Reprogramming Primordial Germ Cells (PGC) to Embryonic Germ (EG) Cells

Gabriela Durcova‐Hills1, Azim Surani1

1 The Wellcome Trust/Cancer Research UK Gurdon Institute of Cancer and Developmental Biology, Cambridge, United Kingdom
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 1A.3
DOI:  10.1002/9780470151808.sc01a03s5
Online Posting Date:  April, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

In this unit we describe the derivation of pluripotent embryonic germ (EG) cells from mouse primordial germ cells (PGCs) isolated from both 8.5‐ and 11.5‐days post‐coitum (dpc) embryos. Once EG cells are derived we explain how to propagate and characterize the cell lines. We introduce readers to PGCs and explain differences between PGCs and their in vitro derivatives EG cells. Finally, we also compare mouse EG cells with ES cells. This unit will be of great interest to anyone interested in PGCs or studying the behavior of cultured PGCs or the derivation of new EG cell lines. Curr. Protoc. Stem Cell Biol. 5:1A.3.1‐1A.3.20. © 2008 by John Wiley & Sons, Inc.

Keywords: primordial germ cells; embryonic germ cells; mouse; reprogramming; pluripotency

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Deriving, Culturing, and Freezing Mouse Embryonic Germ Cells
  • Support Protocol 1: Purification of 11.5 dpc PGCs from Surrounding Somatic Cells by Applying Magnetic Beads
  • Support Protocol 2: Preparation of Mitotically Inactivated Sl4‐m220 Feeder Cells
  • Support Protocol 3: Sexing of EG Cell Lines or Embryos by PCR
  • Support Protocol 4: Nontissue Specific Alkaline Phosphatase (AP) Staining
  • Support Protocol 5: Immunofluorescence Staining for SSEA‐1 or Oct‐3/4
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Deriving, Culturing, and Freezing Mouse Embryonic Germ Cells

  Materials
  • 8.5 or 11.5 dpc pregnant MF1 female crossed with 129 male
  • Dissecting medium [make 1% FBS in CMF‐PBS (Invitrogen, pH 7.2, 1×, CaCl 2‐ and MgCl 2‐free, cat. no. 20012)], sterile
  • 0.05% Trypsin/EDTA (Invitrogen, cat. no. 25300)
  • PGC growth medium (see recipe), sterile
  • 4‐well plates with Sl4‐m220 cells, mitotically inactivated (see protocol 3)
  • Mouse embryonic fibroblast (MEF) medium (see recipe)
  • Ca2+/Mg2+‐free phosphate‐buffered saline (CMF‐PBS; Invitrogen), sterile
  • EG cell growth medium (see recipe), sterile
  • 35‐mm tissue culture dishes seeded with mitotically inactive MEFs (unit 1.3)
  • DMEM
  • Freezing solution (see recipe), sterile
  • Liquid nitrogen
  • 10‐cm culture dishes for dissection of fetuses and PGCs‐containing tissues
  • Forceps with sharp tips (sterile) for isolation of tissues containing PGCs
  • Dissecting stereomicroscope and inverted microscope
  • 1.0‐ml and 100‐µl micropipettor tips, sterile
  • 1.5‐ml microcentrifuge tubes for collecting tissues, sterile
  • 5‐cm tissue culture dish
  • 37°C water bath
  • 4‐well culture plates to culture PGCs or expand EG cells
  • Pulled‐glass mouth pipet
  • 15‐ml tubes, sterile
  • Cryotubes
  • −80°C freezer
  • Additional reagents and equipment for euthanasia of the mouse (Donovan and Brown, )

Support Protocol 1: Purification of 11.5 dpc PGCs from Surrounding Somatic Cells by Applying Magnetic Beads

  • Cell sorting medium (see recipe), cold
  • SSEA‐1 antibody (Developmental Studies Hybridoma Bank, The University of Iowa, or Abcam)
  • AP staining solution (see protocol 5)
  • MiniMACS Starting Kit (Miltenyi Biotec) containing:
  • 1 MiniMACS Separating Unit
  • 1 MACS MultiStand
  • 25 MS Columns
  • 1 ml unit of MACS MicroBeads (rat‐anti mouse IgM)
  • Plate shaker in a cold room
  • Additional reagents and solutions for counting cells using a hemacytometer (Phelan, )

