Scalable Production of Transplantable Dopaminergic Neurons from hESCs and iPSCs in Xeno‐Free Defined Conditions

Andrzej Swistowski1, Xianmin Zeng2

1 XCell Science Inc., Novato, California, 2 Buck Institute for Age Research, Novato, California
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 2D.12
DOI:  10.1002/9780470151808.sc02d12s22
Online Posting Date:  August, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are potentially an unlimited cell source for cell replacement therapy and personalized medicine. Before hESC‐ and iPSC‐based therapy can be moved from bench to bedside, however, it is essential to establish protocols for generating therapeutically relevant cells, like dopaminergic neurons in defined conditions that are suitable for scalable good manufacturing practice (GMP)‐compliant protocols. Here, the derivation and differentiation of functional dopaminergic neurons from hESCs and iPSCs under xeno‐free defined conditions are described. These protocols have been validated in multiple hESC and iPSC lines. Curr. Protoc. Stem Cell Biol. 22:2D.12.1‐2D.12.20. © 2012 by John Wiley & Sons, Inc.

Keywords: human ESCs; human iPSCs; xeno‐free; neural stem cell; dopaminergic neuron

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Maintenance of hESCs/iPSCs Under Xeno‐Free Defined Conditions
  • Alternate Protocol 1: Manual Dissection of hESCs/iPSCs
  • Support Protocol 1: Cryopreservation and Recovery of Xeno‐Free hESCs/iPSCs
  • Basic Protocol 2: Derivation of Neural Stem Cells in Xeno‐Free Defined Conditions
  • Support Protocol 2: Maintenance of Neural Stem Cells in Xeno‐Free Defined Conditions
  • Basic Protocol 3: Dopaminergic Differentiation of NSCs in Xeno‐Free Defined Conditions
  • Support Protocol 3: Immunocytochemistry
  • Support Protocol 4: Reverse Transcription Polymerase Chain Reaction (RT‐PCR)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Maintenance of hESCs/iPSCs Under Xeno‐Free Defined Conditions

  Materials
  • CellStart (Life Technologies, cat. no. A10142)
  • PBS with Ca2+ and Mg2+
  • Cultured cell colonies in culture dishes coated with xeno‐free substrate (CellStart) in xeno‐free complete medium (KnockOut SR xeno‐free complete medium, see recipe)
  • KnockOut SR xeno‐free complete medium (see recipe)
  • 35‐ and 60‐mm standard tissue culture–treated dishes (Corning)
  • 37°C incubator
  • Syringe needle or tool made of heat‐stretched glass Pasteur pipet (Fig. A)
  • StemPro EZPassage disposable stem cell passaging tool (Life Technologies, cat. no. 23181‐010)

Alternate Protocol 1: Manual Dissection of hESCs/iPSCs

  • Light microscope or dissecting microscope placed in a clean room or low traffic area

Support Protocol 1: Cryopreservation and Recovery of Xeno‐Free hESCs/iPSCs

  Materials
  • ES FREEZE‐A and ES FREEZE‐B media (see reciperecipes)
  • Isopropanol
  • Liquid nitrogen tank
  • 50× StemPro hESC supplement (Life Technologies, cat. no. A10006‐01)
  • 15‐ or 50‐ml conical tubes
  • Bench‐top centrifuge
  • 5‐ml serological pipets
  • 2‐ml cryogenic vials (Corning)
  • Freezing container (e.g., Mr. Frosty, Nalgene)
  • Freezer (−80°C)
  • 37°C water bath
  • Additional reagents and equipment for hESCs/iPSCs processing (see protocol 1)

Basic Protocol 2: Derivation of Neural Stem Cells in Xeno‐Free Defined Conditions

  Materials
  • hESCs/iPSCs grown to confluency on 60‐mm dishes
  • DMEM/F‐12 (see recipe), prewarmed
  • Xeno‐free medium for EB differentiation (XF‐EB medium, see recipe)
  • Neural induction medium (NIM, see recipe)
  • 60‐mm cell culture dishes coated with CellStart (see protocol 1)
  • NSC expansion medium (NSC medium, see recipe)
  • StemPro accutase (Life Technologies, cat. no. A11105)
  • 37°C incubator
  • EZPassage tool
  • Petri dishes
  • 15‐ml conical tubes
  • Heat‐stretched glass Pasteur pipet
  • 1.5‐ml microcentrifuge tubes

Support Protocol 2: Maintenance of Neural Stem Cells in Xeno‐Free Defined Conditions

