Differentiation of Embryonic Stem Cells into Cartilage Cells

Jaspal Singh Khillan1

1 University Of Pittsburgh, Pittsburgh, Pennsylvania
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 1F.1
DOI:  10.1002/9780470151808.sc01f01s2
Online Posting Date:  July, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Embryonic stem (ES) cells have complete potential to form all types of cells. Although these cells have indefinite capacity for self‐renewal, the mechanisms that control their lineage‐restricted differentiation are not well understood. Due to their potential to form all types of cells, these cells are expected to have applications in regenerative medicine to cure human diseases. Osteoarthritis (OA) is a degenerative disease of articular cartilage of weight bearing joints. Approximately twenty million people suffer from this debilitating disease. Therefore, the induced differentiation of ES cells into cartilage‐producing cells will have potential application to cure OA. This unit describes a system to induce differentiation of a high percentage of ES cells into mesenchymal cells that differentiate into chondrocytes, the cartilage‐producing cells. A quantitative production of chondrocytes can be a powerful resource to alleviate the suffering of those patients with OA. Furthermore, this can be an excellent system to investigate the upstream events of cell‐restricted differentiation during the inaccessible period of development. Curr. Protoc. Stem Cell Biol. 2:1F.1.1‐1F.1.13. © 2007 by John Wiley & Sons, Inc.

Keywords: embryonic stem cells; limb bud progenitor cells; cartilage; chondrocytes; collagen type II; alternate splicing of collagen type II gene; Oct‐4 transcription factor; proteoglycans

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation, Co‐Culture, and Analysis of Differentiated Embryonic Stem Cells
  • Support Protocol 1: Preparation of Mitotically Inactive Feeder Cells
  • Support Protocol 2: Preparation of Limb Bud Progenitor Cells (LBPC)
  • Support Protocol 3: Alcian Blue Staining of Differentiated Cells
  • Support Protocol 4: Analysis of Differentiated Cells by Reverse Transcriptase–Polymerase Chain Reaction (RT‐PCR)
  • Support Protocol 5: Differential Gene Expression Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation, Co‐Culture, and Analysis of Differentiated Embryonic Stem Cells

  Materials
  • Gelatin solution (see recipe)
  • 1.0 × 106 mitomycin C–treated or irradiated primary mouse fibroblast cells ( protocol 2)
  • ES medium (see recipe)
  • Frozen ES cells
  • 0.25% (w/v) trypsin/EDTA (Invitrogen)
  • PF medium (see recipe)
  • Calcium‐ and magnesium‐free phosphate‐buffered saline (CMF‐PBS: Invitrogen)
  • Plasmid DNA for neo and/or enhanced green florescence protein (EGFP; e.g., pEGFPN1; Clontech)
  • 100‐mm plates with feeder cells
  • G418 (Gibco/BRL)
  • 10% (v/v) DMSO in ES medium
  • LBPC cells ( protocol 3)
  • Trypsin
  • 2 mg/ml collagenase
  • 60‐mm tissue culture dishes
  • Electroporation vials
  • Bio‐Rad Pulsar II electroporator
  • 96‐well plate
  • 24‐well feeder coated plate
  • Stereomicroscope with UV attachment
  • Rotator
  • Four‐well Nunc Petri dishes (Fisher Scientific)
  • Microcentrifuge tubes
  • Additional reagents and equipment for preparation of mitomycin C–treated fibroblast cells ( protocol 2), cell counting (Phelan, ), PCR (Kramer and Coen, ), and preparation of limb bud progenitor cells (LBPC; protocol 3)

Support Protocol 1: Preparation of Mitotically Inactive Feeder Cells

  Materials
  • Breeding pairs of FVB/N (Taconic Farm) mice consisting of:
    • Females: 5‐ to 6‐week old
    • Males: 10‐ to 12‐week old stud males
  • CO 2
  • CMF‐PBS
  • 0.25% (w/v) trypsin/EDTA (Invitrogen)
  • PF medium (see recipe)
  • 100‐mm petri dishes
  • Surgical instruments, e.g., two pairs of forceps and a pair of scissors for collection of embryos
  • Additional reagents and equipment for euthanizing mice by CO 2 asphyxiation (Donovan and Brown, )

Support Protocol 2: Preparation of Limb Bud Progenitor Cells (LBPC)

  Materials
  • Micromass cultures containing putative chondrocytes ( protocol 1)
  • CMF‐PBS
  • 100% ethanol
  • Alcian blue dye (see recipe)
  • 80% (v/v) glycerol with distilled H 2O
  • 100% glycerol
  • Additional reagents and equipment for micromass cultures containing putative chondrocytes ( protocol 1)

