Comprehensive Protocols for CRISPR/Cas9‐based Gene Editing in Human Pluripotent Stem Cells

David P. Santos1, Evangelos Kiskinis1, Kevin Eggan2, Florian T. Merkle3

1 The Ken & Ruth Davee Department of Neurology & Clinical Neurological Sciences, Department of Physiology, Feinberg School of Medicine, Northwestern University, Chicago, Illinois, 2 Stanley Center for Psychiatric Research, Broad Institute of MIT and Harvard, Cambridge, Massachusetts, 3 Metabolic Research Laboratories and Medical Research Council Metabolic Diseases Unit, Wellcome Trust‐Medical Research Council Institute of Metabolic Science, and Wellcome Trust‐Medical Research Council Cambridge Stem Cell Institute, University of Cambridge, Cambridge
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 5B.6
DOI:  10.1002/cpsc.15
Online Posting Date:  August, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Genome editing of human pluripotent stem cells (hPSCs) with the CRISPR/Cas9 system has the potential to revolutionize hPSC‐based disease modeling, drug screening, and transplantation therapy. Here, we aim to provide a single resource to enable groups, even those with limited experience with hPSC culture or the CRISPR/Cas9 system, to successfully perform genome editing. The methods are presented in detail and are supported by a theoretical framework to allow for the incorporation of inevitable improvements in the rapidly evolving gene‐editing field. We describe protocols to generate hPSC lines with gene‐specific knock‐outs, small targeted mutations, or knock‐in reporters. © 2016 by John Wiley & Sons, Inc.

Keywords: CRISPR; gene editing; knock‐in; pluripotent; stem cell

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Common Procedures for CRISPR/Cas9‐Based Gene Editing In hPSCs
  • Support Protocol 1: Plasmid DNA and PCR Purification
  • Support Protocol 2: sgRNA Generation by in Vitro Transcription
  • Support Protocol 3: In Vitro Testing of sgRNAs
  • Support Protocol 4: hPSC Culture Techniques for Gene Editing
  • Support Protocol 5: CRISPR/Cas9 Delivery into hPSCs
  • Support Protocol 6: Genomic DNA Extraction
  • Support Protocol 7: Barcoded Deep Sequencing
  • Support Protocol 8: PCR Protocols
  • Basic Protocol 2: Generation of Knock‐Out hPSC LINES
  • Support Protocol 9: Sanger Sequencing of Mutant Clones
  • Basic Protocol 3: Introduction of Small Targeted Mutations into HPSCs
  • Support Protocol 10: Design of Single‐Stranded Oligonucleotides (ssODNs)
  • Support Protocol 11: Identification of Targeted Clones by ddPCR
  • Basic Protocol 4: Generation of Knock‐in Cell Lines
  • Support Protocol 12: Gene Targeting Vector Design
  • Support Protocol 13: Genomic Locus Amplification
  • Support Protocol 14: Homology arm Cloning
  • Support Protocol 15: PCR Amplification of the Targeting Vector Backbone and Reporter/Selection Cassette
  • Support Protocol 16: Generation of the Gene Targeting Vectors
  • Support Protocol 17: Drug Selection
  • Support Protocol 18: Confirmation of Gene Knock‐In
  • Support Protocol 19: Excision of the Selection Cassette
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Common Procedures for CRISPR/Cas9‐Based Gene Editing In hPSCs

  Materials
  • sgRNA oligos (forward and reverse; two per sgRNA; ordered on the smallest synthesis scale, 25 nM, purified by desalting)
  • sgRNA expression plasmid of choice (see Table 5B.6.1)
  • FastDigest BbsI (Thermo Fisher Scientific, cat. no. FD1014) or FastDigest BsmBI (Thermo Fisher Scientific, cat. no. FD0454)
  • Fast Antarctic Phosphatase (FastAP; Thermo Scientific, cat. no. EF0654)
  • 10× FastDigest buffer (Thermo Fisher Scientific, cat. no. B72)
  • Wizard SV Gel and PCR Clean‐Up Kit (Promega)
  • 10× T4 DNA ligase buffer (New England Biolabs, cat. no. B0202S)
  • T4 polynucleotide kinase (PNK; New England Biolabs, cat. no. M0201S))
  • 2× Quick Ligation Buffer (New England Biolabs, cat. no. E6010)
  • Quick Ligase (New England Biolabs, cat. no. M2200)
  • OneShot TOP10 chemically competent E. coli cells (Thermo Fisher Scientific, cat. no. C4040‐03)
  • Luria broth (LB; see recipe)
  • LB/agar/ampicillin plates (see recipe)
  • Sequencing primer (AGGGCCTATTTCCCATGATTCCTTCA)
  • Thermal cycler
  • PCR strips/tubes
  • 42°C water bath or heat block
  • Bacterial incubator (shaking/non‐shaking)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and purification of DNA ( protocol 2)