  Materials
  • 60‐mm dish containing confluent NSCs
  • StemPro accutase (Life Technologies, cat. no. A11105)
  • Neurobasal medium (Life Technologies, cat. no. 21103)
  • CellStart substrate–coated dishes (see protocol 1)
  • NSC freezing medium A (NSC‐FREEZE‐A, see recipe)
  • NSC freezing medium B (NSC‐FREEZE‐B, see recipe)
  • Isopropanol
  • Liquid nitrogen
  • KO‐DMEM/F12 medium (see recipe), pre‐warmed
  • 2‐ml cryogenic vials
  • Isopropanol freezing chamber (e.g., Mr. Frosty from Nalgene)
  • 37°C water bath
  • 37°C, 5% CO 2 humidified incubator
  • Additional reagents and equipment for cell processing (see protocol 4)

Basic Protocol 3: Dopaminergic Differentiation of NSCs in Xeno‐Free Defined Conditions

  Materials
  • Poly‐ornithine (Sigma, cat. no. P3655‐50MG)
  • Laminin (Life Technologies, cat. no. 23017‐015)
  • NSCs
  • XF NSC medium (see recipe)
  • DA1 and DA2 media (see recipes)
  • Ascorbic acid
  • 35‐mm cell culture dishes

Support Protocol 3: Immunocytochemistry

  Materials
  • Cells cultured in dish
  • PBS
  • 4% paraformaldehyde (PFA; see recipe)
  • 10% goat serum in 0.1% PBS/Triton‐X (see recipe)
  • 8% goat serum in 0.1% PBS/Triton‐X (see recipe)
  • Primary antibodies and dilutions:
    • Mouse anti‐β‐tubulin isotype III clone SDL.3D10, 1:1500 (Sigma, cat. no. T8660)
    • Mouse anti‐Nestin, 1:500 (BD Transduction laboratories, cat. no. 611658)
    • Mouse anti Tra 1‐60, 1:50 (eBioscience, cat. no. 14‐8863)
    • Mouse anti‐SSEA4, 1:50 (eBioscience, cat. no. 14‐8843)
    • Mouse anti‐GalC, 1:50 (Millipore, cat. no. MAB342)
    • Rabbit anti‐Oct4, 1:1000 (AbCam, cat. no. ab19857)
    • Rabbit anti‐Sox‐1, 1:800 (Chemicon, cat. no. AB5768)
    • Rabbit anti‐tyrosine hydroxylase (TH), 1:500 (Pel‐Freeze, cat. no. P40101)
    • Rabbit anti‐GFAP 1:1000 (Chemicon, cat. no. M0761)
    • Rabbit anti‐Girk2, 1:250 (Chemicon, cat. no. AB5200)
    • Rabbit anti‐Lmx1a, 1:1500 (a kind gift from Dr. Michael German, UCSF)
    • Rat anti‐Musashi, 1:50 (eBioscience, cat. no. 14‐9896)
  • Secondary antibodies:
    • Alexa Fluor 488 goat anti‐mouse (Molecular Probes, cat. no. A‐11001)
    • Alexa Fluor 488 goat anti‐rabbit (Molecular Probes, cat. no. A‐11008)
    • Alexa Fluor 488 goat anti‐mouse IgM (Molecular Probes, cat. no. A‐21042)
    • Alexa Fluor 594 goat anti‐rabbit (Molecular Probes, cat. no. A‐11005)
    • Alexa Fluor 594 goat anti‐mouse (Molecular Probes, cat. no. A‐11012)
    • Alexa Fluor 594 rabbit anti‐goat (Molecular Probes, cat. no. A‐11080)
    • Alexa Fluor 486 goat anti‐rat (Molecular Probes, cat. no. A‐11006)
    • Alexa Fluor 594 goat anti‐rat (Molecular Probes, cat. no. A‐11007)
    • Alexa Fluor 594 goat anti‐mouse IgM (Molecular Probes, cat. no. A‐21044)
  • ProLong antifade reagent (Life Technologies, cat. no. P36930)
  • 10 mg/ml Hoechst 33342, trichloride, trihydrate solution in water (Life Technologies, cat. no. H3570)
  • Coverslips
  • Fluorescent microscope with appropriate filters

Support Protocol 4: Reverse Transcription Polymerase Chain Reaction (RT‐PCR)