Support Protocol 3: Alcian Blue Staining of Differentiated Cells

  Materials
  • G418‐treated micromass cultures ( protocol 1)
  • 0.25% (w/v) trypsin/EDTA
  • RNA extraction kit (STAF‐60; Tel‐Test)
  • RT‐PCR kit (Invitrogen)
  • Tris
  • KCl
  • MgCl 2
  • Taq DNA polymerase
  • PCR primers:
    • Oct‐4:(forward) 5′‐GGCGTTCTCTTTGGAAAGGTGTTC‐3′
    • (reverse) 5′‐CTCGAACCACATCCTTCTCT‐3′
    • Collagen II:(forward) 5′‐GTGAGCCATGATCCGC‐3′
    • (reverse) 5′‐GACCAGGATTTCCAGG‐3′ (Carlberg et al., )
    • Neomycin:(forward) 5′‐AGGATCTCCTGTCATCTCACCTTGCTCCTG‐3′
    • (reverse) 5′‐ AAGAACTCGTCAAGAAGGCGATAGAAGGCG‐3′
    • HPRT:(forward) 5′‐GTAATGATCAGTCAACGGGGGAC‐3′
    • (reverse) 5′‐CCAGCAAGCTTGCAACCTTAACCA‐3′
  • 2% (w/v) agarose gel
  • Thermal cycler
  • Additional reagents and equipment for RNA extraction (Kingston et al., ), RT‐PCR (Beverly, ), and gel electrophoresis (Voytas, )

Support Protocol 4: Analysis of Differentiated Cells by Reverse Transcriptase–Polymerase Chain Reaction (RT‐PCR)

  Materials
  • 1.5 × 106 GFP‐positive ES cells (from frozen stocks)
  • LPBC from normal embryos ( protocol 3)
  • PF medium (see recipe)
  • 4‐well plate
  • FACS (fluorescence‐activated cell sorter) for GFP
  • Additional reagents and equipment for preparation of LPBC ( protocol 3)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ahrens, P.B., Solursh, M., and Meier, S. 1977. The synthesis and localization of glycosaminoglycans in striated muscle differentiating in cell culture. J. Exp. Zool. 202:375‐388.
   Beverly, S.M. 2001. Enzymatic amplification of RNA by PCR (RT‐PCR). Curr. Protoc. Mol. Biol. 56:15.5.1‐15.5.6.
   Bradley, A., Evans, M., Kaufman, M.H., and Robertson, E. 1984. Formation of germ‐line chimaeras from embryo‐derived teratocarcinoma cell lines. Nature 309:255‐256.
   Brown, T. 1999. Southern blotting. Curr. Protoc. Mol. Biol. 68:2.9.1‐2.9.20.
   Carlberg, A.L., Pucci, B., Rallapalli, R., Tuan, R.S., and Hall, D.J. 2001. Efficient chondrogenic differentiation of mesenchymal cells in micromass culture by retroviral gene transfer of BMP‐2. Differentiation 67:128‐138.
   Doetschman, T.C., Eistetter, H., Katz, M., Schmidt, W., and Kemler, R. 1985. The in vitro development of blastocyst‐derived embryonic stem cell lines: Formation of visceral yolk sac, blood islands and myocardium. J Embryol. Exp. Morph. 87:27‐45.
   Donovan, J. and Brown, P. 2006. Euthanasia. Curr. Protoc. Immunol. 73:1.8.1‐1.8.4.
   Evans, M.J. and Kaufman, M.H. 1981. Establishment in culture of pluripotential cells from mouse embryos. Nature 292:154‐156.
   Kimmel, C.A. and Trammell, C.A. 1981. A rapid procedure for routine double staining of cartilage and bone in fetal and adult animals. Stain Technol. 6:271‐273.
   Kingston, R.E., Chomczynski, P., and Sacchi, N. 1996. Guanidine methods for total RNA preparation. Curr. Protoc. Mol. Biol. 36:4.2.1‐4.2.9.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
   Martin, G.R. 1981. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U.S.A. 78:7634‐7638.
   O'Shea, K.S. 2001. Directed differentiation of embryonic stem cells: Genetic and epigenetic methods. Wound Repair Regen. 9:443‐459.
   Phelan, M.C. 2006. Techniques for mammalian cell tissue culture. Curr. Protoc. Mol. Biol. 74:A3F.1‐A.3F.18.
   Robertson, E.J. 1997. Derivation and maintenance of embryonic stem cell cultures. Methods Mol. Biol. 75:173‐184.
   Sandell, L.J., Nalin, A.M., and Reife, R.A. 1994. Alternative splice form of type II procollagen mRNA (IIA) is predominant in skeletal precursors and non‐cartilaginous tissues during early mouse development. Dev. Dyn. 199:129‐140.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library