Purification and Culture of Human Blood Vessel–Associated Progenitor Cells

Mihaela Crisan1,2, Johnny Huard3,2,1, Bo Zheng4,1, Bin Sun2,1, Solomon Yap2,1,5, Alison Logar1,4, Jean‐Paul Giacobino4,2,1, Louis Casteilla2,6, Bruno Péault2,3,1

1 Stem Cell Research Center, Children's Hospital of Pittsburgh of UPMC, Pittsburgh, Pennsylvania, 2 Children's Hospital of Pittsburgh of UPMC, Pittsburgh, Pennsylvania, 3 McGowan Institute for Regenerative Medicine, Pittsburgh, Pennsylvania, 4 Department of Orthopedic Surgery and Molecular Genetics and Biochemistry, Children's Hospital of Pittsburgh of UPMC, Pittsburgh, Pennsylvania, 5 University of Pittsburgh, Pittsburgh, Pennsylvania, 6 University of Toulouse, Toulouse, France
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 2B.2
DOI:  10.1002/9780470151808.sc02b02s4
Online Posting Date:  March, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Multilineage progenitor cells, diversely designated as MSC, MAPC, or MDSC, have been previously extracted from long-term cultures of fetal and adult organs (e.g., bone marrow, brain, lung, pancreas, muscle, adipose tissue, and several others). The identity and location, within native tissues, of these elusive stem cells are described here. Subsets of endothelial cells and pericytes, which participate in the architecture of human blood vessels, exhibit, following purification to homogeneity, developmental multipotency. The selection from human tissues, by flow cytometry using combinations of positive and negative cell surface markers, of endothelial and perivascular cells is described here. In addition, a rare subset of myoendothelial cells that express markers of both endothelial and myogenic cell lineages and exhibit dramatic myogenic and cardiomyogenic potential has been identified and purified from skeletal muscle. The culture conditions amenable to the long-term proliferation of these blood vessel–associated stem cells in vitro are also described. Curr. Protoc. Stem Cell Biol. 4:2B.2.1-2B.2.13. © 2008 by John Wiley & Sons, Inc.

Keywords: endothelial cell; myogenic cell; blood vessel; pericyte; flow cytometry

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of Myoendothelial Cells and Pericytes from Fetal and Adult Tissues
  • Support Protocol 1: Procurement and Storage of Human Fetal and Adult Tissues
  • Basic Protocol 2: Cell Sorting to Purify Human Endothelial, Myoendothelial, and Perivascular Cells
  • Basic Protocol 3: Long-Term Culture of Human Blood Vessel–Associated Progenitor Cells
  • Support Protocol 2: RT-PCR Analysis of Sorted Cell Subsets
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of Myoendothelial Cells and Pericytes from Fetal and Adult Tissues

