Reprogramming of Pancreatic Acinar Cells to Functional Beta Cells by In Vivo Transduction of a Polycistronic Construct Containing Pdx1, Ngn3, MafA in Mice

C. Cavelti‐Weder1, A. Zumsteg2, W. Li3, Q. Zhou4

1 University Hospital of Basel, Department of Endocrinology, Diabetes, and Metabolism, Basel, 2 Covagen AG, Schlieren, 3 Translational Medical Center for Stem Cell Therapy and Institute for Regenerative Medicine, Shanghai East Hospital, Tongji University School of Life Sciences and Technology, Shanghai, 4 Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 4A.10
DOI:  10.1002/cpsc.21
Online Posting Date:  February, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

To generate new beta cells after birth is a key focus of regenerative medicine, which could greatly aid the major health burden of diabetes. Beta‐cell regeneration has been described using four different approaches: (1) the development of beta cells from putative precursor cells of the adult pancreas, which is termed neogenesis, (2) replication of existing beta cells, (3) differentiation from embryonic or induced pluripotent stem cells, and (4) reprogramming of non‐beta cells to beta cells. Studies from the authors’ laboratory have shown that beta‐cell reprogramming can be achieved by transduction of adult pancreatic tissues with viral constructs containing the three developmentally important transcription factors Pdx1, Ngn3, and MafA. This protocol outlines the generation of a polycistronic construct containing the three transcription factors, the expansion and purification of the polycistronic virus, and in vivo transduction for acinar to beta‐cell reprogramming in adult mice. The ultimate goal is to generate beta‐like cells that resemble as closely as possible endogenous beta cells in phenotype and function for potential translational applications. © 2017 by John Wiley & Sons, Inc.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Significance Statement
  • Introduction
  • Basic Protocol 1: Making Polycistronic Constructs
  • Basic Protocol 2: Viral Production and Purification
  • Basic Protocol 3: Surgical Procedure
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Making Polycistronic Constructs

  Materials
  • Gateway pENTR2B vector (Invitrogen)
  • Polycistronic sequence (synthesized by IDT) TCGACACTAGTGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCTGGATCCGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCTATCGATCAGTGTACTAATTATGCTCTCTTGAAATTGGCTGGAGATGTTGAGAGCAACCCAGGTCCCGC
  • Restriction enzymes and corresponding buffers
  • pAd/CMV/V5‐DEST Gateway Vector Kit (Invitrogen)
  • QIAEX II Gel Extraction Kit
  • KAPA High‐Fidelity DNA polymerase
  • T4 DNA ligase
  • Mouse cDNA
  • Agarose gel electrophoresis station
  • Heating block or incubator
  • Access to DNA sequencing service
Follow basic molecular biology protocols. As a template for the murine transcription factors, cDNA from reverse‐transcribed newborn mouse pancreas RNA is a good source. Primer sequences are available upon request.

Basic Protocol 2: Viral Production and Purification

  Materials
  • M3C fragment (see protocol 1)
  • ViraPower Adenoviral Expression System (Invitrogen), containing pAd/CMV/V5‐DEST adenoviral vector and an optimized 293A cell line
  • Pac I enzyme and buffer
  • Phenol/chloroform or QIAEX II Gel Extraction Kit (Qiagen)
  • Sterile water
  • 293A cell line complete growth medium (see recipe)
  • Opti‐MEM I medium (Gibco) with and without serum
  • Lipofectamine 2000 (Invitrogen)
  • Trypsin
  • Dry ice/ethanol bath
  • Vivapure Adenopack 100 (Sartorius)
  • Storage buffer (see recipe)
  • 6‐ and 24‐well cell culture plates
  • Fluorescence microscope
  • 10‐ and 15‐cm tissue culture plates
  • 10‐ml tissue culture pipettes
  • 15‐ml capped tubes
  • 37°C water bath
  • Tabletop centrifuge

