Generation of GFP Reporter Human Induced Pluripotent Stem Cells Using AAVS1 Safe Harbor Transcription Activator‐Like Effector Nuclease

Yongquan Luo1, Mahendra Rao1, Jizhong Zou1

1 NIH Center for Regenerative Medicine, Laboratory of Stem Cell Biology, National Institute of Arthritis, Musculoskeletal and Skin Diseases, National Institutes of Medicine, Bethesda, Maryland
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 5A.7
DOI:  10.1002/9780470151808.sc05a07s29
Online Posting Date:  May, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Generation of a fluorescent GFP reporter line in human induced pluripotent stem cells (hiPSCs) provides enormous potentials in both basic stem cell research and regenerative medicine. A protocol for efficiently generating such an engineered reporter line by gene targeting is highly desired. Transcription activator‐like effector nucleases (TALENs) are a new class of artificial restriction enzymes that have been shown to significantly promote homologous recombination by >1000‐fold. The AAVS1 (adeno‐associated virus integration site 1) locus is a “safe harbor” and has an open chromatin structure that allows insertion and stable expression of transgene. Here, we describe a step‐by‐step protocol from determination of TALENs activity, hiPSC culture, and delivery of a donor into AAVS1 targeting site, to validation of targeted integration by PCR and Southern blot analysis using hiPSC line, and a pair of open‐source AAVS1 TALENs. Curr. Protoc. Stem Cell Biol. 29:5A.7.1‐5A.7.18. © 2014 by John Wiley & Sons, Inc.

Keywords: gene targeting; transcription activator‐like effector nucleases (TALENs); adeno‐associated virus integration site 1 (AAVS1); induced pluripotent stem cells (iPSCs); reporter cell line

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: T7 Endonuclease I NHEJ Assay
  • Basic Protocol 2: Targeting AAVS1 Locus of hIPSCS with AAVS1‐TALENs and an EGFP Reporter Donor
  • Support Protocol 1: PCR Screening and Southern Blot Confirmation of AAVS1‐Targeted Integration
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: T7 Endonuclease I NHEJ Assay

  Materials
  • 293T cells (ATCC #CRL‐11268)
  • Dulbecco's modified Eagle medium (DMEM; Invitrogen, cat. no. 11885‐084)
  • Fetal bovine serum (FBS; HyClone, cat. no. SH30070.03)
  • 0.25% trypsin‐EDTA (Invitrogen, cat. no. 25200‐056)
  • SF cell line 4D‐nucleofector X kit (Lonza, cat. no. V4XC‐2012)
  • AAVS1‐TALEN plasmids (System Biosciences, cat. no. GE601A‐1; Addgene, cat. nos. 52637 and 52638)
  • DNeasy Blood and Tissue kit (Qiagen, cat. no. 69506)
  • PCR primers:
    • AAVS1CEL‐F: 5′‐TTCGGGTCACCTCTCACTCC;
    • AAVS1CEL‐R: 5′‐GGCTCCATCGTAAGCAAACC
    • Custom oligos, IDT
  • Phusion Hot Start II high‐fidelity DNA polymerase (Thermo Scientific, cat. no. F549s) containing:
    • 5× Phusion HF buffer
  • 10 mM dNTPs
  • Sterile water
  • 1% agarose gel
  • QIAquick PCR purification kit (Qiagen, cat. no. 28104)
  • T7 endoneuclease I (New England BioLabs, cat. no. M0302L) containing:
    • NEB buffer 2
  • 0.5 M EDTA, pH 8.0 (Mediatech, cat. no. 46‐034‐CI)
  • 6‐well plates
  • 37°C, 5% incubator
  • 15‐ml tubes
  • Centrifuge
  • 4D‐nucleofector system (4D‐nucleofector core unit and 4D‐nucleofector X unit)
  • PCR thermal cycler
  • Gel electrophoresis appartus
  • UV imaging station (e.g., ChemiDoc XRS+)

Basic Protocol 2: Targeting AAVS1 Locus of hIPSCS with AAVS1‐TALENs and an EGFP Reporter Donor