 Materials
  • Fresh embryonic, fetal, or adult tissue (see Support Protocol 1)
  • 100 µg/ml type-I collagenase (Invitrogen)
  • 100 µg/ml type-IV collagenase (Invitrogen)
  • 1.2 µg/ml dispase (Invitrogen)
  • 1× Hanks’ balanced salt solution (HBSS; Invitrogen)
  • 1× Dulbecco's modified Eagle medium (high-glucose DMEM, Invitrogen)
  • Fetal bovine serum (FBS, Invitrogen)
  • 1% penicillin/streptomycin solution (PS, Invitrogen)
  • Mouse serum (Sigma)
  • 1× Dulbecco's phosphate buffered saline without calcium and magnesium (CMF-DPBS; Invitrogen)
  • Antibodies:
    • CD45-FITC (BD Biosciences) or CD45-APC-Cy7 (1:100; Santa Cruz Biotechnologies)
    • CD144-PE (Beckman Coulter)
    • CD146-FITC (1:100; Serotec)
    • UEA-1-PE (Biomeda Corporation)
    • CD34-APC (BD Biosciences) or CD34-PE (1:100; DAKO or BD Biosciences)
    • CD56-PE-Cy7 (1:100; BD Biosciences or Serotec) or CD56-APC (BD Biosciences)
    • Isotype control antibodies: APC-Cy7-, APC-, PE-Cy7- and PE-mouse IgG1 (BD Biosciences); PE- (1:100; Chemicon), APC-Cy7- (1:100; BD Biosciences), PE-Cy7- and FITC-conjugated mouse IgG (1:100; US Biological)
  • 7-amino-actinomycin D (7-AAD, ViaProbe; BD Biosciences)
  • CompBeads set (BD Biosciences)
  • Collagenases type IA-S, II-S, and IV-S (Sigma)
  • Trypsin-EDTA (Invitrogen)
  • Trypan blue (Sigma)
  • 37°C rotator
  • Sterile surgery scissors, forceps (VWR) and scalpels (Bard-Parker)
  • 50-ml tubes (Falcon)
  • 40-, 70-, and 100-µm cell strainers (BD Biosciences)
  • Flow cytometer
  • CellQuest software (BD Biosciences)
  • 5-ml FACS tubes (BD Biosciences)
  • 60 × 15–mm Petri dishes (BD Biosciences)
  • 37°C shaker
  • Polylysine-coated glass slides (ESCO)
  • Hemacytometer
  • Vortex agitator
  • Additional reagents and equipment for cell counting (unit 1C.3)

Support Protocol 1: Procurement and Storage of Human Fetal and Adult Tissues

 Materials
  • Fetal or adult tissue samples
  • Hanks’ balanced salt solution (HBSS; Invitrogen)
  • 1× Dulbecco's phosphate buffered saline without calcium and magnesium (CMF-DPBS; Invitrogen)
  • Fetal bovine serum (FBS, Invitrogen)
  • Penicillin/streptomycin solution (PS, Invitrogen)
  • 1× Dulbecco's modified Eagle medium (high-glucose DMEM, Invitrogen)
  • Horse serum (Invitrogen)
  • 60 × 15–mm Petri dishes (BD Biosciences)
  • Vertical laminar flow hood
  • Sterile surgery scissors, forceps (VWR), and scalpels (Bard-Parker)
  • Dissecting microscope

Basic Protocol 2: Cell Sorting to Purify Human Endothelial, Myoendothelial, and Perivascular Cells

 Materials
  • Sterile PBS (CMF-DPBS)
  • SPHERO Rainbow fluorescent particles (BD Biosciences)
  • FACS Accudrop fluorescent beads (BD Biosciences)
  • 70% ethanol
  • Antibody stained cell suspensions (see Basic Protocol 1)
  • BD FACSAria flow cytometer equipped with three lasers (488-, 633-, and 407–nm; BD Biosciences) with the following standard filter configurations:
  • Blue excitation: FITC 525 nm, PE 575 nm, PE-Texas Red 610 nm, PerCP-Cy5.5 695 nm, PECy7 780 nm
  • Red excitation: APC 660 nm, APCCy7 780 nm
  • Violet excitation: Pacific Blue 450 nm, Pacific Orange 530 nm

Basic Protocol 3: Long-Term Culture of Human Blood Vessel–Associated Progenitor Cells

 Materials
  • Sorted myoendothelial cells (see Basic Protocol 2)
  • Proliferation medium (see recipe)
  • Trypsin/EDTA (Invitrogen)
  • 1× Dulbecco's modified Eagle medium (high-glucose DMEM, Invitrogen)
  • Fetal bovine serum (FBS, Invitrogen)
  • Penicillin/streptomycin solution (PS, Invitrogen)
  • 0.2% gelatin (Calbiochem)
  • Sorted pericytes (see Basic Protocol 2)
  • Endothelial cell growth medium (EGM2, Cambrex)
  • DPBS
  • Dimethylsulfoxide (DMSO, Sigma)
  • Liquid nitrogen
  • 6-, 12-, 48-, and 96-well collagen-coated plates (Corning)
  • 37°C, 5% CO2 cell incubator
  • Refrigerated low-speed centrifuge
  • 25- and 75-cm2 tissue culture flasks (Falcon)
  • 12- and 48-well uncoated plates
  • 15-ml conical tubes (Falcon)