Basic Protocol 3: Surgical Procedure

  Materials
  • Alcohol preps (Kendall)
  • Rag1−/− mice (B6.129S7‐Rag1<tm1Mom>/J)
  • Anesthesia (see recipe)
  • Betadine solution (Santa Cruz)
  • Adenovirus (see protocol 2)
  • Storage buffer (see recipe)
  • Banamine (Merck)
  • Animal balance
  • Shaver
  • 18‐ and 27‐G needles (BD)
  • 1‐ and 3/10‐ml syringes
  • Surgical gloves (sterile) and facemasks
  • Sterile surgical tools (stapler, staples, small scissors, and forceps)
  • Warming pads and Delta Phase operating board (Braintree Scientific)
  • Dissecting microscope (Leica stereo zoom 7)
  • Blue sterile tissues (IMCO)
  • Suture (5‐0 Chromic gut) (Butler Schein)
  • Sterile drape (IMCO)
  • Bead sterilizer (Fine Science Tool)
  • Heating lamp
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Al‐Hasani, K., Pfeifer, A., Courtney, M., Ben‐Othman, N., Gjernes, E., Vieira, A., Druelle, N., Avolio, F., Ravassard, P., Leuckx, G., Lacas‐Gervais, S., Ambrosetti, D., Benizri, E., Hecksher‐Sorensen, J., Gounon, P., Ferrer, J., Gradwohl, G., Heimberg, H., Mansouri, A., and Collombat, P. 2013. Adult duct‐lining cells can reprogram into beta‐like cells able to counter repeated cycles of toxin‐induced diabetes. Dev. Cell 26:86‐100. doi: 10.1016/j.devcel.2013.05.018.
  Ariyachet, C., Tovaglieri, A., Xiang, G., Lu, J., Shah, M.S., Richmond, C.A., Verbeke, C., Melton, D.A., Stanger, B.Z., Mooney, D., Shivdasani, R.A., Mahony, S., Xia, Q., Breault, D.T., and Zhou, Q. 2016. Reprogrammed stomach tissue as a renewable source of functional beta cells for blood glucose regulation. Cell Stem Cell 18:410‐421. doi: 10.1016/j.stem.2016.01.003.
  Baeyens, L., Lemper, M., Leuckx, G., De Groef, S., Bonfanti, P., Stange, G., Shemer, R., Nord, C., Scheel, D.W., Pan, F.C., Ahlgren, U., Gu, G., Stoffers, D.A., Dor, Y., Ferrer, J., Gradwohl, G., Wright, C.V., Van de Casteele, M., German, M.S., Bouwens, L., and Heimberg, H. 2014. Transient cytokine treatment induces acinar cell reprogramming and regenerates functional beta cell mass in diabetic mice. Nat. Biotechnol. 32:76‐83. doi: 10.1038/nbt.2747.
  Caiazzo, M., Dell'Anno, M.T., Dvoretskova, E., Lazarevic, D., Taverna, S., Leo, D., Sotnikova, T.D., Menegon, A., Roncaglia, P., Colciago, G., Russo, G., Carninci, P., Pezzoli, G., Gainetdinov, R.R., Gustincich, S., Dityatev, A., and Broccoli, V. 2011. Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature 476:224‐227. doi: 10.1038/nature10284.
  Cavelti‐Weder, C., Li, W., Weir, G.C., and Zhou, Q. 2014. Direct lineage conversion of pancreatic exocrine to endocrine beta cells in vivo with defined factors. Methods Mol. Biol. 1150:247‐262. doi: 10.1007/978‐1‐4939‐0512‐6_17.
  Cavelti‐Weder, C., Li, W., Zumsteg, A., Stemann‐Andersen, M., Zhang, Y., Yamada, T., Wang, M., Lu, J., Jermendy, A., Bee, Y.M., Bonner‐Weir, S., Weir, G.C., and Zhou, Q. 2015. Hyperglycaemia attenuates in vivo reprogramming of pancreatic exocrine cells to beta cells in mice. Diabetologia 59: 522. doi:10.1007/s00125‐015‐3838‐7
  Chen, Y.J., Finkbeiner, S.R., Weinblatt, D., Emmett, M.J., Tameire, F., Yousefi, M., Yang, C., Maehr, R., Zhou, Q., Shemer, R., Dor, Y., Li, C., Spence, J.R., and Stanger, B.Z. 2014. De novo formation of insulin‐producing “neo‐beta cell islets” from intestinal crypts. Cell Reports 6:1046‐1058. doi: 10.1016/j.celrep.2014.02.013.
  Chera, S., Baronnier, D., Ghila, L., Cigliola, V., Jensen, J.N., Gu, G., Furuyama, K., Thorel, F., Gribble, F.M., Reimann, F., and Herrera, P.L. 2014. Diabetes recovery by age‐dependent conversion of pancreatic delta‐cells into insulin producers. Nature 514:503‐507 doi:10.1038/nature13633
  Davis, R.L., Weintraub, H., and Lassar, A.B. 1987. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51:987‐1000. doi: 10.1016/0092‐8674(87)90585‐X.
  Ferber, S., Halkin, A., Cohen, H., Ber, I., Einav, Y., Goldberg, I., Barshack, I., Seijffers, R., Kopolovic, J., Kaiser, N., and Karasik, A. 2000. Pancreatic and duodenal homeobox gene 1 induces expression of insulin genes in liver and ameliorates streptozotocin‐induced hyperglycemia. Nat Med 6:568‐572. doi: 10.1038/75050.
