Excision of a Viral Reprogramming Cassette by Delivery of Synthetic Cre mRNA

Yuin‐Han Loh1, Jimmy Chen Yang1, Alejandro De Los Angeles1, Chunguang Guo2, Anne Cherry3, Derrick J. Rossi2, In‐Hyun Park4, George Q. Daley4

1 These authors contributed equally to this work and are co‐first authors., 2 Immune Disease Institute, Program in Cellular and Molecular Medicine, Children's Hospital Boston, Harvard Stem Cell Institute, and the Department of Pathology, Harvard Medical School, Boston, Massachusetts, 3 Harvard Stem Cell Institute, Cambridge, Massachusetts, 4 These authors are co‐corresponding authors.
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 4A.5
DOI:  10.1002/9780470151808.sc04a05s21
Online Posting Date:  May, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The generation of patient‐specific induced pluripotent stem (iPS) cells provides an invaluable resource for cell therapy, in vitro modeling of human disease, and drug screening. To date, most human iPS cells have been generated with integrating retro‐ and lenti‐viruses and are limited in their potential utility because residual transgene expression may alter their differentiation potential or induce malignant transformation. Alternatively, transgene‐free methods using adenovirus and protein transduction are limited by low efficiency. This unit describes a protocol for the generation of transgene‐free human induced pluripotent stem cells using retroviral transfection of a single vector, which includes the coding sequences of human OCT4, SOX2, KLF4, and cMYC linked with picornaviral 2A plasmids. Moreover, after reprogramming has been achieved, this cassette can be removed using mRNA transfection of Cre recombinase. The method described herein to excise reprogramming factors with ease and efficiency facilitates the experimental generation and use of transgene‐free human iPS cells. Curr. Protoc. Stem Cell Biol. 21:4A.5.1‐4A.5.16. © 2012 by John Wiley & Sons, Inc.

Keywords: reprogramming; induced pluripotent stem cells; synthetic mRNA; Cre‐excision; transgene‐free iPSCs

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Direct Reprogramming of Human Fibroblasts using a Cre‐Excisable Retroviral Reprogramming Monovector
  • Basic Protocol 2: Synthesis of Modified Cre mRNA
  • Basic Protocol 3: Efficient Excision of Reprogramming Factors using mRNA Transfection of Cre Recombinase
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Direct Reprogramming of Human Fibroblasts using a Cre‐Excisable Retroviral Reprogramming Monovector

  Materials
  • 293T cells for generating retrovirus (ATCC #CRL11268) growing in a 100‐mm tissue culture dish
  • 293T medium (see recipe)
  • Fugene 6 (Roche Applied Science, cat no. 1181509001)
  • DMEM
  • DMEM/F12 (Invitrogen, cat. no. 10565‐018)
  • pE4‐OSKM vector (available from author upon request)
  • Gag‐Pol (Addgene, clone 8455)
  • VSV‐G (Addgene, clone 8454)
  • 10% FBS medium
  • Human fibroblasts
  • Protamine sulfate (Sigma Aldrich, cat no. P4380)
  • PBS
  • Human fibroblast medium (see recipe)
  • Irradiated CF‐1 mouse embryonic fibroblast (MEFs) (GlobalStem, cat. no. GSC‐6001G)
  • CF1 MEF feeder medium (see 10% FBS medium recipe)
  • 0.05% trypsin (Invitrogen, cat no. 2530054)
  • hESC growth medium (see recipe)
  • Y‐27632 (Sigma‐Aldrich, cat no. Y0503)
  • Platform rocker
  • 37°C, 5% CO 2 humidified incubator
  • 6‐well plates
  • 10‐ml disposable syringe (BD, cat no. 301030)
  • Low protein–binding, 0.45‐µm pore size cellulose acetate filter (Pall Life Sciences, cat no. PN4184)
  • 1 × 3‐1/2 polyallomer centrifuge tube (Beckman, cat no. 326823)
  • Beckman XL‐90 ultracentrifuge
  • 100‐mm plates coated with 0.1% gelatin (for gelatin, Sigma‐Aldrich, cat no. G1890)
  • Hemacytometer
  • 12‐well plates coated with 0.1% gelatin (for gelatin, Sigma‐Aldrich, cat no. G1890)
  • Stereomicroscope
  • Cell lifter (Corning, cat no. 3008)