  Materials
  • Matrigel (BD Bioscience, cat. no. 354230)
  • hiPSCs (WiCell, cat. no. MIRJT7i‐mND2‐0)
  • 0.1% Gelatin (Millipore, cat. no. SF008)
  • Dulbecco's phosphate‐buffered saline (D‐PBS; Life Technologies, cat. no. 14190‐144)
  • DR4 MEF 2M IRR cells (GlobalStem, cat. no. GSC‐6204G)
  • MEF medium (see recipe)
  • Essential 8 (E8) medium (prototype) (Life Technologies, cat. no. A14666SA)
  • StemPro Accutase (Life Technologies, cat. no. A11105‐01)
  • P3 Primary Cell 4D‐Nucleofector X kit L (Lonza, cat. no. V4XP‐3024) containing:
    • P3 Nucleofection solution
    • X unit cuvette
  • AAV‐CAGGS‐EGFP donor plasmid (Addgene, cat. no. 22212)
  • AAVS1‐TALEN plasmids (System Biosciences, cat. no. GE601A‐1; Addgene, cat. nos. 52637 and 52638)
  • Y27632 dihydrochloride (see recipe)
  • NutriStem XF/FF culture medium (Stemgnet, cat. no. 01‐0005)
  • Puromycin
  • 0.5 M EDTA dissociation buffer (see recipe)
  • CryStor CS10 (Stemcell, cat. no. 7930)
  • Liquid nitrogen
  • 6‐well plates
  • 37°C incubator
  • Centrifuge
  • Hemacytometer
  • 4D‐Nucleofector system (4D‐Nucleofector core unit and 4D‐Nucleofector X unit, Lonza)
  • 96‐well plates
  • 1.5‐ml microcentrifuge tubes
  • Fluorescent microscope with object marker mounted on an objective lens turret (e.g., Leica DMI3000B)
  • Dissection microscope
  • 10‐µl pipet tips
  • 24‐well plates
  • Additional reagents and equipment for performing PCR screening ( protocol 3Support Protocol)

Support Protocol 1: PCR Screening and Southern Blot Confirmation of AAVS1‐Targeted Integration