  Materials
  • Undifferentiated or differentiated cells
  • StemPro accutase (Life Technologies, cat. no. A11105)
  • PBS
  • Trizol (Life Technologies, cat. no. 15596018)
  • Chloroform (Sigma, cat. no. C2432)
  • Isopropanol (Acros Organics, cat. no. 327270010)
  • Ethyl alcohol, 200 proof (Acros Organics, cat. no. 61510‐1000)
  • DEPC water (Sigma, cat. no. 95284)
  • DNase I kit (Sigma, cat. no. AMPD1‐kt)
  • 10 mM dNTP mix (Life Technologies, cat. no. 18427‐013)
  • SuperScript first‐strand synthesis system for RT‐PCR (Life Technologies, cat. no. 11904‐018)
  • Taq DNA polymerase, recombinant (Life Technologies, cat. no. 10342‐046)
  • PCR primers (Table 2.12.1)
  • EZPassage tool
  • 2‐ml tubes
  • Refrigerated centrifuge
  • 70°C heating block
  • Thermal cycler
    Table 2.1.1   MaterialsPrimer Sequences

    Gene name Genbank accession no. Primer sequence
    TH NM_00360 5‐ GGTTCCCAAGAAAAGTGTCAG‐3′5′‐ GGTGTAGACCTCCTTCCAG‐3′
    AADC NM_00790 5′‐ GGGACCACAACATGCTGCTC‐3′5′‐ CCACTCCATTCAGAAGGTGCC‐3′
    Nurr1 X75918 NM_006186Hs. 82120 5′‐ CGGACAGCAGTCCTCCATTAAGGT‐3′5′‐CTGAAATCGGCAGTACTGACAGCG‐3′
    trkA M23102 NM_002529Hs.406293 5′‐CCATCGTGAAGAGTGGTCTC‐3′5′‐GGTGACATTGGCCAGGGTCA‐3′
    trkB S76473 NM_006180Hs.422220 5′‐AGGGCAACCCGCCCACGGAA‐3′5′‐TTGGTGGCCTCCAGCGGCAG‐3′
    trkC S76475 NM_002530Hs.26776 5′‐ACGCCAGGCCAAGGGTGAGCT‐3′5′‐TTCATGACCACCAGCCACCAC‐3′
    GTPCH I NM_00161 5′‐CAGGAGACCATCTCAGATGTC‐3′5′‐TTCTTCTCCCTTCCCAGGCC‐3′
    PITX3 NM_005029 5′‐ACTAGGCCCTACACAC‐3′5′‐TTTTTTTGACAGTCCGC‐3′
    LMX1B NM_002316 5′‐AACTGTACTGCAAACAAGACTACC‐3′5′‐TTCATGTCCCCATCTTCATCCTC‐3′
    PCBD NM_00281 5′‐GTGATGCCATCTTCAAGCAG‐3′5′‐CAAATTAGTGTAACAGAGCCCC‐3′
    QDPR NM_00320 5′‐AAGGAAGGACGGAACTCAC‐3′5′‐TCCCCAATACCAACAAATCAAC‐3′
    DAT L24178 NM_001044Hs.406 5′‐AGCAGAACGGAGTGCAGCT‐3′5′‐GTATGCTCTGATGCCGTCT‐3′
    VMAT2 L23205 NM_003054Hs.50458 5′‐CTTTGGAGTTGGTTTTGC‐3′5′‐GCAGTTGTGATCCATGAG‐3′
    DBH NM_00787 5′‐GTGCTACATTAAGGAGCTTCCAAAG‐3′5′‐GGCCTCATTGCCCTTGGT‐3′
    CHAT NM_020549Hs.302002 5′‐ ATGGGGCTGAGGACAGCGAAG‐3′5′‐ AAGTGTCGCATGCACTGCAGG‐3′
    VAChT U10554 NM_003055Hs.302002 5′‐ ACGTGGATGAAGCATACG‐3′5′‐ CTGAGACATGGCGCACGT‐3′
    GAD67 NM_00817 5′‐ATTCTTGAAGCCAAACAG‐3′5′‐TAGCTTTTCCCGTCGTTG‐3′
    Glutaminase (KGA) AF097494 NM_014905Hs.128410 5′‐GGTCTCCTCCTCTGGATAAGATGG‐3′5′‐CCCGTTGTCAGAATCTCCTTGAGG‐3′
    Glutaminase (GAC) AF158555Hs.128410 5′‐GATGTCCTCATTTGACTCAGGTGAC‐3′
    TPH1 NM_004179Hs.356479 5′‐ATGATTGAAGACAATAAGGAG‐3′5′‐AGTTTCCATACCATCTTCCTTC‐3′
    TPH2 NM_173353 5′‐CTCTCCAAACTCTATCCCACTC‐3′5′‐GCATTCCTGTAAGCAAGTTGTC‐3′
    p75 NM_002507 5′‐AGCCAACCAGACCGTGTGT‐3′5′‐TTGCAGCTGTTCCACCTCTT‐3′
    c‐RET 5′‐AGGAGGCTGAGTGGGCTACGT‐3′5′‐GGACCTCAGATGTGCTGT‐3′
    GFRA1 NM_005264 5′‐AGGGAAATGATCTGCTGGAGGA‐3′5′‐CTCTGGCTGGCAGTTGGTAAAA‐3′
    GFRA2 NM_001495 5′‐AGGCCCTGCGCCAGTTCTTCGA‐3′5′‐ACGTTCACGTCCGTGCCGTTGC‐3′
    GFRA3 NM_001496 5′‐CTGCACCTCTAGCATAAGCACC‐3′5′‐GGCCTTCTCGAAGAAAGTGAGC‐3′
    PTCH NM_0026 5′‐TCCCAAGCAAATGTACGAGCA‐3′5′‐TGAGTGGAGTTCTGTGCGACAC‐3′
    Smo NM_005631 4 5′‐TATTCACTCCCGCACCAAC‐3′5′‐AGCCAGACATCCAGAACTC‐3′