Support Protocol 1: Plasmid DNA and PCR Purification

  Materials
  • Luria broth (LB; see recipe) containing the appropriate antibiotic
  • QIAGEN Plasmid Plus Midi Kit
  • Wizard SV Gel and PCR Clean‐Up Kit (Promega)
  • 65°C water bath or heat block

Support Protocol 2: sgRNA Generation by in Vitro Transcription

  Materials
  • Oligos (see steps below; also see Table 5.6.1)
  • Taq PCR master mix (Thermo Fisher Scientific, cat. no. B9014S)
  • Wizard SV Gel and PCR Clean‐Up Kit (Promega, cat. no. A9282)
  • RNase‐free H 2O
  • 100‐bp DNA ladder
  • MEGAshortscript T7 Transcription Kit (Thermo Fisher Scientific, cat. no. AM1354)
  • E.Z.N.A PF miRNA Isolation Kit (OMEGA Bio‐Tek, cat. no. R7036‐01)
  • 6× gel loading dye, purple (New England Biolabs, cat. no. B7024S)
  • PCR strips/tubes
  • Thermal cycler
  • Spectrophotometer
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Support Protocol 3: In Vitro Testing of sgRNAs

  Materials
  • Purified human genomic DNA ( protocol 7)
  • Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific, cat. no. F549)
  • Wizard SV Gel and PCR Clean‐Up Kit (Promega, cat. no. A9282)
  • Assay buffer (see recipe)
  • 1 µg/µl GeneArt Platinum Cas9 Nuclease (Thermo Fisher Scientific, cat. no. B25640)
  • Purified IVT sgRNA ( protocol 3)
  • 4 µg/µl RNase A (Qiagen, cat. no. 19101)
  • Reaction stop buffer (see recipe)
  • HEK293T cells (e.g., ATCC)
  • 0.25% trypsin‐EDTA with phenol red (Thermo Fisher Scientific, cat. no. 25200‐056)
  • sgRNA expression plasmid (exact expression plasmid will be determined by downstream application, e.g., pX330; see Table 5.6.1)
  • HilyMax (Dojindo Molecular Technologies, cat. no. H357‐10) or preferred transfection reagent
  • QIAGEN DNeasy Blood and Tissue Kit (Qiagen, cat. no. 69504; also see protocol 7)
  • 5× GC buffer (New England Biolabs, cat. no. B0519S)
  • dNTP mix (10 mM each dNTP; Thermo Fisher Scientific, cat. no. R0192))
  • Forward/reverse primers (amplifying CRISPR/Cas9‐targeted loci)
  • Dimethylsulfoxide (DMSO)
  • 10× Taq PCR buffer (New England Biolabs, cat. no. B9014S)
  • SURVEYOR Mutation Detection Kit (IDT, cat. no. 706025)
  • 6× gel loading dye, purple (New England Biolabs, cat. no. B7024S)
  • 100‐bp DNA ladder
  • Novex TBE gel, 4‐20%, 10 well (Thermo Fisher Scientific, cat. no. EC6225BOX)
  • SYBR Gold Nucleic Acid Gel Stain (Thermo Fisher Scientific, cat. no. S‐11494)
  • 1× TBE buffer (see recipe for 10×)
  • NanoDrop or similar spectrophotometer
  • PCR strips/tubes
  • UV transilluminator
  • 10‐cm tissue culture treated plates (Corning, cat. no. 430167)
  • 6‐well tissue culture treated plate (Corning, cat. no. 3516)
  • Cell scrapers
  • Microcentrifuge
  • Thermal cycler
  • Platform rocker
  • Imaging system and Image Lab software (or equivalent)
  • Additional reagents and equipment for PCR ( protocol 9), agarose gel electrophoresis (Voytas, ), plasmid purification ( protocol 2), counting cells (e.g., unit 1.13; Behar et al., ), genomic DNA extraction ( protocol 7), and polyacrylamide gel electrophoresis (Gallagher, )

