Phenotypic Analysis of Human Embryonic Stem Cells

Mark Ungrin1, Michael O'Connor2, Connie Eaves3, Peter W. Zandstra1

1 IBBME, University of Toronto, Toronto, Canada, 2 StemCell Technologies, Inc, Vancouver, British Columbia, 3 Terry Fox Laboratory, BC Cancer Agency, Vancouver, British Columbia
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 1B.3
DOI:  10.1002/9780470151808.sc01b03s2
Online Posting Date:  August, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Human embryonic stem cells (hESCs) are an important tool for the study of developmental biology and may one day serve as a source of cells for regenerative medicine. As no definitive assay for hESC pluripotency is available, surrogate assays that measure markers or properties that have been correlated with hESC developmental potential are used to measure the effects of test conditions on their propagation and differentiation. This unit presents a range of protocols, including visual inspection, flow cytometry, immunofluorescence, quantitative real‐time reverse‐transcriptase PCR, and a colony‐forming assay, as tools to measure the undifferentiated hESC state. The authors discuss the advantages and limitations of the various protocols, and present expected results and discuss potential problems. The development of quantitative assays of hESC developmental potential are critical for our understanding of hESC biology. Curr. Protoc. Stem Cell Biol. 2:1B.3.1‐1B.3.25. © 2007 by John Wiley & Sons, Inc.

Keywords: hESC; marker; Oct4; SSEA‐3; SSEA‐4; Tra‐1‐60; microscopy; flow cytometry; quantitative real‐time PCR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Visual Observation of hESC Cultures
  • Basic Protocol 2: Flow Cytometric Measurement of hESC Surface Antigens
  • Alternate Protocol 1: Determining Oct4 Intracellular Expression by Flow Cytometry
  • Support Protocol 1: Preparation of a Single‐Cell Suspension of Viable hESCs
  • Basic Protocol 3: Immunofluorescent Staining of Fixed hESCs on Coverslips
  • Alternate Protocol 2: Immunofluorescence Staining for High‐Content Screening
  • Basic Protocol 4: Quantitative Real‐Time Polymerase Chain Reaction (Q‐RT‐PCR)
  • Basic Protocol 5: hESC Colony Forming Cell Assay
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Visual Observation of hESC Cultures

  Materials
  • Single‐cell suspensions of hESCs ( protocol 4)
  • Hank's buffered saline solution with 2% (v/v) FBS (HF)
  • Appropriate primary and secondary antibodies
  • 7‐aminoactinomycin‐D (7‐AAD), optional
  • DNase, optional
  • 15‐ml microcentrifuge tubes
  • 40‐µm cell strainer
  • Flow cytometer sample tubes (e.g., BD Falcon 352058)
  • Flow cytometer
  • Additional reagents and equipment for preparing a single‐cell suspension of hESCs ( protocol 4)

Basic Protocol 2: Flow Cytometric Measurement of hESC Surface Antigens

  Materials
  • Single‐cell suspension of hESCs ( protocol 4)
  • Hank's buffered‐saline solution with 2% (v/v) FBS (HF)
  • IntraPrep Permeabilization Kit (Beckman Coulter) containing:
    • Reagent 1
    • Reagent 2
  • Primary antibody: Mouse anti–mouse Oct3/4 antibody (IgG1 isotype; BD Biosciences, cat. no. 611202; http://www.bdbiosciences.com)
  • Secondary antibody: Goat anti–mouse IgG (Fc specific)‐FITC conjugate (Sigma‐Aldrich, cat. no. F‐2772; http://www.sigmaaldrich.com/)
  • DNase, optional
  • 1.5‐ml microcentrifuge tubes (DiaMed Lab Supplies, no. SPE150‐N)
  • Vortex
  • 40‐µm cell strainer
  • FC sample tubes (e.g., BD Falcon 352058)
  • Flow cytometer
  • Additional reagents and equipment for preparing a single‐cell suspension of hESCs ( protocol 4)

Alternate Protocol 1: Determining Oct4 Intracellular Expression by Flow Cytometry

  Materials
  • Cultures of hESCs in 6‐well plates (grown to ∼80% or as desired for a specific experiment)
  • TrypLE Express (Invitrogen, no. 12604‐013)
  • PBS (Invitrogen)
  • 37°C incubator
  • 15‐ml conical centrifuge tube
  • Hemacytometer
  • Additional reagents and equipment for counting cells (Phelan, )

