TALEN‐ and CRISPR/Cas9‐Mediated Gene Editing in Human Pluripotent Stem Cells Using Lipid‐Based Transfection

William T. Hendriks1, Xin Jiang2, Laurence Daheron2, Chad A. Cowan3

1 Department of Neurology, Massachusetts General Hospital, Harvard Medical School, Boston, Massachusetts, 2 Harvard University, Department of Stem Cell and Regenerative Biology and Harvard Stem Cell Institute, Cambridge, Massachusetts, 3 Center for Regenerative Medicine, Massachusetts General Hospital, Boston, Massachusetts
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 5B.3
DOI:  10.1002/9780470151808.sc05b03s34
Online Posting Date:  August, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Using custom‐engineered nuclease‐mediated genome editing, such as Transcription Activator–Like Effector Nucleases (TALENs) and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) RNA‐guided Cas9 nucleases, human pluripotent stem cell (hPSC) lines with knockout or mutant alleles can be generated and differentiated into various cell types. This strategy of genome engineering in hPSCs will prove invaluable for studying human biology and disease. Here, we provide a detailed protocol for design and construction of TALEN and CRISPR vectors, testing of their nuclease activity, and delivery of TALEN or CRISPR vectors into hPSCs. In addition, we describe the use of single‐stranded oligodeoxynucleotides (ssODNs) to introduce or repair point mutations. Next, we describe the identification of edited hPSC clones without antibiotic selection, including their clonal selection, genotyping, and expansion for downstream applications. © 2015 by John Wiley & Sons, Inc.

Keywords: TALEN; CRISPR/Cas9; gene editing; pluripotent stem cells; transfection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Cloning and Isolation of TALEN Plasmids
  • Alternate Protocol 1: Cloning and Isolation of CRISPR/Cas9 Plasmids
  • Support Protocol 1: Design and Preparation of a Knock‐In ssODN
  • Basic Protocol 2: CEL‐I Nuclease (Surveyor) DNA Mismatch Cleavage Assay
  • Basic Protocol 3: Transfection and Single‐Cell Cloning of hPSCs
  • Basic Protocol 4: Isolation and Screening of Clonal Genome Edited hPSC Lines
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cloning and Isolation of TALEN Plasmids

  Materials
  • TALE array tri‐ and tetramer plasmids, bacterial stab cultures (Addgene, plasmid ID 42963‐43794); these tri‐ and tetramer plasmids are also available as a kit (Addgene, cat no. 1000000034)
  • LB agar plates and liquid medium (see reciperecipes) containing 50 μg/ml kanamycin
  • Plasmid DNA Mini Kit (Qiagen, cat. no. 12125)
  • BsmBI restriction endonuclease (New England Biolabs, cat. no. R0580 or Thermo Fisher Scientific, cat. no. ER0451) and 10× digestion buffer
  • Agarose gel extraction kit (Qiagen, cat. no. 28704)
  • TALEN backbones:
    • pTAL_GFP plasmid, bacterial stab culture (Addgene, plasmid ID 43858)
    • pTAL_RFP plasmid, bacterial stab culture (Addgene, plasmid ID 43859)
  • LB agar plates and liquid medium (see reciperecipes) containing 100 μg/ml ampicillin
  • Endotoxin‐free HiSpeed Plasmid DNA Maxi Kit (Qiagen, cat. no. 12362)
  • NEBuffer 3 (New England Biolabs)
  • DNA dephosphorylation enzyme—e.g., calf intestine phosphatase (CIP; New England Biolabs, cat. no. M0290) or Antarctic phosphatase (New England Biolabs, cat. no. M0289)—and 10× phosphatase reaction buffer
  • Stop solution (EDTA solution) from Surveyor Mutation Detection Kit (IDT, cat. no. 706020) 0.1 M EDTA
  • 25:24:1 phenol:chloroform:isoamyl alcohol, (Sigma‐Aldrich, cat. no. P2069)
  • T4 DNA ligase (New England Biolabs, cat. no. M0202) and 10× ligase buffer
  • Competent E. coli bacterial cells (e.g., DH5α, XL10)
  • SOC medium (see recipe)
  • BamHI restriction endonuclease (New England Biolabs, cat. no. R0136) and 10× digestion buffer
  • XbaI restriction endonuclease (New England Biolabs, cat. no. R0145) and 10× digestion buffer
  • pTAL forward sequencing primer (5′‐GGCCAGTTGCTGAAGATCG‐3′) and pTAL reverse sequencing primer (5′‐CGCTACAAGATGATCATTAGTG‐3′)
  • Sterile pipet tips or toothpicks for picking colonies from agar plates
  • Incubator with shaker
  • 42° and 75°C water baths or heat blocks
  • DNA sequence analysis software (e.g., Geneious, NCBI BLAST)
  • Access to Sanger sequencing facility
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and DNA sequencing (Shendure et al., )