  Ginsberg, M., James, D., Ding, B.S., Nolan, D., Geng, F., Butler, J.M., Schachterle, W., Pulijaal, V.R., Mathew, S., Chasen, S.T., Xiang, J., Rosenwaks, Z., Shido, K., Elemento, O., Rabbany, S.Y., and Rafii, S. 2012. Efficient direct reprogramming of mature amniotic cells into endothelial cells by ETS factors and TGFbeta suppression. Cell 151:559‐575. doi: 10.1016/j.cell.2012.09.032.
  Graf, T. 2011. Historical origins of transdifferentiation and reprogramming. Cell Stem Cell 9:504‐516. doi: 10.1016/j.stem.2011.11.012.
  Guo, Z., Zhang, L., Wu, Z., Chen, Y., Wang, F., and Chen, G. 2014. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell 14:188‐202. doi: 10.1016/j.stem.2013.12.001.
  Ieda, M., Fu, J.D., Delgado‐Olguin, P., Vedantham, V., Hayashi, Y., Bruneau, B.G., and Srivastava, D. 2010. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142:375‐386. doi: 10.1016/j.cell.2010.07.002.
  Lee, J., Sugiyama, T., Liu, Y., Wang, J., Gu, X., Lei, J., Markmann, J.F., Miyazaki, S., Miyazaki, J., Szot, G.L., Bottino, R., and Kim, S.K. 2013. Expansion and conversion of human pancreatic ductal cells into insulin‐secreting endocrine cells. eLife 2:e00940. doi: 10.7554/eLife.00940.
  Li, W., Nakanishi, M., Zumsteg, A., Shear, M., Wright, C., Melton, D.A., and Zhou, Q. 2014b. In vivo reprogramming of pancreatic acinar cells to three islet endocrine subtypes. eLife 3:e01846.
  Li, W., Cavelti‐Weder, C., Zhang, Y., Clement, K., Donovan, S., Gonzalez, G., Zhu, J., Stemann, M., Xu, K., Hashimoto, T., Yamada, T., Nakanishi, M., Zhang, Y., Zeng, S., Gifford, D., Meissner, A., Weir, G., and Zhou, Q. 2014a. Long‐term persistence and development of induced pancreatic beta cells generated by lineage conversion of acinar cells. Nat. Biotechnol. 32:1223‐1230. doi: 10.1038/nbt.3082.
  Pan, F.C., Bankaitis, E.D., Boyer, D., Xu, X., Van de Casteele, M., Magnuson, M.A., Heimberg, H., and Wright, C.V. 2013. Spatiotemporal patterns of multipotentiality in Ptf1a‐expressing cells during pancreas organogenesis and injury‐induced facultative restoration. Development 140:751‐764. doi: 10.1242/dev.090159.
  Sancho, R., Gruber, R., Gu, G., and Behrens, A. 2014. Loss of Fbw7 reprograms adult pancreatic ductal cells into alpha, delta, and beta cells. Cell Stem Cell 15:139‐153. doi: 10.1016/j.stem.2014.06.019.
  Song, K., Nam, Y.J., Luo, X., Qi, X., Tan, W., Huang, G.N., Acharya, A., Smith, C.L., Tallquist, M.D., Neilson, E.G., Hill, J.A., Bassel‐Duby, R., and Olson, E.N. 2012. Heart repair by reprogramming non‐myocytes with cardiac transcription factors. Nature 485:599‐604. doi: 10.1038/nature11139.
  Su, Z., Niu, W., Liu, M.L., Zou, Y., and Zhang, C.L. 2014. In vivo conversion of astrocytes to neurons in the injured adult spinal cord. Nat. Commun. 5:3338. doi: 10.1038/ncomms4338.
  Sumazaki, R., Shiojiri, N., Isoyama, S., Masu, M., Keino‐Masu, K., Osawa, M., Nakauchi, H., Kageyama, R., and Matsui, A. 2004. Conversion of biliary system to pancreatic tissue in Hes1‐deficient mice. Nat. Genet. 36:83‐87. doi: 10.1038/ng1273.
  Szymczak, A.L. and Vignali, D.A. 2005. Development of 2A peptide‐based strategies in the design of multicistronic vectors. Expert. Opin. Biol. Ther. 5:627‐638. doi: 10.1517/14712598.5.5.627.
  Talchai, C., Xuan, S., Kitamura, T., DePinho, R.A., and Accili, D. 2012. Generation of functional insulin‐producing cells in the gut by Foxo1 ablation. Nat. Genet. 44:406‐412. doi: 10.1038/ng.2215.
  Thorel, F., Nepote, V., Avril, I., Kohno, K., Desgraz, R., Chera, S., and Herrera, P.L. 2010. Conversion of adult pancreatic alpha‐cells to beta‐cells after extreme beta‐cell loss. Nature 464:1149‐1154. doi: 10.1038/nature08894.
  Vierbuchen, T. and Wernig, M. 2011. Direct lineage conversions: Unnatural but useful? Nat. Biotechnol. 29:892‐907. doi: 10.1038/nbt.1946.
  Vierbuchen, T., Ostermeier, A., Pang, Z.P., Kokubu, Y., Sudhof, T.C., and Wernig, M. 2010. Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463:1035‐1041. doi: 10.1038/nature08797.
  Zhou, Q. and Melton, D.A. 2008. Extreme makeover: Converting one cell into another. Cell Stem. Cell 3:382‐388. doi: 10.1016/j.stem.2008.09.015.
  Zhou, Q., Brown, J., Kanarek, A., Rajagopal, J., and Melton, D.A. 2008. In vivo reprogramming of adult pancreatic exocrine cells to beta‐cells. Nature 455:627‐632. doi: 10.1038/nature07314.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library