Heterokaryon‐Based Reprogramming for Pluripotency

Carlos Filipe Pereira1, Amanda G. Fisher1

1 Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 4B.1
DOI:  10.1002/9780470151808.sc04b01s9
Online Posting Date:  April, 2009
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Embryonic stem (ES) cells have the ability to self‐renew, execute multiple lineage paths, and dominantly reprogram differentiated cells upon cell fusion. Here, we describe an approach that reprograms human B lymphocytes toward pluripotency by generating inter‐species heterokaryons with mouse ES cells. This induces a human ES‐specific gene expression profile, in which the extent and the rapidity of conversion allows us to compare the capacity of different mouse ES cell lines to dominantly induce pluripotency. This approach, coupled with pharmacological inhibition, gene knock‐out, or knock‐down permits factors that are required to directly induce reprogramming to be defined individually, as well as in combination. Experimental heterokaryons provide a simple and tractable approach to address the mechanisms underlying direct reprogramming to pluripotency. The procedure requires 5 days to complete. Curr. Protoc. Stem Cell Biol. 9:4B.1.1‐4B.1.14. © 2009 by John Wiley & Sons, Inc.

Keywords: reprogramming; embryonic stem (ES) cell; pluripotency; cell fusion; heterokaryon

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Generation of Inter‐Species Heterokaryons Between Human B Lymphocytes and Mouse ES Cells
  • Alternate Protocol 1: Generation and Analysis of Inter‐Species Heterokaryons Without FACS Sorting
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of Inter‐Species Heterokaryons Between Human B Lymphocytes and Mouse ES Cells

  Materials
  • Epstein‐Barr virus (EBV)–transformed human B cell clones
  • Human B cell medium (hB cell medium; see recipe)
  • Mouse ES/heterokaryon medium (see recipe)
  • Mouse ES cells cultured on gelatin‐coated dishes or using mouse embryonic fibroblasts (MEFs) as feeder layers (unit 1.4)
  • Mitotically inactivated MEFs (unit 1.3)
  • 50% (w/v) Polyethylene glycol (PEG) 1500 in 75 mM HEPES, pH 8.0 (Roche, cat. no. 10783641001)
  • Knockout (KO) Dulbecco's Modified Eagle's Medium (KO‐DMEM; Invitrogen, cat. no. 10829‐018)
  • Calcium‐ and magnesium‐free phosphate‐buffered saline without (CMF‐PBS; Invitrogen, cat. no. 14190‐094)
  • 0.05% (w/v) trypsin/EDTA (Invitrogen, cat. no. 25300‐054)
  • Vybrant multicolor cell‐labeling kit (Molecular Probes, cat. no. V22889) containing:
    • 1,1′‐dioctadecyl‐3,3,3′,3′‐tetramethylindodicarbocyanine (DiD) cell labeling solution
    • 1,1′‐dioctadecyl‐3,3,3′,3′‐tetramethylindocarbocyanine perchlorate (DiI) cell labeling solution
  • Leukemia inhibitory factor (LIF; Esgro, Chemicon/Millipore, cat. no. ESG1107)
  • Liquid N 2
  • Mouse monoclonal anti–human LaminA/C (Vector, cat. no. VP‐L550), optional
  • Vectashield with DAPI (0.1 µg/ml; Vector, cat. no. H‐1200), optional
  • Alexa Fluor 568 phalloidin (Molecular Probes, cat. no. A12380), optional
  • FACS buffer (see recipe)
  • RNA‐BEE RNA isolation solvent (AMS Biotechnology, cat. no. CS‐501B)
  • DEPC‐treated water (Ambion, cat. no. 9915G)
  • TURBO DNA‐free kit (Ambion, cat. no. 1907)
  • Superscript first‐strand synthesis system (Invitrogen, cat. no. 18080‐085) containing:
    • First‐strand buffer
    • Superscript III
  • 10 mM dNTP mix (Invitrogen, cat. no. 18427‐013)
  • Oligo (dT) 12‐18 primers (Invitrogen, cat. no. 18418‐012)
  • RNaseOUT (Invitrogen, cat. no. 10777‐019)
  • SYBR Green Master Mix (Qiagen, cat. no. 204145)
  • Human gene‐specific primers (see Table 4.1.1)
  • 175‐cm2 tissue culture flasks
  • Gelatin‐coated 90‐mm tissue culture dishes (see recipe)
  • 37°C water bath
  • 37°C, 5% CO 2 incubator
  • 10‐ml pipet
  • 50‐ and 15‐ml conical tubes (BD Falcon)
  • Hemacytometer
  • Conical 30‐ml universal tubes (Sterilin, cat. no. 128A)
  • Pasteur pipets
  • 70‐µm cell strainer (BD Falcon, cat. no. 352350)
  • 5‐ml polystyrene round‐bottom tubes (BD Falcon, cat. no. 352054)
  • FACS DiVa cell sorter (Becton Dickinson) or similar
  • Nanodrop ND‐1000 spectrophotometer
  • Dyad DNA engine
  • 96‐well plates for PCR (Bio‐Rad, cat. no. MLL‐9651)
  • Real‐time PCR engine (MJ research Chromo4)
  • Additional reagents and equipment for counting cells using a hemacytometer (unit 1.3), growing mouse ES cell culture on feeders (unit 1.4), for mitotically inactive mouse embryonic fibroblasts (unit 1.3), for RNA extraction (Kingston et al., ), and for RT‐PCR (Giulietti et al., )
    Table 4.0.1   Materials   Human Gene‐Specific Primers for qRT‐PCR Analysis a   Human Gene‐Specific Primers for qRT‐PCR Analysis