Alternate Protocol 1: Cloning and Isolation of CRISPR/Cas9 Plasmids

  Materials
  • pCas9_GFP plasmid, bacterial stab culture (Addgene, plasmid ID 44719)
  • LB agar plates and liquid medium (see reciperecipes) containing 100 μg/ml ampicillin
  • Endotoxin free HiSpeed Plasmid DNA Maxi Kit (Qiagen, cat. no. 12362)
  • Oligonucleotides containing BbsI 5′ overhangs and gRNA sequence (order from, e.g., IDT or Eurofins MWG Operon):
  • 10× PCR buffer for oligo annealing reactions (10× standard PCR Taq PCR buffer; New England Biolabs, cat. no. B9014)
  • pSPgRNA cloning plasmid vector, bacterial stab culture (Addgene, plasmid ID 47108)
  • Plasmid DNA Mini Kit (Qiagen, cat. no. 12125)
  • BbsI restriction endonuclease (New England Biolabs, cat. no. R0539 or Thermo Fisher Scientific, cat. no. ER1011) and 10× digestion buffer
  • DNA dephosphorylation enzyme—e.g., calf intestine phosphatase (CIP; New England Biolabs, cat. no. M0290) or Antarctic phosphatase (New England Biolabs, cat. no. M0289)—and 10× phosphatase reaction buffer
  • Agarose gel extraction kit (Qiagen, cat. no. 28704)
  • 40% (w/v) polyethylene glycol (PEG)
  • T4 DNA ligase (New England Biolabs, cat. no. M0202) and 10× T4 ligase buffer
  • Competent E. coli bacterial cells (e.g., DH5α, XL10)
  • SOC medium (see recipe)
  • EcoRI restriction endonuclease (New England Biolabs, cat. no. R0101) and 10× digestion buffer
  • M13 forward sequencing primer (5′‐GTAAAACGACGGCCAG‐3′)
  • M13 reverse sequencing primer (5′‐CAGGAAACAGCTATGAC‐3′)
  • Sterile pipet tips or toothpicks for picking colonies from agar plates
  • Incubator with shaker
  • DNA sequence analysis software (e.g., Geneious, NCBI BLAST)
  • 42°, 65°, and 95°C heat block
  • Access to Sanger sequencing facility
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and DNA sequencing (Shendure et al., )

Support Protocol 1: Design and Preparation of a Knock‐In ssODN

  Materials
  • Single‐stranded oligodeoxynucleotide, 120 to 200 nt long (e.g., IDT or Eurofins MWG Operon)

Basic Protocol 2: CEL‐I Nuclease (Surveyor) DNA Mismatch Cleavage Assay

  Materials
  • HEK293T cells (ATCC or Life Technologies)
  • DMEM/10% FBS: high‐glucose DMEM medium (Life Technologies, cat. no. 11960‐44) containing 10% fetal bovine serum (Seradigm, cat. no. 1600‐500)
  • TALEN plasmids ( protocol 1) or CRISPR/Cas9 plasmids ( protocol 2Alternate Protocol)
  • Lipofectamine 2000 (Life Technologies, cat. no. 11668‐027)
  • Opti‐MEM medium (Life Technologies, cat. no. 11965‐092)
  • DNeasy Blood and Tissue Kit (Qiagen)Herculase II Fusion DNA Polymerase (Agilent, cat. no. 600675) and 5× Herculase II PCR buffer
  • GeneAmp dNTP Blend (2.5 mM each dNTP; Life Technologies, cat. no. N8080260)
  • 10 μmol/μl forward and reverse oligonucleotide primers designed to amplify a 300‐ to 600‐base‐pair fragment of the targeted region of interest
  • DMSO (Sigma, cat. no. D9170; optional)
  • Low DNA Mass Ladder (Life Technologies, cat. no. 10068013)
  • Surveyor Mutation Detection Kit (IDT, cat. no. 706020)
  • 10% Mini‐PROTEAN TBE Gel (BioRad, cat. no. 456‐5035)
  • TBE buffer (see recipe)
  • Genomic DNA extraction kit (Qiagen, cat. no. 69504)
  • 6‐well culture plates
  • Refrigerated centrifuge
  • Thermal cycler
  • ImageJ software (NIH)
  • Mini‐PROTEAN Tetra Cell (BioRad, cat. no. 165‐8004)
  • UV transilluminator and gel scanner
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and the polymerase chain reaction (PCR; Kramer and Coen, )