Support Protocol 2: Preparation of Mitotically Inactivated Sl4‐m220 Feeder Cells

  Materials
  • Sl4‐m220 cells, frozen
  • Sl4‐m220 growth medium (see recipe), sterile
  • Mitomycin C solution (see recipe), sterile
  • Ca2+/Mg2+‐free phosphate‐buffered saline (CMF‐PBS; Invitrogen), sterile
  • 0.05% Trypsin/EDTA
  • PGC growth medium (see recipe)
  • 10‐cm petri dishes, gelatinized (see recipe)
  • 1‐ml micropipettor tip attached to a pipettor
  • 15‐ml tubes
  • 4‐well culture dishes, gelatinized (see recipe)
  • Additional reagents and equipment for counting cells (unit 1.3)

Support Protocol 3: Sexing of EG Cell Lines or Embryos by PCR

  Materials
  • 10‐cm dish of EG cells without feeder cells
  • PCR reagents including:
    • 10 mM dNTP solution (10 mM each dNTP)
    • 10× PCR buffer (containing 50 mM MgCl 2; Qiagen, cat. no. 201203)
    • 5 U/µl Taq DNA polymerase
    • Autoclaved distilled water
  • Primers:
    • Ube1XA: TGGTCTGGACCCAAACGCTGTCCACA
    • Ube1XB: GGCAGCAGCCATCACATAATCCAGATG
  • Template genomic DNA
  • DNA size ladder: 1‐kb DNA ladder (Invitrogen)
  • 2‐µl thin‐walled PCR tubes
  • Thermal cycler (e.g., PTC‐100, MJ Research)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Support Protocol 4: Nontissue Specific Alkaline Phosphatase (AP) Staining

  Materials
  • PGC from day 8.5 dpc embryos or EG cells grown on feeders
  • PGC growth medium (see recipe)
  • EG cell growth medium (see recipe)
  • CMF‐PBS
  • AP staining solution (see recipe)
  • 4‐well culture dish
  • Microscope