Support Protocol 1: Preparation of a Single‐Cell Suspension of Viable hESCs

  Materials
  • Poly‐lysine (L or D), optional
  • Phosphate‐buffered saline (PBS; Invitrogen)
  • Desired substrate (e.g., Matrigel, mouse embryo fibroblasts)
  • hESCs
  • 3.7% (w/v) formaldehyde in PBS
  • Methanol (chilled to −20°C)
  • Appropriate primary and fluorescently labeled secondary antibodies
  • 3% (w/v) BSA in PBS
  • Mounting medium/antifade
  • Cosmetic nail polish
  • Coverslips
  • Glass petri dish
  • Filter paper
  • Beakers
  • Microscope slides

Basic Protocol 3: Immunofluorescent Staining of Fixed hESCs on Coverslips

  Materials
  • hESCs
  • 3.7% (w/v) formaldehyde in PBS
  • Phosphate‐buffered saline (PBS; Invitrogen)
  • Methanol (chilled to −20°C)
  • 10% (v/v) FBS in PBS
  • Appropriate primary and secondary antibodies Hoechst 33342 (Sigma‐Aldrich, cat. no. B2261), frozen stock at 1 mg/ml
  • Multi‐well tissue culture plates designed for use in microscopy (Perkin Elmer, Packard View Plate, cat. no. 6005182; Fisher Scientific, Corning 96‐well, cat. no. 07‐200‐729)
  • Multichannel pipet
  • Disposable reagent reservoirs
  • Sterile trough
  • 200‐µl pipet
  • Aluminum foil
  • Cellomics ArrayScan VTI (Cellomics, http://www.cellomics.com, or equivalent automated microscopy platform); see also CellProfiler, a freely available open‐source automated image analysis package, http://www.cellprofiler.org/ (Carpenter et al., )

Alternate Protocol 2: Immunofluorescence Staining for High‐Content Screening

  Materials
  • hESC cultures
  • Trizol reagent
  • DEPC‐treated water
  • 250 ng/µl random hexamers
  • 5× FS buffer
  • RNase inhibitor
  • 0.1 M DTT
  • dNTP mix
  • Superscript II reverse transcriptase
  • cDNA samples
  • Primer pairs (forward and reverse primers can be combined into one working stock with each primer at 20 pmoles/µl; see Table 1.3.2)
  • SYBR Green Master Mix
  • Nuclease‐free tubes
  • GeneAmp PCR System 9700 (or equivalent)
  • ABI 96‐well optical reaction plate and adhesive cover
  • Applied Biosystems 7500 Real Time PCR System (or equivalent)
  • Additional reagents and equipment for measuring RNA concentration (Gallagher and Desjardins, )
    Table 1.0.2   Materials   Primers Used for the Most Commonly Studied Gene Products d   Primers Used for the Most Commonly Studied Gene Products

    Gene symbol Accession number Forward primer Reverse primer
    GAPDH NM_002046 CCCATCACCATCTTCCAGGAG CTTCTCCATGGTGGTGAAGACG
    Pou5F1 NM_002701 GTGGAGGAAGCTGACAACAA CTCCAGGTTGCCTCTCACTC
    Nanog NM_024865 AACTGGCCGAAGAATAGCAA CATCCCTGGTGGTAGGAAGA
    TDGF1 NM_003212 CTGCTTTCCTCAGGCATTTC TGCAGACGGTGGTAGTTCTG
    UTF1 NM_003577 CGCCGCTACAAGTTCCTTA ATGAGCTTCCGGATCTGCT
    AFP NM_001134 GTAGCGCTGCAAACAATGAA TCTGCAATGACAGCCTCAAG
    Hand1 NM_004821 AACTCAAGAAGGCGGATGG CGGTGCGTCCTTTAATCCT
    Msx1 BC067353 CGAGAAGCCCGAGAGGAC GGCTTACGGTTCGTCTTGTG
    Msi1 NM_002442 CTTTGATTGCCACAGCCTTC ACTCGTGGTCCTCAGTCAGC

     dDue to the presence of pseudogenes for some of these genes, some of the above primer sequences also match pseudogene sequences.