Basic Protocol 3: Transfection and Single‐Cell Cloning of hPSCs

  Materials
  • Matrigel, hESC qualified (Corning, cat. no. 354277) or Geltrex, hESC qualified (Life Technologies, cat. no. A1413302)
  • DMEM/F12 medium (Life Technologies, cat. no. 11330‐032)
  • Feeder‐free hPSCs: HUES‐64 and BjRiPS (HSCI iPS Core; http://stemcelldistribution.harvard.edu)
  • mTeSR1 stem cell medium for feeder‐free culture (Stem Cell Technologies, cat. no. 05850)
  • 10 mM (3.3 mg/ml) stock solution of Rho Kinase (ROCK) Inhibitor Y‐27632 (Tocris, cat. no. 1254)
  • Dulbecco's phosphate‐buffered saline without calcium or magnesium (CMF‐DPBS; Life Technologies, cat. no. 14190‐144)
  • Accutase (Stemcell Technologies, cat. no. 07920)
  • P3000 reagent (Life Technologies, product code 100022059)
  • Lipofectamine 3000 (Life Technologies, cat. no. L3000‐008)
  • TALEN plasmid pair (see protocol 1) or CRISPR/Cas9‐GFP plasmids (see protocol 2Alternate Protocol)
  • Opti‐MEM medium (Life Technologies, cat. no. 11965‐092)
  • ssODN containing SNP of interest (optional: See protocol 3Support Protocol)
  • MycoZap (Lonza, cat. no. VZA‐2011)
  • Post‐FACS recovery medium (see recipe)
  • 6‐well tissue culture plates
  • 15‐ml conical centrifuge tubes (e.g., Corning Falcon)
  • Centrifuge
  • 35‐μm mesh cell strainer
  • BDFACSAria II (BD Biosciences) with 100‐μm nozzle
  • Additional reagents and equipment for counting cells (UNIT 1.3; Michalska, ) and fluorescence‐activated cell sorting (FACS; Robinson et al., )