Support Protocol 5: Immunofluorescence Staining for SSEA‐1 or Oct‐3/4

  Materials
  • CMF‐PBS
  • 4% (w/v) fixative solution (see recipe)
  • PBS‐TX solution (see recipe)
  • SSEA 1 antibody (mouse, 1:1; Developmental Studies Hybridoma Bank, http://dshb.biology.uiowa.edu)
  • Anti‐Oct 3/4 (mouse, 1:250) from BD Transduction Laboratories
  • Anti‐mouse IgM‐Alexa (red, 1:500; Molecular Probes) for SSEA‐1
  • Anti‐mouse IgG‐Alexa (red, 1:500; Molecular Probes) for OCT‐3/4
  • TOTO‐3 solution (see recipe)
  • Mounting medium for fluorescence (Vectashield; Vector)
  • Lab‐tek chambers (Nunc) for staining of cultured EG cells or PGCs or for freshly prepared cell suspensions use multiwell microscope glass slides (C.A. Hendley, cat. no. PH‐136) precoated with poly‐L‐lysine to enhance the adherence of cells
  • Humidified dark chamber
  • Coverslips
  • Fluorescence microscope
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ancelin, K., Lange, U.C., Hajkova, P., Schneider, R., Bannister, A.J., Kouzarides, T., and Surani, M.A. 2006. Blimp1 associates with Prmt5 and directs histone arginine methylation in mouse germ cells. Nat. Cell Biol. 6: 623‐630.
   Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell‐Badge, R. 2003. Multipotent cell lineages in early mouse development depend on Sox2 function. Genes Dev. 17: 126‐140.
   Chiquoine, A.D. 1954. The identification, origin, and migration of the primordial germ cells in the mouse embryo. Anat. Rec. 118: 135‐146.
   Chuma, S. and Nakatsuji, N. 2001. Autonomous transition into meiosis of mouse fetal germ cells in vitro and its inhibition by gp130‐mediated signaling. Dev. Biol. 229: 468‐479.
   Donovan, J. and Brown, P. 2006. Euthanasia. Curr. Protoc. Immunol. 73: 1.8.1‐1.8.4.
   Donovan, P.J. and de Miguel, M.P. 2003. Turning germ cells into stem cells. Curr. Opin. Genet. Dev. 13: 463‐471.
   Durcova‐Hills, G., Ainscough, J. F.‐X., and McLaren, A. 2001. Pluripotent stem cells derived from migrating primordial germ cells. Differentiation 68: 220‐226.
   Durcova‐Hills, G., Wianny, F., Merriman, J., Zernicka‐Goetz, M., and McLaren, A. 2003. Developmental fate of embryonic germ cells (EGCs), in vivo and in vitro. Differentiation 71: 135‐141.
   Durcova‐Hills, G., Adams, I.R., Barton, S.C., Surani, M.A. and McLaren A. 2006. The role of exogenous FGF‐2 on the reprogramming of primordial germ cells into pluripotent stem cells. Stem Cells 24: 1441‐1449.
   Hajkova, P., Erhardt, S., Lane, N., Haaf, T., Reik, W., Walter, J., and Surani, M.A. 2002. Epigenetic reprogramming in primordial germ cells. Mech. Dev. 117: 15‐23.
   Huang, B., Xie, T.‐S., Shi, D.‐S., Li, T., Wang, X.‐L., Mo, Y., Wang, Z.‐Q., and Li, M.‐M. 2007. Isolation and characterization of EG‐like cells from Chinese swamp buffalo (Bubalus bubalis). Cell Biol. Inter. 31: 1079‐1088.
   Jia, W., Yang, W., Lei, A., Gao, Z., Yang, C., Hua, J., Huang, W., Ma, X., Wang, H., and Dou, Z. 2008. A caprine chimera produced by injection of embryonic germ cells into blastocyst. Theriogeneology 69: 340‐348.
   Kanatsu‐Shinohara, M., Inoue, K., Lee, J., Yoshimoto, M., Ogonuki, N., Miki, H., Baba, S., Kato, T., Kazuki, K., Toyokuni, S., Toyoshima, M., Niwa, O., Oshimura, M., Heike, T., Nakahata, T., Ishino, F., Ogura, A., and Shinohara, T. 2004. Generation of pluripotent stem cells from neonatal mouse testis. Cell 119: 1001‐1012.
   Kimura, T., Suzuki, A., Fujita, Y., Yomogida, K., Lomeli, H., Asada, N., Ikeuchi, M., Nagy, A., Mak, T.W., and Nakano, T. 2003. Conditional loss of PTEN leads to testicular teratoma and enhances embryonic germ cell production. Development 130: 1691‐1700.
   Kuhholzer, B., Baguisi, A., and Overstrom, E.M. 2000. Long‐term culture and characterization of goat primordial germ cells. Theriogeneology 53: 1071‐1079.
   Labosky, P. A., Barlow, D.P., and Hogan, B.L.M. 1994. Mouse embryonic germ (EG) cell lines: Transmission through the germline and differences in the methylation imprint of insulin‐like growth factor 2 receptor (Igf2r) gene compared with embryonic stem (ES) cell lines. Development 120: 3197‐3204.
   Matsui, Y., Zsebo, K., and Hogan, B.L.M. 1992. Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 70: 841‐847.
