with green interference filter and digital camera, with digital image processing software (e.g., Adobe Photoshop)

Support Protocol 4: Teratoma Formation in NOD‐SCID Mice

  Materials
  • 5–50 × 105 exponentially growing, high‐quality ES cells; typically three wells of a 6‐well plate (see protocol 1; if possible, use cells that have been recently karyotyped; see protocol 4)
  • Normal saline (0.9% w/v NaCl), sterile
  • Immunocompromised mice (e.g., NOD‐SCID; The Jackson Laboratory), 7 weeks old
  • Anesthetic solution: 20 mg/ml ketamine/0.5 mg/ml acepromazine in normal saline
  • 10% (v/v) formalin (formaldehyde concentration, 3.7% v/v) in DPBS (Invitrogen, cat. no. 14190‐144)
  • 70%, 90%, 95%, and 100% ethanol
  • Paraffin wax
  • Hematoxylin
  • Eosin
  • Acid rinse: combine 500 ml distilled H 2O and 1 ml glacial acetic acid
  • Ammonia rinse: combine 480 ml distilled H 2O and 1 ml ammonium hydroxide
  • 1‐ml syringe and 25‐G needle
  • Scalpels and scissors
  • Peloris tissue processor (Vision BioSystems, http://www.vision‐bio.com/; optional)
  • Embedding blocks
  • Microtome
  • Microscope slides
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   American College of Medical Genetics (ACMG). 1999. Standards and Guidelines for Clinical Genetics Laboratories. 2nd ed. ACMG, Rockville, Md.
   Bayani, J. and Squire, J.A. 2004. Preparation of cytogenetic specimens from tissue samples. Curr. Protoc. Cell. Biol. 23:22.2.1‐22.2.15.
   Calhoun, J.D., Lambert, N.A., Mitalipova, M.M., Noggle, S.A., Lyons, I., Condie, B.G., and Stice, S.L. 2003. Differentiation of rhesus embryonic stem cells to neural progenitors and neurons. Biochem. Biophys. Res. Commun. 306:191‐197.
   Cibelli, J.B., Grant, K.A., Chapman, K.B., Cunniff, K., Worst, T., Green, H.L., Walker, S.J., Gutin, P.H., Vilner, L., Tabar, V., Dominko, T., Kane, J., Wettstein, P.J., Lanza, R.P., Studer, L., Vrana, K.E., and West, M.D. 2002. Parthenogenetic stem cells in nonhuman primates. Science 295:819.
   Gallagher, S.R. and Desjardins, P.R. 2006. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 76:A.3D.1‐A.3D.21.
   Haruta, M., Sasai, Y., Kawasaki, H., Amemiya, K., Ooto, S., Kitada, M., Suemori, H., Nakatsuji, N., Ide, C., Honda, Y., and Takahashi, M. 2004. In vitro and in vivo characterization of pigment epithelial cells differentiated from primate embryonic stem cells. Invest. Ophthalmol. Vis. Sci. 45:1020‐1025.
   Hewitson, L. 2004. Primate models for assisted reproductive technologies. Reproduction 128:293‐299.
   Kuo, H.C., Pau, K.Y., Yeoman, R.R., Mitalipov, S.M., Okano, H., and Wolf, D.P. 2003. Differentiation of monkey embryonic stem cells into neural lineages. Biol. Reprod. 68:1727‐1735.
   Levenstein, M.E., Ludwig, T.E., Xu, R.H., Llanas, R.A., VanDenHeuvel‐Kramer, K., Manning, D., and Thomson, J.A. 2006. Basic fibroblast growth factor support of human embryonic stem cell self‐renewal. Stem Cells 24:568‐574.
   Li, T., Zheng, J., Xie, Y., Wang, S., Zhang, X., Li, J., Jin, L., Ma, Y., Wolf, D.P., Zhou, Q., and Ji, W. 2005. Transplantable neural progenitor populations derived from rhesus monkey embryonic stem cells. Stem Cells 23:1295‐1303.
   Maatman, R., Gertsenstein, M., de Meijer, E., Nagy, A., and Vintersten, K. 2003. Aggregation of embryos and embryonic stem cells. Methods Mol. Biol. 209:201‐230.
   Mitalipov, S., Kuo, H.C., Byrne, J., Clepper, L., Meisner, L., Johnson, J., Zeier, R., and Wolf, D. 2006. Isolation and characterization of novel rhesus monkey embryonic stem cell lines. Stem Cells 24:2177‐2186.
   Nakayama, T., Momoki‐Soga, T., and Inoue, N. 2003. Astrocyte‐derived factors instruct differentiation of embryonic stem cells into neurons. Neurosci. Res. 46:241‐249.
   Navara, C.S., Mich‐Basso, J., Redinger, C., Ben‐Yehudah, A., and Schatten, G. 2007. Pedigreed non‐human primates embryonic stem cells display family and sex related differences in gene expression. Submitted for publication.