Support Protocol 2: RT-PCR Analysis of Sorted Cell Subsets

 Materials
  • Freshly sorted cells pelleted by microcentrifuging 1 min at 10,000 rpm, 4°C
  • Absolutely RNA nanoprep kit (Stratagene)
  • SuperScript II reverse transcriptase kit (Invitrogen)
  • Taq DNA polymerase (Invitrogen)
  • DNA oligonucleotides (Integraded DNA Technologies; see Table 2B.2.3 for size and sequence)
  • 1% agarose gels
  • Microcentrifuge (Sorvall Biofuge)
  • PCR machine (thermal cycler model TC-312, Techne)
  • 0.5-ml thin-walled PCR reaction tubes (GeneAmp, Applied Biosystems)
  • Agarose gel electrophoresis system (DNA plus, USA Scientific)
  • Gel documentation system (Gel Doc 2000, Bio-Rad)
     
    Table 2B.2.3 Primers for PCR Analysis of Myoendothelial Cells and Pericyte Cells

    GeneSense primeraAnti-sense primeraAmplicon positionAccess numberProduct size

    CD34CATCACTGGCTATTTCCTGATGAGCCGAATGTGTAAAGGACAG1172–1591NM001025109419
    CD144TGGAGACTCCTTCCAGCTTCAGCTTCCACCACGATCTCATAC511–785U84722274
    CD56GTATTTGCCTATCCCAGTGCCCATACTTCTTCACCCACTGCTC542–873BC014205331
    Myf5CACCTCCAACTGCTCTGATGGGTGAATCGGTGCTGGCAACT519–757NM005593238
    Pax7ACCAGGAGACCGGGTCCATCCCCGAACTTGATTCTGAGC868–1088NM 002584220
    CD45CATGTACTGCTCCTGATAAGACGCCTACACTTGACATGCATAC940–1579Y00638639
    CD146AAGGCAACCTCAGCCATGTCGCTCGACTCCACAGTCTGGGAC168–603M28882435
    NG2GCTTTGACCCTGACTATGTTGGCTCCAGAGTAGAGCTGCAGCA141–336NM001897195
    -actinCCTCGCCTTTGCCGATCCGGAATCCTTCTGACCCATGC25–229NM001101204