Basic Protocol 4: Quantitative Real‐Time Polymerase Chain Reaction (Q‐RT‐PCR)

  Materials
  • hESCs cultured in 6‐well plates
  • TrypLE Express (Invitrogen, cat. no. 12604‐013)
  • Phosphate‐buffered saline (PBS; Invitrogen)
  • 35‐mm dish containing mouse embryonic fibroblasts or Matrigel with MEF‐conditioned medium
  • Alkaline phosphatase detection kit (Sigma‐Aldrich, cat. no. 86R‐1KT).
  • 15‐ml conical tubes
  • 40‐µm cell strainer
  • Hemacytometer
  • Standard optical microscope
  • Additional reagents and solutions for counting cells using a hemacytometer (Phelan, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Amit, M., Carpenter, M.K., Inokuma, M.S., Chiu, C.P., Harris, C.P., Waknitz, M.A., Itskovitz‐Eldor, J., and Thomson, J.A. 2000. Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev. Biol. 227:271‐278.
   Andrews, P.W., Goodfellow, P.N., Shevinsky, L.H., Bronson, D.L., and Knowles, B.B. 1982. Cell‐surface antigens of a clonal human embryonal carcinoma cell line: Morphological and antigenic differentiation in culture. Int. J. Cancer 29:523‐531.
   Andrews, P.W., Meyer, L.J., Bednarz, K.L., and Harris, H. 1984. Two monoclonal antibodies recognizing determinants on human embryonal carcinoma cells react specifically with the liver isozyme of human alkaline phosphatase. Hybridoma 3:33‐39.
   Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and Lovell‐Badge, R. 2003. Multipotent cell lineages in early mouse development depend on SOX2 function. Genes Dev. 17:126‐140.
   Boiani, M. and Schöler, H.R. 2005. Regulatory networks in embryo‐derived pluripotent stem cells. Nat. Rev. Mol. Cell Biol. 6:872‐884.
   Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., Gifford, D.K., Melton, D.A., Jaenisch, R., and Young, R.A. 2005. Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122:947‐956.
   Cai, J., Chen, J., Liu, Y., Miura, T., Luo, Y., Loring, J.F., Freed, W.J., Rao, M.S., and Zeng, X. 2006. Assessing self‐renewal and differentiation in human embryonic stem cell lines. Stem Cells 24:516‐530.
   Carpenter, A.E., Jones, T.R., Lamprecht, M.R., Clarke, C., Kang, I.H., Friman, O., Guertin, D.A., Chang, J.H., Lindquist, R.A., Moffat, J., Golland, P., and Sabatini, D.M. 2006. CellProfiler: Image analysis software for identifying and quantifying cell phenotypes. Genome Biol. 7:R100.
   Chadwick, K., Wang, L., Li, L., Menendez, P., Murdoch, B., Rouleau, A., and Bhatia, M. 2003. Cytokines and BMP‐4 promote hematopoietic differentiation of human embryonic stem cells. Blood 102:906‐915.
   Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. 2003. Functional expression Nanog c.o., a pluripotency sustaining factor in embryonic stem cells. Cell 113:643‐655.
   Draper, J.S., Pigott, C., Thomson, J.A., and Andrews, P.W. 2002. Surface antigens of human embryonic stem cells: Changes upon differentiation in culture. J. Anat. 200:249‐258.
   Enver, T., Soneji, S., Joshi, C., Brown, J., Iborra, F., Orntoft, T., Thykjaer, T., Maltby, E., Smith, K., Dawud, R.A., Jones, M., Matin, M., Gokhale, P., Draper, J., and Andrews, P.W. 2005. Cellular differentiation hierarchies in normal and culture‐adapted human embryonic stem cells. Hum. Mol. Genet. 14:3129‐3140.
   Forsyth, N.R., Musio, A., Vezzoni, P., Hamish, A., Simpson, R.W., Noble, B.S., and McWhir, J. 2006. Physiologic oxygen enhances human embryonic stem cell clonal recovery and reduces chromosomal abnormalities. Cloning Stem Cells 8:16‐23.
   Gallagher, S.R. and Desjardins, P.R. 2006. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 76:A.3D.1‐A.3D.21.
   He, J. and Landau, N.R. 1995. Use of a novel human immunodeficiency virus type I reporter virus expressing human placental alkaline phosphatase to detect an alternative viral receptor. J. Virol. 69:4587‐4592.
   Henderson, J.K., Draper, J.S., Baillie, H.S., Fishel, S., Thomson, J.A., Moore, H., and Andrews, P.W. 2002. Preimplantation human embryos and embryonic stem cells show comparable expression of stage‐specific embryonic antigens. Stem Cells 20:329‐337.