Support Protocol 4: hPSC Culture Techniques for Gene Editing

  Materials
  • Matrigel or Geltrex hESC‐qualified matrix (Thermo Fisher Scientific, cat. no. 08774552)
  • DMEM:F12 medium (Life Technologies, cat. no. 11320082)
  • Tissue‐culture grade Ca2+‐ and Mg2+‐free PBS (Corning, cat. no. 21‐040‐CV)
  • Appropriate culture medium [mTeSR1 (StemCell Technologies, cat. no. 05850)]
  • 1:1 medium (see recipe)
  • 10 mM Y27362 (ROCK inhibitor)
  • Cryovials containing frozen hPSCs
  • 0.5 mM disodium EDTA (Sigma‐Aldrich, cat. no. E1644)
  • hESC/hiPSC line (low passage, karyotypically normal)
  • 2× freezing medium (see recipe)
  • Liquid N 2
  • TrypLE Express (Life Technologies, cat. no. 12604‐039)
  • Fetal bovine serum (FBS; Fisher Scientific, cat. no. SH3007003)
  • Fluorescent marker: e.g., calcein red AM or calcein green AM
  • 70% ethanol
  • 6‐well tissue culture plates (Corning, cat. no. 3516)
  • 10‐cm tissue culture treated plate (Corning, cat. no. 430167)
  • 15‐cm tissue culture treated plate (Corning, cat. no. 430599)
  • Phase‐contrast microscope
  • Label maker
  • Sterile screw‐top 2‐ml cryovials
  • Mr. Frosty or other freezing container capable of cooling cells at a rate of −1°C per min
  • 50‐ml conical centrifuge tubes (e.g., Corning Falcon)
  • 40 µm cell strainer (Corning Falcon, cat. no. 352340)
  • Fluorescence activated cell sorter (FACS; e.g., Beckman Coulter MoFlo or BD Aria‐III)
  • 96‐well tissue culture treated plates (Corning, cat. no. 3916) and adhesive foil for 96‐well plates (VWR, cat. no. 60941‐126)
  • Aerosol‐barrier 200‐μl pipet tips (and 200‐μl repeat pipettor)
  • Dissecting microscope or EVOS microscope
  • Styrofoam box
  • 96‐well, 0.75‐ml 2‐D‐barcoded tubes and tube rack (e.g., Thermo Scientific)
  • SepraSeal caps (e.g., Thermo Scientific)

Support Protocol 5: CRISPR/Cas9 Delivery into hPSCs

  Materials
  • NEON transfection system (Life Technologies) including:
    • NEON transfection device
    • 100 µl NEON pipet tips
    • Resuspension buffer
    • Electrolytic buffer (E2)
  • 1:1 medium (see recipe)
  • 10 mM Y27362 (ROCK inhibitor)
  • Tissue‐culture grade Ca2+‐ and Mg2+‐free PBS (Corning, cat. no. 21‐040‐CV)
  • TrypLE express (Life Technologies, cat. no. 12604‐039)
  • DMEM:F12 medium (Life Technologies, cat. no. 11320082)
  • Fetal bovine serum (FBS; Fisher Scientific, cat. no. SH3007003)
  • hPSC suspension to be electroporated
  • 10‐cm tissue culture plates
  • Tabletop centrifuge
  • Additional reagents and equipment for coating plates with Matrigel ( protocol 5)

Support Protocol 6: Genomic DNA Extraction

  Materials
  • 0.5 mM disodium EDTA (Sigma‐Aldrich, cat. no. E1644)
  • TrypLE express (Life Technologies, cat. no. 12604‐039)
  • Tissue‐culture grade Ca2+‐ and Mg2+‐free PBS (Corning, cat. no. 21‐040‐CV)
  • 100% and 70% ethanol
  • SDS lysis buffer (see recipe)
  • 25:24:1 phenol:chloroform:isoamyl alcohol
  • TE buffer (see recipe)
  • DirectPCR/ProK buffer (see recipe)
  • HotShot Component 1 (see recipe)
  • HotShot Component 2 (see recipe)
  • Centrifuge (capable of 4°C and room temperature) with microtiter plate adapter
  • 50°C water bath or heat block
  • NanoDrop or similar spectrophotometer
  • Microseal‐B Adhesive Film
  • 96‐well tissue culture treated plates (Corning, cat. no. 3916)
  • Multichannel pipettors
  • Hybridization oven
  • Additional reagents and equipment for culture of hPSCs ( protocol 5)