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Carpenter, M., Rao, M.S., Freed, W., and Zeng, X. 2006. Derivation and characterization of neuronal precursors and dopaminergic neurons from human embryonic stem cells in vitro. Methods Mol. Biol. 331:153‐167.
   Han, Y., Miller, A., Mangada, J., Liu, Y., Swistowski, A., Zhan, M., Rao, M.S., and Zeng, X. 2009. Identification by automated screening of a small molecule that selectively eliminates neural stem cells derived from hESCs but not dopamine neurons. PLoS One 4:e7155.
   Perrier, A.L. and Studer, L. 2003. Making and repairing the mammalian brain In vitro production of dopaminergic neurons. Semin. Cell Dev. Biol. 14:181‐189.
   Swistowska, A.M., da Cruz, A.B., Han, Y., Swistowski, A., Liu, Y., Shin, S., Zhan, M., Rao, M.S., and Zeng, X. 2010. Stage‐specific role for SHH in dopaminergic differentiation of human embryonic stem cells induced by stromal cells. Stem Cells Dev. 19:71‐82.
   Swistowski, A., Peng, J., Han, Y., Swistowska, A.M., Rao, M.S., and Zeng, X. 2009. Xeno‐free defined conditions for culture of human embryonic stem cells, neural stem cells and dopaminergic neurons derived from them. PLoS One 4:e6233.
   Swistowski, A., Peng, J., Liu, Q., Mali, P., Rao, M.S., Cheng, L., and Zeng, X. 2010. Efficient generation of functional dopaminergic neurons from human induced pluripotent stem cells under defined conditions. Stem Cells 28:1893‐1904.
   Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861‐872.
   Thomson, J.A., Itskovitz‐Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145‐1147.
   Vazin, T., Becker, K.G., Chen, J., Spivak, C.E., Lupica, C.R., Zhang, Y., Worden, L., and Freed, W.J. 2009. A novel combination of factors, termed SPIE, which promotes dopaminergic neuron differentiation from human embryonic stem cells. PLoS One 4:e6606.
   Yan, Y., Yang, D., Zarnowska, E.D., Du, Z., Werbel, B., Valliere, C., Pearce, R.A., Thomson, J.A., and Zhang, S.C. 2005. Directed differentiation of dopaminergic neuronal subtypes from human embryonic stem cells. Stem Cells 23:781‐790.
   Yang, D., Zhang, Z.J., Oldenburg, M., Ayala, M., and Zhang, S.C. 2008. Human embryonic stem cell‐derived dopaminergic neurons reverse functional deficit in Parkinsonian rats. Stem Cells 26:55‐63.
   Zeng, X., Cai, J., Chen, J., Luo, Y., You, Z.B., Fotter, E., Wang, Y., Harvey, B., Miura, T., Backman, C., Chen, G.J., Rao, M.S., and Freed, W.J. 2004a. Dopaminergic differentiation of human embryonic stem cells. Stem Cells 22:925‐940.
   Zeng, X., Chen, J., Liu, Y., Luo, Y., Schulz, T.C., Robins, A.J., Rao, M.S., and Freed, W.J. 2004b. BG01V: A variant human embryonic stem cell line which exhibits rapid growth after passaging and reliable dopaminergic differentiation. Restor. Neurol. Neurosci. 22:421‐428.
   Zeng, X., Chen, J., Deng, X., Liu, Y., Rao, M.S., Cadet, J.L., and Freed, W.J. 2006. An in vitro model of human dopaminergic neurons derived from embryonic stem cells: MPP+ toxicity and GDNF neuroprotection. Neuropsychopharmacology 31:2708‐2715.
   Zhang, X.Q. and Zhang, S.C. 2010. Differentiation of neural precursors and dopaminergic neurons from human embryonic stem cells. Methods Mol. Biol. 584:355‐366.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library