    Species/Gene Accession number Sequence 5′‐3′
    hGapdh NM_002046 s TCTGCTCCTCCTGTTCGACA
    as AAAAGCAGCCCTGGTGACC
    hHprt NM_000194 s TCCTTGGTCAGGCAGTATAATCC
    as GTCAAGGGCATATCCTACAACAAA
    hOct4 NM_002701 s TCGAGAACCGAGTGAGAGGC
    as CACACTCGGACCACATCCTTC
    hNanog NM_024865 s CCAACATCCTGAACCTCAGCTAC
    as GCCTTCTGCGTCACACCATT
    hCripto NM_003212 s AGAAGTGTTCCCTGTGTAAATGCTG
    as CACGAGGTGCTCATCCATCA
    hDnmt3b NM_006892 s GTCAAGCTACACACAGGACTTGACAG
    as AGTTCGGACAGCTGGGCTTT
    hTert NM_198253 s GCCAGCATCATCAAACCCC
    as CTGTCAAGGTAGAGACGTGGCTC
    hTle1 NM_005077 s TGTCTCCCAGCTCGACTGTCT
    as AAGTACTGGCTTCCCCTCCC
    hSox2 NM_003106 s CACACTGCCCCTCTCACACAT
    as CATTTCCCTCGTTTTTCTTTGAA
    hRex1 NM_174900 s GCGTACGCAAATTAAAGTCCAGA
    as CAGCATCCTAAACAGCTCGCAGAAT
    hCD37 NM_001774 s GTGGCTGCACAACAACCTTATTT
    as GCCTAACGGTATCGAGCGAG
    hCD19 NM_001770 s GCTCAAGACGCTGGAAAGTATTATT
    as GATAAGCCAAAGTCACAGCTGAGA
    hCD45 NM_002838 s CCCCATGAACGTTACCATTTG
    as GATAGTCTCCATTGTGAAAATAGGCC

     aAdapted from Pereira et al., .
NOTE: The following procedures (steps 1 to 36) are performed in a Class II biological hazard flow hood or a laminar‐flow hood. All solutions and equipment coming into contact with live cells must be sterile, and proper aseptic technique should be used accordingly.

Alternate Protocol 1: Generation and Analysis of Inter‐Species Heterokaryons Without FACS Sorting

  • Ara‐C (cytosine β‐D‐arabinofuranoside, Sigma, cat. no. C‐1768)
  • Ouabain (G‐Strophanthin; Sigma, cat. no. O‐3125)
  • HAT (20 µM hypoxanthine, 0.08 µM aminopterine and 3.2 µM thymidine) media supplement (Sigma, cat. no. H0262‐10VL), optional
  • Puromycin (Sigma, cat. no. P9620), optional
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Cowan, C.A., Atienza, J., Melton, D.A., and Eggan, K. 2005. Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells. Science 309:1369‐1373.
   Giulietti, A., Overbergh, L., Valckx, D., Decallonne, B., Bouillon, R., and Mathieu, C. 2001. An overview of real‐time quantitative PCR: Applications to quantify cytokine gene expression. Methods 25:386‐401.
   Hochedlinger, K. and Jaenisch, R. 2006. Nuclear reprogramming and pluripotency. Nature 441:1061‐1067.
   Hooper, M., Hardy, K., Handyside, A., Hunter, S., and Monk, M. 1987. HPRT‐deficient (Lesch‐Nyhan) mouse embryos derived from germline colonization by cultured cells. Nature 326:292‐295.
   Jaenisch, R. and Young, R. 2008. Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132:567‐582.
   Kingston, R.E., Chomczynski, P., and Sacchi, N. 1996. Guanidine methods for total RNA preparation. Curr. Protoc. Mol. Biol. 36:4.2.1‐4.2.9.
   Niwa, H., Miyazaki, J., and Smith, A.G. 2000. Quantitative expression of Oct‐3/4 defines differentiation, dedifferentiation or self‐renewal of ES cells. Nat. Genet. 24:372‐376.
   Pereira, C.F., Terranova, R., Ryan, N.K., Santos, J., Morris, K.J., Cui, W., Merkenschlager, M., and Fisher, A.G. 2008. Heterokaryon‐based reprogramming of human B lymphocytes for pluripotency requires Oct4 but not Sox2. PLoS Genet. 4:e1000170.
   Silva, J., Chambers, I., Pollard, S., and Smith, A. 2006. Nanog promotes transfer of pluripotency after cell fusion. Nature 441:997‐1001.
   Stadtfeld, M., Maherali, N., Breault, D.T., and Hochedlinger, K. 2008. Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse. Cell Stem Cell 2:230‐240.
   Tada, M., Tada, T., Lefebvre, L., Barton, S.C., and Surani, M.A. 1997. Embryonic germ cells induce epigenetic reprogramming of somatic nucleus in hybrid cells. EMBO J. 16:6510‐6520.
   Tada, M., Takahama, Y., Abe, K., Nakatsuji, N., and Tada, T. 2001. Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr. Biol. 11:1553‐1558.
   Terranova, R., Pereira, C.F., Du Roure, C., Merkenschlager, M., and Fisher, A.G. 2006. Acquisition and extinction of gene expression programs are separable events in heterokaryon reprogramming. J. Cell Sci. 119:2065‐2072.
   Weimann, J.M., Johansson, C.B., Trejo, A., and Blau, H.M. 2003. Stable reprogrammed heterokaryons form spontaneously in Purkinje neurons after bone marrow transplant. Nat. Cell Biol. 5:959‐966.
   Yamanaka, S. 2007. Strategies and new developments in the generation of patient‐specific pluripotent stem cells. Cell Stem Cell 1:39‐49.
   Ying, Q.L., Nichols, J., Evans, E.P., and Smith, A.G. 2002. Changing potency by spontaneous fusion. Nature 416:545‐548.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library