Support Protocol 7: Barcoded Deep Sequencing

  Materials
  • PCR primers and barcoding primers (see steps below)
  • Genomic DNA (directPCR/ProK buffer‐extracted; see protocol 7)
  • PhiX Control V3
  • 96‐well PCR plates (VWR, cat. no. 89049‐178)
  • NanoDrop or similar spectrophotometer
  • Access to Illumina Miseq System and consumables
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), genomic PCR for short amplicons ( protocol 9), and PCR purification ( protocol 2)

Support Protocol 8: PCR Protocols

  Materials
  • 5× GC buffer (New England Biolabs, cat. no. B0519S)
  • Dimethylsulfoxide (DMSO)
  • dNTP mix (10 mM each dNTP; Thermo Fisher Scientific, cat. no. R0192))
  • Phusion Hot Start II DNA polymerase (Thermo Fisher Scientific, cat. no. F549)
  • 10 μM appropriate forward and reverse primers
  • Genomic DNA ( protocol 7)
  • DpnI restriction enzyme (New England Biolabs, cat. no. R0176S)
  • Luria broth (LB; see recipe)
  • Thermal cycler
  • 8‐well PCR strips or 96‐well PCR plates

Basic Protocol 2: Generation of Knock‐Out hPSC LINES

  Materials
  • hESC or hiPSC line ( protocol 5)
  • sgRNAs ( protocol 1)
  • 1:1 medium (see recipe)
  • 10 mM Y27362 (ROCK inhibitor)
  • Additional reagents and equipment for designing sgRNAs ( protocol 1), generating sgRNAs by IVT ( protocol 3), testing sgRNAs ( protocol 4), culture of hPSCs ( protocol 5), introduction of CRISPR/Cas components into cells by electroporation ( protocol 6), extraction of genomic DNA ( protocol 7), barcoded deep sequencing ( protocol 8), and Sanger sequencing ( protocol 11)

Support Protocol 9: Sanger Sequencing of Mutant Clones

  Materials
  • Primers (see steps below)
  • AMPure magnetic beads (Beckman Coulter Life Sciences)
  • Thermal cycler
  • Access to Sanger sequencing facility
  • Additional reagents and equipment for PCR ( protocol 9) and agarose gel electrophoresis (Voytas, )

Basic Protocol 3: Introduction of Small Targeted Mutations into HPSCs

  Materials
  • hESC or hiPSC line ( protocol 5)
  • sgRNAs ( protocol 1)
  • 1:1 medium (see recipe)
  • 10 mM Y27362 (ROCK inhibitor)
  • Additional reagents and equipment for designing sgRNAs ( protocol 1), generating sgRNAs by IVT ( protocol 3), testing sgRNAs ( protocol 4), culture of hPSCs ( protocol 5), introduction of CRISPR/Cas9 components into cells by electroporation ( protocol 6), extraction of genomic DNA ( protocol 7), barcoded deep sequencing ( protocol 8), and Sanger sequencing ( protocol 11), and design of ssODNs ( protocol 20)

Support Protocol 10: Design of Single‐Stranded Oligonucleotides (ssODNs)

  Materials
  • Probes (see steps below)
  • Forward/reverse genomic loci primers (see steps below)
  • Internal sequencing primer (see steps below)
  • ddPCR Supermix for Probes (no dUTP; BioRad, cat. no. 1863023)
  • Genomic DNA (DirectPCR/ProK‐extracted; protocol 9)
  • Droplet oil (BioRad, cat. no. 186‐3030)
  • BioRad XQ200 Droplet Digital PCR machine and droplet generator, or similar system
  • 96‐well PCR plates (VWR, cat. no. 89049)
  • Adhesive foil for 96‐well plates (VWR, cat. no. 60941‐126)

Support Protocol 11: Identification of Targeted Clones by ddPCR

  Materials
  • hESC or hiPSC line ( protocol 5)
  • sgRNAs ( protocol 1)
  • Additional reagents and equipment for designing sgRNAs ( protocol 1), generating sgRNAs by IVT ( protocol 3), testing sgRNAs ( protocol 4), culture of hPSCs ( protocol 5), introduction of CRISPR/Cas9 components into cells by electroporation ( protocol 6), extraction of genomic DNA ( protocol 7), gene targeting vector design ( protocol 22), amplification of homology arms ( protocol 24), drug selection ( protocol 27), and excision of the selection cassette ( protocol 29)