Basic Protocol 4: Isolation and Screening of Clonal Genome Edited hPSC Lines

  Materials
  • Single cell–derived (clonal) hPSC lines cultured feeder‐free in 10‐cm plates ( protocol 5)
  • Dulbecco's phosphate‐buffered saline without calcium or magnesium (CMF‐DPBS; Life Technologies, cat. no. 14190‐144)
  • mTeSR1 stem cell medium (Stem Cell Technologies, cat. no. 05850)
  • 10 mM (3.3 mg/ml) stock solution of Rho Kinase (ROCK) Inhibitor Y‐27632 (Tocris, cat. no. 1254)
  • 2× freezing medium (see recipe)
  • Lysis buffer (see recipe)
  • 95% (v/v) ethanol supplemented with 75 mM NaCl (150 μl 5 M NaCl per 10 ml 95% ethanol)
  • RNase A stock solution (Sigma, cat. no. R4642)
  • Standard Taq DNA polymerase (New England Biolabs, cat. no. M0273) and 10× standard Taq PCR buffer
  • dNTP mix (2.5 mM each dNTP; GeneAmp dNTP Blend, Life Technologies, cat. no. N8080260)
  • 10 mM forward and reverse PCR primers that amplify a 150 to 200 base pair region around the target site
  • DNA Clean and Concentrator Kit (Zymo Research, cat. no. D4003)
  • 70% ethanol
  • TOPO‐TA cloning kit (Life Technologies, cat. no. K4575‐01)
  • 96‐well, 24‐well, and 6‐well flat‐bottom plates
  • Styrofoam freezing container
  • PCR plate sealers
  • Shaker
  • Thermal cycler
  • Additional reagents and equipment for coating plates with Matrigel or Geltrex ( protocol 5, step 1) and DNA sequencing (Shendure et al., )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bibikova, M., Beumer, K., Trautman, J.K., and Carroll, D. 2003. Enhancing gene targeting with designed zinc finger nucleases. Science 300:764.
  Bogdanove, A.J. and Voytas, D.F. 2011. TAL effectors: Customizable proteins for DNA targeting. Science 333:1843‐1846.
  Byrne, S.M., Ortiz, L., Mali, P., Aach, J., and Church, G.M. 2015. Multi‐kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic Acids Res. 43:e21.
  Cai, L., Ye, Z., Zhou, B.Y., Mali, P., Zhou, C., and Cheng, L. 2007. Promoting human embryonic stem cell renewal or differentiation by modulating Wnt signal and culture conditions. Cell Res.17:62‐72.
  Cohen, D.E. and Melton, D. 2011. Turning straw into gold: Directing cell fate for regenerative medicine. Nat. Rev. Genet. 12:243‐252.
  Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., and Zhang, F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823.
  Dimos, J.T., Rodolfa, K.T., Niakan, K.K., Weisenthal, L.M., Mitsumoto, H., Chung, W., Croft, G.F., Saphier, G., Leibel, R., Goland, R., Wichterle, H., Henderson, C.E., and Eggan, K. 2008. Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science 321:1218‐1221.
  Ding, Q., Regan, S.N., Xia, Y., Oostrom, L.A., Cowan, C.A., and Musunuru, K. 2013b. Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Cell Stem Cell 12:393‐394.
  Ding, Q., Lee, Y.K., Schaefer, E.A., Peters, D.T., Veres, A., Kim, K., Kuperwasser, N., Motola, D.L., Meissner, T.B., Hendriks, W.T., Trevisan, M., Gupta, R.M., Moisan, A., Banks, E., Friesen, M., Schinzel, R.T., Xia, F., Tang, A., Xia, Y., Figueroa, E., Wann, A., Ahfeldt, T., Daheron, L., Zhang, F., Rubin, L.L., Peng, L.F., Chung, R.T., Musunuru, K., and Cowan, C.A. 2013a. A TALEN genome‐editing system for generating human stem cell‐based disease models. Cell Stem Cell 12:238‐251.
  Ebert, A.D., Yu, J., Rose, F.F., Jr., Mattis, V.B., Lorson, C.L., Thomson, J.A., and Svendsen, C.N. 2009. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature 457:277‐280.
  Elliott, B., Richardson, C., Winderbaum, J., Nickoloff, J.A., and Jasin, M. 1998. Gene conversion tracts from double‐strand break repair in mammalian cells. Mol. Cell. Biol. 18:93‐101.
  Engler, C., Gruetzner, R., Kandzia, R., and Marillonnet, S. 2009. Golden gate shuffling: A one‐pot DNA shuffling method based on type IIs restriction enzymes. PloS One 4:e5553.
  Grskovic, M., Javaherian, A., Strulovici, B., and Daley, G.Q. 2011. Induced pluripotent stem cells–opportunities for disease modelling and drug discovery. Nat. Rev. Drug. Discov. 10:915‐929.
  Hockemeyer, D., Soldner, F., Beard, C., Gao, Q., Mitalipova, M., DeKelver, R.C., Katibah, G.E., Amora, R., Boydston, E.A., Zeitler, B., Meng, X., Miller, J.C., Zhang, L., Rebar, E.J., Gregory, P.D., Urnov, F.D., and Jaenisch, R. 2009. Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc‐finger nucleases. Nat. Biotechnol. 27:851‐857.
  Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., and Zhang, F. 2013. DNA targeting specificity of RNA‐guided Cas9 nucleases. Nat. Biotechnol. 31:827‐832.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821.