   Ji, L., Allen‐Hoffmann, B.L., Juan Pablo, J.D., and Palecek, S.P. 2006. Generation and differentiation of human embryonic stem cell‐derived keratinocyte precursors. Tissue Eng. 12:665‐679.
   Josephson, R., Ording, C.J., Liu, Y., Shin, S., Lakshmipathy, U., Toumadje, A., Love, B., Chesnut, J.D., Andrews, P.W., Rao, M.S., and Auerbach, J.M. 2007. Qualification of embryonal carcinoma 2102Ep as a reference for human embryonic stem cell research. Stem Cells 25:437‐446.
   Lutfalla, G. and Uze, G. 2006. Performing quantitative reverse‐transcribed polymerase chain reaction experiments. Methods Enzymol. 410:386‐400.
   Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. 2003. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ES cells. Cell 113:631‐642.
   Niwa, H., Miyazaki, J., and Smith, A.G. 2000. Quantitative expression of Oct‐3/4 defines differentiation, dedifferentiation or self‐renewal of ES cells. Nat. Genet. 24:372‐376.
   Oka, M., Tagoku, K., Russell, T.L., Nakano, Y., Hamazaki, T., Meyer, E.M., Yokota, T., and Terada, N. 2002. CD9 is associated with leukemia inhibitory factor‐mediated maintenance of embryonic stem cells. Mol. Biol. Cell 13:1274‐1281.
   Pera, M.F., Blasco‐Lafita, M.J., Cooper, S., Mason, M., Mills, J., and Monaghan, P. 1988. Analysis of cell‐differentiation lineage in human teratomas using new monoclonal antibodies to cytostructural antigens of embryonal carcinoma cells. Differentiation 39:139‐149.
   Phelan, M.C. 2006. Techniques for mammalian cell tissue culture. Curr. Protoc. Mol. Biol. 74:A.3F.1‐A.3F.18.
   Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. 2000. Embryonic stem cell lines from human blastocysts: Somatic differentiation in vitro. Nat. Biotechnol. 18:399‐404.
   Riedy, M.C., Muirhead, K.A., Jensen, C.P., and Stewart, C.C. 1991. Use of a photolabeling technique to identify nonviable cells in fixed homologous or heterologous cell populations. Cytometry 12:133‐139.
   Rosner, M.H., Vigano, M.A., Ozato, K., Timmons, P.M., Poirier, F., Rigby, P.W., and Staudt, L.M. 1990. A POU‐domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345:686‐692.
   Schatten, G., Smith, J., Navara, C., Park, J., and Pedersen, R. 2005. Culture of human embryonic stem cells. Nat. Methods 2:455‐463.
   Schopperle, W.M. and Dewolf, W.C. 2006. The Tra‐1‐60 and Tra‐1‐81 human pluripotent stem cell markers are expressed on podocaluxin in embryonal carcinoma. Stem Cells 25:723‐730.
   Segev, H., Kenyagin‐Karsenti, D., Fishman, B., Gerecht‐Nir, S., Ziskind, A., Amit, M., Coleman, R., and Itskovitz‐Eldor, J. 2005. Molecular analysis of cardiomyocytes derived from human embryonic stem cells. Dev. Growth Differ. 47:295‐306.
   Stewart, M.H., Bossé, M., Chadwick, K., Menendez, P., Bendall, S.C., and Bhatia, M. 2006. Clonal isolation of hESCs reveals heterogeneity within the pluripotent stem cell compartment. Nat. Methods 3:807‐815.
   Takeda, J., Seino, S., and Bell, G.I. 1992. Human Oct3 gene family: cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues. Nucl. Acids Res. 20:4613‐4620.
   Thomson, J.A., Itskovitz‐Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145‐1147.
   Toh, W.S., Yang, Z., Liu, H., Heng, B.C., Lee, E.H., and Cao, T. 2007. Effects of culture conditions and BMP2 on extent of chondrogenesis from human embryonic stem cells. Stem Cells 25:950‐960.
   Trounson, A. 2006. The production and directed differentiation of human embryonic stem cells. Endocr. Rev. 27:208‐219.
   Wong, M.L. and Medrano, J.F. 2005. Real‐time PCR for mRNA quantitation. Biotechniques 39:75‐85.
   Xu, X., Kahan, B., Forgianni, A., Jing, P., Jacobson, L., Browning, V., Treff, N., and Odorico, J. 2006. Endoderm and pancreatic islet lineage differentiation from human embryonic stem cells. Cloning Stem Cells 8:96‐107.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library