   Pearson, P.L., Roderick, T.M., Davisson, M.T., Garver, J.J., Warburton, D., Lalley, P.A., and O'Brien, S.J. 1979. Report of the committee on comparative mapping. Cytogenet. Cell Genet. 25:82‐95.
   Rosai, J (ed.). 2004. Rosai and Ackerman's Surgical Pathology. 9th ed. Elsevier, New York.
   Sanchez‐Pernaute, R., Studer, L., Ferrari, D., Perrier, A., Lee, H., Vinuela, A., and Isacson, O. 2005. Long‐term survival of dopamine neurons derived from parthenogenetic primate embryonic stem cells (cyno‐1) after transplantation. Stem Cells 23:914‐922.
   Sasaki, E., Hanazawa, K., Kurita, R., Akatsuka, A., Yoshizaki, T., Ishii, H., Tanioka, Y., Ohnishi, Y., Suemizu, H., Sugawara, A., Tamaoki, N., Izawa, K., Nakazaki, Y., Hamada, H., Suemori, H., Asano, S., Nakatsuji, N., Okano, H., and Tani, K. 2005. Establishment of novel embryonic stem cell lines derived from the common marmoset (Callithrix jacchus). Stem Cells 23:1304‐1313.
   Schatten, G., Smith, J., Navara, C., Park, J.H., and Pedersen, R. 2005. Culture of human embryonic stem cells. Nat. Methods. 2:455‐463.
   Suemori, H., Tada, T., Torii, R., Hosoi, Y., Kobayashi, K., Imahie, H., Kondo, Y., Iritani, A., and Nakatsuji, N. 2001. Establishment of embryonic stem cell lines from cynomolgus monkey blastocysts produced by IVF or ICSI. Dev. Dyn. 222:273‐279.
   Takada, T., Suzuki, Y., Kondo, Y., Kadota, N., Kobayashi, K., Nito, S., Kimura, H., and Torii, R. 2002. Monkey embryonic stem cell lines expressing green fluorescent protein. Cell Transplant 11:631‐635.
   Takagi, Y., Takahashi, J., Saiki, H., Morizane, A., Hayashi, T., Kishi, Y., Fukuda, H., Okamoto, Y., Koyanagi, M., Ideguchi, M., Hayashi, H., Imazato, T., Kawasaki, H., Suemori, H., Omachi, S., Iida, H., Itoh, N., Nakatsuji, N., Sasai, Y., and Hashimoto, N. 2005. Dopaminergic neurons generated from monkey embryonic stem cells function in a Parkinson primate model. J. Clin. Invest. 115:102‐109.
   Thomson, J.A., Kalishman, J., Golos, T.G., Durning, M., Harris, C.P., Becker, R.A., and Hearn, J.P. 1995. Isolation of a primate embryonic stem cell line. Proc. Natl. Acad. Sci. U.S.A. 92:7844‐7848.
   Thomson, J.A., Kalishman, J., Golos, T.G., Durning, T.G., Harris, C.P., and Hearn, J.P. 1996. Pluripotent cell lines derived from common marmoset (Callithrix jacchus) blastocysts. Biol. Reprod. 55:254‐259.
   Thomson, J.A., Itskovitz‐Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145‐1147.
   Umeda, K., Heike, T., Yoshimoto, M., Shiota, M., Suemori, H., Luo, H.Y., Chui, D.H., Torii, R., Shibuya, M., Nakatsuji, N., and Nakahata, T. 2004. Development of primitive and definitive hematopoiesis from nonhuman primate embryonic stem cells in vitro. Development 131:1869‐1879.
   Umeda, K., Heike, T., Yoshimoto, M., Shinoda, G., Shiota, M., Suemori, H., Luo, H.Y., Chui, D.H., Torii, R., Shibuya, M., Nakatsuji, N., and Nakahata, T. 2006. Identification and characterization of hemoangiogenic progenitors during cynomolgus monkey embryonic stem cell differentiation. Stem Cells 24:1348‐1358.
   Vallier, L., Alexander, M., and Pedersen, R.A. 2005. Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells. J. Cell. Sci. 118:4495‐4509.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Vrana, K.E., Hipp, J.D., Goss, A.M., McCool, B.A., Riddle, D.R., Walker, S.J., Wettstein, P.J., Studer, L.P., Tabar, V., Cunniff, K., Chapman, K., Vilner, L., West, M.D., Grant, K.A., and Cibelli, J.B. 2003. Nonhuman primate parthenogenetic stem cells. Proc. Natl. Acad. Sci. U.S.A. 100:11911‐11916.
   Xu, R.H., Peck, R.M., Li, D.S., Feng, X., Ludwig, T., and Thomson, J.A. 2005. Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells. Nat. Methods. 2:185‐190.
   Zhang, X., Stojkovic, P., Przyborski, S., Cooke, M., Armstrong, L., Lako, M., and Stojkovic, M. 2006. Derivation of human embryonic stem cells from developing and arrested embryos. Stem Cells 24:2669‐2676.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library