Basic Protocol 4: Generation of Knock‐in Cell Lines

  Materials
  • Primers (see steps below)
  • Additional reagents and equipment for PCR ( protocol 9), agarose gel electrophoresis (Voytas, ), and PCR purification ( protocol 2)

Support Protocol 12: Gene Targeting Vector Design

  Materials
  • Primers (see steps below)
  • Additional reagents and equipment for gene targeting vector design ( protocol 22), PCR ( protocol 9), agarose gel electrophoresis (Voytas, ), and PCR purification ( protocol 2)

Support Protocol 13: Genomic Locus Amplification

  Materials
  • Targeting vector backbone (PCR amplified for Gibson assembly; protocol 25)
  • Reporter/selection cassette (PCR amplified for Gibson assembly; protocol 25)
  • Genomic locus primers ( protocol 23)
  • Homology arm primers with appropriate Gibson overhangs ( protocol 24)
  • Gibson assembly mixture (see recipe)
  • Luria broth (LB; see recipe)
  • 50°C water bath or heat block
  • PCR strips
  • Additional reagents and equipment for transformation of E. coli ( protocol 1, step 9) and PCR ( protocol 9)

Support Protocol 14: Homology arm Cloning

  Materials
  • hPSCs transfected with neomycin selection cassette in in 10‐cm plates ( protocol 6)
  • 1:1 medium (see recipe)
  • Geneticin (G418; see recipe)
  • Ganciclovir

Support Protocol 15: PCR Amplification of the Targeting Vector Backbone and Reporter/Selection Cassette

  Materials
  • Drug‐resistant hPSC clones
  • Forward/reverse primers for 5′ and 3′ homology arm screening (described below)
  • Additional reagents and equipment for genomic DNA extraction ( protocol 7), PCR ( protocol 9), and agarose gel electrophoresis (Voytas, )