  Karagiannis, P. and Yamanaka, S. 2014. The fate of cell reprogramming. Nat. Methods 11:1006‐1008.
  Kim, H. and Kim, J.S. 2014. A guide to genome engineering with programmable nucleases. Nat. Rev. Genet. 15:321‐334.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Luo, Y., Rao, M., and Zou, J. 2014. Generation of GFP reporter human induced pluripotent stem cells using aavs1 safe harbor transcription activator‐like effector nuclease. Curr. Protoc. Stem Cell Biol. 29:5A.7.1‐5A.7.18.
  Ma, Y., Lin, H., and Qiu, C. 2012. High‐efficiency transfection and siRNA‐mediated gene knockdown in human pluripotent stem cells. Curr. Protoc. Stem Cell Biol. 21:5C.2.1‐5C.2.9.
  Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013. RNA‐guided human genome engineering via Cas9. Science 339:823‐826.
  Michalska, A.E. 2007. Isolation and propagation of mouse embryonic fibroblasts and preparation of mouse embryonic feeder layer cells. Curr. Protoc. Stem Cell Biol. 3:1C.3.1‐1C.3.17.
  Moscou, M.J. and Bogdanove, A.J. 2009. A simple cipher governs DNA recognition by TAL effectors. Science 326:1501.
  Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., and Zhang, F. 2013. Double nicking by RNA‐guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380‐1389.
  Robinson, J.P., Darzynkiewicz, Z., Hoffman, R., Nolan, J.P., Orfao, A., Rabinovitch, P.S., and Watkins, S. 2015. Current Protocols in Cytometry. John Wiley & Sons, Hoboken, N.J.
  Sandoe, J. and Eggan, K. 2013. Opportunities and challenges of pluripotent stem cell neurodegenerative disease models. Nat. Neurosci.16:780‐789.
  Shendure, J.A., Porreca, G.J., Church, G.M., Gardner, A.F., Hendrickson, C.L., Kieleczawa, J., and Slatko, B.E. 2011. Overview of DNA sequencing strategies. Curr. Protoc. Mol. Biol. 96:7.1.1‐7.1.23.
  Soldner, F., Laganiere, J., Cheng, A.W., Hockemeyer, D., Gao, Q., Alagappan, R., Khurana, V., Golbe, L.I., Myers, R.H., Lindquist, S., Zhang, L., Guschin, D., Fong, L.K., Vu, B.J., Meng, X., Urnov, F.D., Rebar, E.J., Gregory, P.D., Zhang, H.S., and Jaenisch, R. 2011. Generation of isogenic pluripotent stem cells differing exclusively at two early onset Parkinson point mutations. Cell 146:318‐331.
  Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861‐872.
  Thomson, J.A., Itskovitz‐Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145‐1147.
  Urnov, F.D., Miller, J.C., Lee, Y.L., Beausejour, C.M., Rock, J.M., Augustus, S., Jamieson, A.C., Porteus, M.H., Gregory, P.D., and Holmes, M.C. 2005. Highly efficient endogenous human gene correction using designed zinc‐finger nucleases. Nature 435:646‐651.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, G.M., and Arlotta, P. 2011. Efficient construction of sequence‐specific TAL effectors for modulating mammalian transcription. Nat. Biotechnol.29:149‐153.
  Zhang, Y., Ge, X., Yang, F., Zhang, L., Zheng, J., Tan, X., Jin, Z.B., Qu, J., and Gu, F. 2014. Comparison of non‐canonical PAMs for CRISPR/Cas9‐mediated DNA cleavage in human cells. Sci. Rep. 4:5405.
  Zou, J., Maeder, M.L., Mali, P., Pruett‐Miller, S.M., Thibodeau‐Beganny, S., Chou, B.K., Chen, G., Ye, Z., Park, I.H., Daley, G.Q., Porteus, M.H., Joung, J.K., and Cheng, L. 2009. Gene targeting of a disease‐related gene in human induced pluripotent stem and embryonic stem cells. Cell Stem Cell 5:97‐110.
  Zwaka, T.P. and Thomson, J.A. 2003. Homologous recombination in human embryonic stem cells. Nat. Biotechnol. 21:319‐321.
Internet Resources
  http://watcut.uwaterloo.ca/template.php
  This Web site can be used to find silent mutations in any given sequence, e.g., ssODNs for custom nuclease–mediated introduction or removal of SNPs. This can be helpful with finding correctly targeted clones obtained through homology directed repair, e.g., by introducing or removing a restriction endonuclease site.
  http://zifit.partners.org/ZiFiT/
  These Web sites can be used to design TALE binding arrays in silico and give additional background information. Both Web sites also give a score to each TALE array based on the binding affinity with the targeted DNA sequence.
  https://tale‐nt.cac.cornell.edu
  These Web sites can be used to design CRISPR guide RNA in silico and they rank the possible guide RNAs according to their (potential) off‐target effect.
  http://crispr.mit.edu/
  http://zifit.partners.org/ZiFiT/
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library