Basic Protocol 2: Synthesis of Modified Cre mRNA

  Materials
  • 5′ ORF oligonucleotide: 5′ TCCAATTTACTGACCGTACACC3′
  • T4 polynucleotide kinase (PNK) with 10× buffer (New England Biolabs, cat. no. M0201)
  • Adenosine‐5′‐triphosphate (ATP) (100 mM, USB; Affymetrix, cat. no. 77241)
  • TE buffer, RNase‐free (10 mM Tris⋅Cl, pH 8/1 mM EDTA)
  • KAPA HiFi Hotstart ReadyMix (Harvard Biopolymers, cat. no. KK2601)
  • 3′ ORF oligonucleotide: 5′CTAATCGCCATCTTCCAGCAGG3′
  • pBABE‐puro‐Cre (kindly provided by Dr. Zhe Li, Harvard Medical School)
  • 1.2% agarose gel
  • 100‐bp DNA ladder (NEB, cat. no. N3231S)
  • QIAquick PCR purification kit (Qiagen) containing:
    • Buffer EB
    • Buffer PE
    • Buffer
    • PB Loading dye
    • QIAquick spin columns
  • Nuclease‐free water
  • 5′ UTR oligonucleotide:
    • 5′TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG3′
  • 3′ UTR oligonucleotide (phosphorylated):
    • 5′TTGGACCCTCGTACAGAAGCTAATACGACTCACTATAGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACCATG3′
  • 5′ Splint oligonucleotide:
    • 5′GGTGTACGGTCAGTAAATTGGACATGGTGGCTCTTATATTTCTT3′
  • 3′ Splint oligonucleotide:
    • 5′CCCGCAGAAGGCAGCGATTAGCGGTAGAAGGTCGT3′
  • Ampligase enzyme with 10× buffer (Epicentre Biotechnologies, cat. no. A32750)
  • KAPA HiFi Hotstart Readymix (Harvard Biopolymers, cat. no. KK2601)
  • Tail forward primer (generic): 5′TTGGACCCTCGTACAGAAGCTAATACG3′
  • Tail reverse primer (generic; PAGE purified):
    • 5′T 120CTTCCTACTCAGGCTTTATTCAAAGACCA3′
  • NTP mix (see recipe)
  • MEGAscript T7 kit (Ambion, cat. no. AM1334M) containing:
    • 10× reaction buffer
    • Enzyme mix
    • ATP solution
    • GTP solution
    • CTP solution
    • UTP solution
  • TURBO DNase (Invitrogen, cat. no. AM‐2238)
  • MEGAclear kit (Ambion, cat. no. AM1908M) containing:
    • Binding solution concentrate
    • Wash solution
    • 5 M ammonium acetate
    • Elution solution
    • Filter cartridges
    • Collection and elution tubes
  • 100% ethanol
  • Antarctic phosphatase (New England Biolabs, cat. no. M0289)
  • 37°C and 65°C heating blocks
  • Thermal cycler
  • 1.7‐ml microcentrifuge tubes, RNase‐free
  • Spectrophotometer (NanoDrop)
  • PCR strip

Basic Protocol 3: Efficient Excision of Reprogramming Factors using mRNA Transfection of Cre Recombinase