  Materials
  • PCR Screening plate (see the Basic Protocol)
  • DNeasy Blood and Tissue kit (Qiagen, cat. no. 69506)
  • Platinum Taq DNA polymerase (Invitrogen, cat. no. 10966‐034) containing:
    • 10× Platinum Taq buffer
    • 50 mM MgCl 2
  • dNTPs
  • 5′‐junction PCR primers (5′‐F: 5′‐CTGCCGTCTCTCTCCTGAGT; 5′‐R: 5′‐GTGGGCTTGTACTCGGTCAT, Custom oligos, IDT)
  • Internal AAVS1 probe primers (AAVS1pb‐F: 5′‐GGCCTGGGTCACCTCTACG; AAVS1pb‐R: 5′‐GAACCAGAGCCACATTAACCG, Custom oligos, IDT)
  • Distilled water
  • 5× DNA gel loading solution (Quality Biological, cat. no. 351‐028‐661)
  • 1% agarose gel
  • 1× TAE buffer
  • PCR DIG probe synthesis kit (Roche, cat. no. 11636090910)
  • DNA molecular weight marker II, digoxigenin‐labeled (Roche, cat. no. 11218590910)
  • Denaturing solution (KD Medical, cat. no. RGF‐3030)
  • Neutralizing solution (KD Medical, cat. no. RGF‐3180)
  • 20× SSC (KD Medical, cat. no. RGF‐3240)
  • DIG Easy Hyb granules (Roche Applied Science, cat. no. 11796895001)
  • DIG wash and block buffer set (Roche Applied Science, cat. no. 11585762001) containing:
    • 10× blocking solution
    • 10× maleic acid
    • Detection buffer
  • Anti‐digoxigenin‐AP, Fab fragments (Roche, cat. no. 11093274910)
  • CSPD ready‐to‐use disodium 3‐(4‐methoxyspiro {1,2‐dioxetane‐3,2′‐(5′‐chloro)tricyclo [3.3.1.13,7]decan}‐4‐yl)phenyl phosphate (Roche, cat. no. 11755633001)
  • 0.2 N NaOH
  • Veriti thermal cycler system (Life Technologies)
  • Whatman 3 MM paper
  • Large container
  • Nylon membrane, positively charged (Roche, cat. no. 11209272001)
  • Whatman Reaction Folders (Capital Scientific, cat. no. 10483064)
  • Hybridization tube or bag
  • HL‐2000 HybriLinker hybridization oven/UV crosslinker (UVP, LLC)
  • Stuart SSL 3Gyro Rocker (Bibby Scientific)
  • Luminescent imager (e.g., ChemiDoc XRS+) or X‐ray film
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Boch, J. and Bonas, U. 2010. Xanthomonas AvrBs3 family‐type III effectors: Discovery and function. Annu. Rev. Phytopathol. 48:419‐436.
  Burgess‐Beusse, B., Farrell, C., Gaszner, M., Litt, M., Mutskov, V., Recillas‐Targa, F., Simpson, M., West, A. and Felsenfeld, G. 2002. The insulation of genes from external enhancers and silencing chromatin. Proc. Natl. Acad. Sci. U.S.A. 99:16433‐16437.
  Deacon, T., Dinsmore, J., Costantini, L.C., Ratliff, J. and Isacson, O. 1998. Blastula‐stage stem cells can differentiate into dopaminergic and serotonergic neurons after transplantation. Exp. Neurol. 149:28‐41.
  Deng, D., Yan, C., Pan, X., Mahfouz, M., Wang, J., Zhu, J.K., Shi, Y. and Yan, N. 2012. Structural basis for sequence‐specific recognition of DNA by TAL effectors. Science 335:720‐723.
  Gross, D.S. and Garrard, W.T. 1988. Nuclease hypersensitive sites in chromatin. Annu. Rev. Biochem. 57:159‐197.
  Hamaguchi, I., Woods, N.B., Panagopoulos, I., Andersson, E., Mikkola, H., Fahlman, C., Zufferey, R., Carlsson, L., Trono, D. and Karlsson, S. 2000. Lentivirus vector gene expression during ES cell‐derived hematopoietic development in vitro. J. Virol. 74:10778‐10784.
  Hentze, H., Graichen, R. and Colman, A. 2007. Cell therapy and the safety of embryonic stem cell‐derived grafts. Trends Biotechnol. 25:24‐32.
  Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J.C., Zeitler, B., Cherone, J.M., Meng, X., Hinkley, S.J., Rebar, E.J., Gregory, P.D., Urnov, F.D. and Jaenisch, R. 2011. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29:731‐734.
  Lamartina, S., Sporeno, E., Fattori, E. and Toniatti, C. 2000. Characteristics of the adeno‐associated virus preintegration site in human chromosome 19: Open chromatin conformation and transcription‐competent environment. J. Virol. 74:7671‐7677.
  Mak, A.N., Bradley, P., Cernadas, R.A., Bogdanove, A.J. and Stoddard, B.L. 2012. The crystal structure of TAL effector PthXo1 bound to its DNA target. Science 335:716‐719.
  Ogata, T., Kozuka, T. and Kanda, T. 2003. Identification of an insulator in AAVS1, a preferred region for integration of adeno‐associated virus DNA. J. Virol. 77:9000‐9007.
  Rao, M.S. and Malik, N. 2012. Assessing iPSC reprogramming methods for their suitability in translational medicine. J. Cell Biochem. 113:3061‐3068.
  Smith, J.R., Maguire, S., Davis, L.A., Alexander, M., Yang, F., Chandran, S., Ffrench‐Constant, C. and Pedersen, R.A. 2008. Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1‐targeted integration. Stem Cells 26:496‐504.
  Sun, N., Liang, J., Abil, Z. and Zhao, H. 2012. Optimized TAL effector nucleases (TALENs) for use in treatment of sickle cell disease. Mol. Biosyst. 8:1255‐1263.
  Walia, B., Satija, N., Tripathi, R.P. and Gangenahalli, G.U. 2012. Induced pluripotent stem cells: fundamentals and applications of the reprogramming process and its ramifications on regenerative medicine. Stem Cell Rev. 8:100‐115.
  Zou, J., Maeder, M.L., Mali, P., Pruett‐Miller, S.M., Thibodeau‐Beganny, S., Chou, B.K., Chen, G., Ye, Z., Park, I.H., Daley, G.Q., Porteus, M.H., Joung, J.K. and Cheng, L. 2009. Gene targeting of a disease‐related gene in human induced pluripotent stem and embryonic stem cells. Cell Stem Cell 5:97‐110.
  Zou, J., Sweeney, C.L., Chou, B.K., Choi, U., Pan, J., Wang, H., Dowey, S.N., Cheng, L. and Malech, H.L. 2011. Oxidase‐deficient neutrophils from X‐linked chronic granulomatous disease iPS cells: Functional correction by zinc finger nuclease‐mediated safe harbor targeting. Blood 117:5561‐5572.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library