   Muller, A.J., Teresky, A.K., and Levine, A.J. 2000. A male germ cell tumor‐susceptibility‐determining locus, pgct1, identified on murine chromosome 13. Proc. Natl. Acad. Sci U.S.A. 97: 8421‐8426.
   Ohinata, Y., Payer, B., O'Carroll, D., Ancelin, K., Ono, Y., Sano, M., Barton, S.C., Obukhanych, T., Nussenzweig, M., Tarakhovsky, A., Saitou, M., and Surani, M.A. 2005. Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 439: 207‐213.
   Park, T.S. and Han, J.Y. 2000. Derivation and characterization of pluripotent embryonic germ cells in chicken. Mol. Reprod. Dev. 56: 475‐482.
   Park, T.S., Hong, Y.H., Kwon, S.C., Lim, J.M., and Han, J.Y. 2003. Birth of germline chimeras by transfer of chicken embryonic germ (EG) cells into recipient embryos. Mol. Reprod. Dev. 65: 389‐395.
   Pesce, M. and De Felici, M. 1995. Purification of mouse primordial germ cells by MiniMACS magnetic separation system. Dev. Biol. 170: 722‐725.
   Phelan, M.C. 2006. Techniques for mammalian cell tissue culture. Curr. Protoc. Mol. Biol. 74: A.3F.1‐A.3F.18.
   Piedrahita, J.A., Moore, K., Oetama, B., Lee, C‐k., Scales, N., Ramsoondar, J., Bazer, F.W., and Ott, T. 1998. Generation of transgenic porcine chimeras using primordial germ cell‐derived colonies. Biol. Reprod. 58: 1321‐1329.
   Resnick, J.L., Bixler, L.S., Cheng, L., and Donovan, P.J. 1992. Long‐term proliferation of mouse primordial germ cells in culture. Nature 359: 550‐551.
   Rui, R., Shim, H., Moyer, A.L., Anderson, D.L., Penedo, C.T., Rowe, J.D., BonDurant, R.H., and Anderson, G.B. 2004. Attempts to enhance production of porcine chimeras from embryonic germ cells and preimplantation embryos. Theriogeneology 61: 1225‐1235.
   Sambrook, J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
   Shamblott, M.J., Axelman, J., Wang, S., Bugg, E.M., Littlefield, J.W., Donovan, P.J., Blumenthal, P.D., Huggins, G.R., and Gearhart, J.D. 1998. Derivation of pluripotent stem cells from cultured human primordial germ cells. Proc. Natl. Acad. Sci. U.S.A. 95: 13726‐13731.
   Schöler, H. R., Dressler, G. R., Balling, R., Rohdewohld, H., and Gruss, P. 1990. A germline specific transcription factor mapping to the mouse t‐complex. EMBO J. 9: 2185‐2195.
   Shim, H., Gutierrez‐Adan, A., Chen, L‐R., BonDurant, R.H., Behboodi, E., and Anderson, G.B. 1997. Isolation of pluripotent stem cells from cultured porcine primordial germ cells. Biol. Reprod. 57: 1089‐1095.
   Shovlin, T.C., Durcova‐Hills, G., Surani, A., and McLaren, A. 2008. Heterogeneity in imprinted methylation patterns of pluripotent embryonic germ cells derived from pre‐migratory mouse germ cells. Dev. Biol. 313: 674‐81.
   Seki, Y., Yamaji, M., Yabuta, Y., Sano, M., Shigeta, M., Matsui, Y., Saga, Y., Tachibana, M., Shinkai, Y., and Saitou, M. 2007. Cellular dynamics associated with the genome‐wide epigenetic reprogramming in migrating primordial germ cells in mice. Development 134: 2627‐2638.
   Stewart, C.L., Gadi, I., and Bhatt, H. 1994. Stem cells from primordial germ cells can reenter the germ line. Dev. Biol. 161: 626‐628.
   Tada, M., Tada, T., Lefebvre, L., Barton, S.C., and Surani, M.A. 1997. Embryonic germ cells induce epigenetic reprogramming of somatic nucleus in hybrid cells. EMBO J. 16: 6510‐6520.
   Tada, T., Tada, M., Hilton, K., Barton, S. C., Sado, T., Takagi, N., and Surani, M. A. 1998. Epigenotype switching of imprintable loci in embryonic germ cells. Dev. Genes Evol. 207: 551‐561.
   Tada, M., Morizane, A., Kimura, H., Kawasaki, H., Ainscough, J.F., Sasai, Y., Nakatsuji, N., and Tada, T. 2003. Pluripotency of reprogrammed somatic genomes in embryonic stem hybrid cells. Dev. Dyn. 227: 504‐510.
   Tsung, H.C., Du, Z.W., Rui, R., Li, X.L., Bao, L.P., Wu, J., Bao, S.M., and Yao, Z. 2003. The culture and establishment of embryonic germ (EG) cell lines from Chinese mini swine. Cell Research 13: 195‐202.
   Turnpenny, L., Brickwood, S., Spalluto, C.M., Piper, K., Cameron, I.T., Wilson, D.I., and Hanley, N.A. 2003. Derivation of human embryonic germ cells: An alternative source of pluripotent stem cells. Stem Cells 21: 598‐609.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51: 2.5A.1‐2.5A.9.
   Yamaguchi, S., Kimura, H., Tada, M., Nakatsuji, N., and Tada, T. 2005. Nanog expression in mouse germ cell development. Gene Express. Patterns 5: 639‐646.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library