     aAll primers are listed from 5¢ to 3¢.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
    Alliot-Licht, B., Bluteau, G., Magne, D., Lopex-Cazaux, S., Lieubeau, B., Daculs, G., and Guicheux, J. 2005. Dexamethasone stimulates differentiation of odontoblast-like cells in human dental pulp cultures. Cell Tissue Sep. 321: 391-400.
    Beresford, J.N., Bennett, J.H., Devlin, C., Leboy, P.S., and Owen, M.E. 1992. Evidence for an inverse relationship between the differentiation of adipocytic and osteogenic cells in rat marrow stromal cell cultures. J. Cell Sci. 102: 341-351.
    Collett, G.D. and Canfield, A.E. 2005. Angiogenesis and pericytes in the initiation of ectopic calcification. Circ. Res. 96: 930-938.
    Cossu, G. and Bianco, P. 2003. Mesoangioblasts-vascular progenitors for extravascular mesodermal tissues. Curr. Opin. Genet. Dev. 13: 537-542.
    Farrington-Rock, C., Crofts, N.J., Doherty, M.J., Ashton, B.A., Griffin-Jones, C., and Canfield, A.E. 2004. Chondrogenic and adipogenic potential of microvascular pericytes. Circulation 110: 2226-2232.
    Jiang, Y., Vaessen, B., Lenvik, T., Blackstad, M., Reyes, M., and Verfaillie, C.M. 2002. Multipotent progenitor cells can be isolated from postnatal murine bone marrow, muscle, and brain. Exp. Hematol. 30: 896-904.
    Oberlin, E., Tavian, M., Blazsek, I., and Péault, B. 2002. Blood-forming potential of vascular endothelium in the human embryo. Development 129: 4147-4157.
    Péault, B., Rudnicki, M., Torrente, Y., Cossu, G., Tremblay, J., Partridge, T., Gussoni, E., Kunkel, L., and Huard, J. 2007. Stem and progenitor cells in skeletal muscle development, maintenance and therapy. Mol. Ther. 15: 867-877.
    Pittenger, M.F., MacKay, A.M., Beck, S.C., Jaiswal, R.K., Douglas, R., Mosca, J.D., Moorman, M.A., Simonetti, D.W., Craig, S., and Marshak, D.R. 1999. Multilineage potential of adult human mesenchymal stem cells. Science 284: 143-147.
    Prockop, D.J. 1997. Marrow stromal cells as stem cells for nonhematopoietic tissues. Science 276: 71-74.
    Qu-Petersen, Z., Deasy, B.M., Jankowski, R., Ikezawa, M., Cummins, J., Pruchnic, R., Cao, B., Mytinger, J., Gates, C., Wernig, A., and Huard, J. 2002. Identification of a novel population of muscle stem cells in mice: Potential for muscle regeneration. J. Cell Biol. 157: 851-864.
    Seaberg, R.M., Smukler, S.R., Kieffer, T.J., Enikolopov, G., Asghar, Z., Wheeler, M.B., Korbutt, G., and Van Der Kooy, D. 2004. Clonal identification of multipotent precursors from adult mouse pancreas that generate neural and pancreatic lineages. Nat. Biotechnol. 22: 1115-1124.
    Shih, D.T., Lee, D.C., Chen, S.C., Tsai, R.Y., Huang, C.T., Tsai, C.C., Shen, E.Y., and Chiu, W.T. 2005. Isolation and characterization of neurogenic mesenchymal stem cells in human scalp tissue. Stem Cells 23: 1012-1020.
    Tavian, M., Hallais, M.F., and Péault, B. 1999. Emergence of intraembryonic hematopoietic precursors in the pre-liver human embryo. Development 126: 793-803.
    Toma, J.G., Akhavan, M., Fernandes, K.J., Barnabe-Heider, F., Sadikot, A., Kaplan, D.R., and Miller, F.D. 2001. Isolation of multipotent adult stem cells from the dermis mammalian skin. Nat. Cell Biol. 3: 778-784.
    Toma, C., Pittenger, M.F., Cahill, K.S., Byrne, B.J., and Kessler, P.D. 2002. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105: 93-98.
    Zambidis, E.T., Péault, B., Park, T.S., Bunz, F., and Civin, C.I. 2005. Hematopoietic differentiation of human embryonic stem cells progresses through sequential hemato-endothelial, primitive, and definitive stages resembling human yolk sac development. Blood 106: 860-870.
    Zambidis, E., Oberlin, E., Tavian, M., and Peault, B. 2006. Blood-forming endothelium in human ontogeny: Lessons from in utero development and embryonic stem cell culture. Trends Cardiovasc. Med. 16: 95-101.
    Zheng, B., Cao, B., Crisan, M., Sun, B., Li, G., Logar, A., Yap, S., Pollet, J.B., Drowley, L., Cassino, T., Gharaibeh, B., Deasy, B.M., Huard, J., and Péault, B. 2007. Prospective identification of myogenic endothelial cells in human skeletal muscle. Nat. Biotechnol. 25: 1025-1034.
    Zuk, P.A., Zhu, M., Mizuno, H., Huang, J., Futrell, J.W., Katz, A.J., Benhaim, P., Lorenz, H.P., and Hedrick, M.H. 2001. Multilineage cells from human adipose tissue: Implications for cell-based therapies. Tissue Eng. 7: 211-228.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library