  Materials
  • Matrigel hESC‐qualified matrix (BD Biosciences, cat. no. 354277)
  • DMEM/F12 (Invitrogen, cat. no. 10565‐018)
  • Growing hiPSCs generated with pE4‐OSKM retrovirus (see protocol 1) at 80% to 90% confluency in 60‐mm dish
  • Accutase (Invitrogen, cat. no. A11105‐01)
  • Y‐27632 (Sigma‐Aldrich, cat. no. Y0503)
  • mTeSR1 medium (Stem Cell Technologies, cat. no. 05850)
  • Cre mRNA (see protocol 2)
  • Opti‐MEM reduced serum medium (Invitrogen, cat. no. 31985‐070)
  • RNAiMax (Invitrogen, cat. no. 13778‐100)
  • B18R interferon inhibitor (Invitrogen, cat. no. 34‐8185)
  • CF1 MEF feeder cells
  • MEF medium (10% FBS/DMEM)
  • hESC medium (see recipe)
  • Qiagen DNeasy blood and tissue kit
  • pE4 retroviral vector primers:
    • Forward 5′ CATCGCAGCTTGGATACA 3′
    • Reverse 5′ CCGATGATTAATTGTCAA 3′
  • EcoRI and HindIII enzymes
  • 15‐ml conical tubes, sterile
  • 6‐well plates
  • 37°C incubator
  • Stereo microscope
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Anokye‐Danso, F., Trivedi, C.M., Juhr, D., Gupta, M., Cui, Z., Tian, Y., Zhang, Y., Yang, W., Gruber, P.J., Epstein, J.A., and Morrisey, E.E. 2011. Highly efficient miRNA‐mediated reprogramming of mouse and human somatic cells to pluripotency. Cell Stem Cell 8:376‐388.
   Chan, E.M., Ratanasirintrawoot, S., Park, I.H., Manos, P.D., Loh, Y.H., Huo, H., Miller, J.D., Hartung, O., Rho, J., Ince, T.A., Daley, G.Q., and Schlaeger, T.M. 2009. Live cell imaging distinguishes bona fide human iPS cells from partially reprogrammed cells. Nat. Biotechnol. 27:1033‐1037.
   Fusaki, N., Ban, H., Nishiyama, A., Saeki, K., and Hasegawa, M. 2009. Efficient induction of transgene‐free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that does not integrate into the host genome. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 85:348‐362.
   Kim, D., Kim, C.‐H., Moon, J.‐I., Chung, Y.‐G., Chang, M.‐Y., Han, B.‐S., Ko, S., Yang, E., Cha, K.Y., Lanza, R., and Kim, K.S. 2009. Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell 4:472‐476.
   Lerou, P.H., Yabuuchi, A., Huo, H., Miller, J.D., Boyer, L.F., Schlaeger, T.M., and Daley, G.Q. 2008. Derivation and maintenance of human embryonic stem cells from poor‐quality in vitro fertilization embryos. Nat. Protocols 3:923‐933.
   Mays Hoopes, L.L. 2008. Nucleic acid blotting: Southern and northern. Curr. Protoc. Essential Lab. Techniq. 0:8.2.1‐8.2.24.
   Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T., and Yamanaka, S. 2008. Generation of mouse induced pluripotent stem cells without viral vectors. Science 322:949‐953.
   Park, I.H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A., Lensch, M.W., Cowan, C., Hochedlinger, K., and Daley, G.Q. 2008a. Disease‐specific induced pluripotent stem cells. Cell 134:877‐886.
   Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W., and Daley, G.Q. 2008b. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451:141‐6.
   Soldner, F., Hockemeyer, D., Beard, C., Gao, Q., Bell, G.W., Cook, E.G., Hargus, G., Blak, A., Cooper, O., Mitalipova, M., Isacson, O., and Jaenisch, R. 2009. Parkinson's disease patient‐derived induced pluripotent stem cells free of viral reprogramming factors. Cell 136:964‐977.
   Stadtfeld, M., Nagaya, M., Utikal, J., Weir, G., and Hochedlinger, K. 2008. Induced pluripotent stem cells generated without viral integration. Science 322:945‐949.
   Takahashi, K. and Yamanaka, S. 2006. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures with defined factors. Cell 4:663‐676.
   Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 5:861‐872.
   Tiscornia, G., Singer, O., and Verma, I.M. 2006. Production and purification of lentiviral vectors. Nat. Protocols 1:241‐245.
   Warren, L., Manos, P.D., Ahfeldt, T., Loh, Y.‐H., Li, H., Lau, F., Ebina, W., Mandal, P.K., Smith, Z.D., Meissner, A., Daley, G.Q., Brack, A.S., Collins, J.J., Cowan, C., Schlaeger, T.M., and Rossi, D.J. 2010. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7:618‐630.
   Woltjen, K., Michael, I.P., Mohseni, P., Desai, R., Mileikovsky, M., Hamalainen, R., Cowling, R., Wang, W., Liu, P., Gertsenstein, M., Kaji, K., Sung, H.K., and Nagy, A. 2009. Piggyback transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458:766‐770.
   Yu, Y. and Bradley, A. 2001. Engineering chromosomal rearrangements in mice. Nat. Rev. Genetics 2:780‐790.
   Yu, J., Vodyanik, M.A., Smuga‐Otto, K., Antosiewicz‐Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., Sluvkin, I.I., and Thomson, J.A. 2007. Induced pluripotent stem cells derived from human somatic cells. Science 318:1917‐1920.
   Yu, J., Hu, K., Smuga‐Otta, K., Tian, S., Stewart, R., Sluvkin, I.I., and Thomson, J.A. 2009. Human induced pluripotent stem cells free of vector and transgene sequences. Science 324:797‐801.
   Zhou, H., Wu, S., Joo, J.Y., Zhu, S., Han, D.W., Lin, T., Trauger, S., Bien, G., Yao, S., Zhu, Y., Siuzdak, G., Schöler, H.R., Duan, L., and Ding, S. 2009. Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell 4:381‐384.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library