Support Protocol 16: Generation of the Gene Targeting Vectors

  Materials
  • Correctly targeted clones (see protocol 28)
  • 1:1 medium (see recipe)
  • Appropriate recombinase and marker gene construct (e.g., plasmid expressing FlpO and puromycin)
  • Additional reagents and equipment for culture techniques ( protocol 5) and drug selection ( protocol 27)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Aarts, M. and te Riele, H. 2010. Subtle gene modification in mouse ES cells: Evidence for incorporation of unmodified oligonucleotides without induction of DNA damage. Nucleic Acids Res. 38:6956‐6967. doi: 10.1093/nar/gkq589.
  Aizawa, E., Hirabayashi, Y., Iwanaga, Y., Suzuki, K., Sakurai, K., Shimoji, M., Aiba, K., Wada, T., Tooi, N., Kawase, E., Suemori, H., Nakatsuji, N., and Mitani, K. 2012. Efficient and accurate homologous recombination in hESCs and hiPSCs using helper‐dependent adenoviral vectors. Mol. Ther. 20:424‐431. doi: 10.1038/mt.2011.266.
  Anders, C. and Jinek, M. 2014. In vitro enzymology of Cas9. Meth. Enzymol. 546:1‐20. doi: 10.1016/B978‐0‐12‐801185‐0.00001‐5.
  Arbab, M., Srinivasan, S., Hashimoto, T., Geijsen, N., and Sherwood, R.I. 2015. Cloning‐free CRISPR. Stem Cell Reports 5:908‐917. doi: 10.1016/j.stemcr.2015.09.022.
  Beers, J., Gulbranson, D.R., George, N., Siniscalchi, L.I., Jones, J., Thomson, J.A., and Chen, G. 2012. Passaging and colony expansion of human pluripotent stem cells by enzyme‐free dissociation in chemically defined culture conditions. Nat. Protoc. 7:2029‐2040. doi: 10.1038/nprot.2012.130.
  Behar, R.Z., Bahl, V., Wang, Y., Weng, J.‐H., Lin, S.C. and Talbot, P. 2012. Adaptation of stem cells to 96‐well plate assays: Use of human embryonic and mouse neural stem cells in the MTT assay. Curr. Protoc. Stem Cell Biol. 23:1C.13.1‐1C.13.21.
  Bell, C.C., Magor, G.W., Gillinder, K.R., and Perkins, A.C. 2014. A high‐throughput screening strategy for detecting CRISPR‐Cas9 induced mutations using next‐generation sequencing. BMC Genomics 15:1002. doi: 10.1186/1471‐2164‐15‐1002.
  Bonner, M. and Kmiec, E.B. 2009. DNA breakage associated with targeted gene alteration directed by DNA oligonucleotides. Mutat. Res. 669:85‐94. doi: 10.1016/j.mrfmmm.2009.05.004.
  Brinkman, E.K., Chen, T., Amendola, M., and van Steensel, B. 2014. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42:e168. doi: 10.1093/nar/gku936.
  Byrne, S.M., Ortiz, L., Mali, P., Aach, J., and Church, G.M. 2015. Multi‐kilobase homozygous targeted gene replacement in human induced pluripotent stem cells. Nucleic. Acids Res. 43:e21. doi: 10.1093/nar/gku1246.
  International Stem Cell, .I., Amps, K., Andrews, P.W., Anyfantis, G., Armstrong, L., Avery, S., Baharvand, H., Baker, J., Baker, D., Munoz, M.B., Beil, S., Benvenisty, N., Ben‐Yosef, D., Biancotti, J.C., Bosman, A., Brena, R.M., Brison, D., Caisander, G., Camarasa, M.V., Chen, J., Chiao, E., Choi, Y.M., Choo, A.B., Collins, D., Colman, A., Crook, J.M., Daley, G.Q., Dalton, A., De Sousa, P.A., Denning, C., Downie, J., Dvorak, P., Montgomery, K.D., Feki, A., Ford, A., Fox, V., Fraga, A.M., Frumkin, T., Ge, L., Gokhale, P.J., Golan‐Lev, T., Gourabi, H., Gropp, M., Lu, G., Hampl, A., Harron, K., Healy, L., Herath, W., Holm, F., Hovatta, O., Hyllner, J., Inamdar, M.S., Irwanto, A.K., Ishii, T., Jaconi, M., Jin, Y., Kimber, S., Kiselev, S., Knowles, B.B., Kopper, O., Kukharenko, V., Kuliev, A., Lagarkova, M.A., Laird, P.W., Lako, M., Laslett, A.L., Lavon, N., Lee, D.R., Lee, J.E., Li, C., Lim, L.S., Ludwig, T.E., Ma, Y., Maltby, E., Mateizel, I., Mayshar, Y., Mileikovsky, M., Minger, S.L., Miyazaki, T., Moon, S.Y., Moore, H., Mummery, C., Nagy, A., Nakatsuji, N., Narwani, K., Oh, S.K., Oh, S.K., Olson, C., Otonkoski, T., Pan, F., Park, I.H., Pells, S., Pera, M.F., Pereira, L.V., Qi, O., Raj, G.S., Reubinoff, B., Robins, A., Robson, P., Rossant, J., Salekdeh, G.H., Schulz, T.C., Sermon, K., Sheik Mohamed, J., Shen, H., Sherrer, E., Sidhu, K., Sivarajah, S., Skottman, H., Spits, C., Stacey, G.N., Strehl, R., Strelchenko, N., Suemori, H., Sun, B., Suuronen, R., Takahashi, K., Tuuri, T., Venu, P., Verlinsky, Y., Ward‐van Oostwaard, D., Weisenberger, D.J., Wu, Y., Yamanaka, S., Young, L., and Zhou, Q. 2011. Screening ethnically diverse human embryonic stem cells identifies a chromosome 20 minimal amplicon conferring growth advantage. Nat. Biotechnol. 29:1132‐1144. doi: 10.1038/nbt.2051.
  Chen, B., Gilbert, L.A., Cimini, B.A., Schnitzbauer, J., Zhang, W., Li, G.W., Park, J., Blackburn, E.H., Weissman, J.S., Qi, L.S., and Huang, B. 2013. Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155:1479‐1491.
  Chen, K.G., Mallon, B.S., McKay, R.D., and Robey, P.G. 2014. Human pluripotent stem cell culture: Considerations for maintenance, expansion, and therapeutics. Cell Stem Cell 14:13‐26. doi: 10.1016/j.stem.2013.12.005.
  Chen, Y., Cao, J., Xiong, M., Petersen, A.J., Dong, Y., Tao, Y., Huang, C.T., Du, Z., and Zhang, S.C. 2015. Engineering human stem cell lines with inducible gene knockout using CRISPR/Cas9. Cell Stem Cell 17:233‐244. doi: 10.1016/j.stem.2015.06.001.
  Chen, G., Gulbranson, D.R., Hou, Z., Bolin, J.M., Ruotti, V., Probasco, M.D., Smuga‐Otto, K., Howden, S.E., Diol, N.R., Propson, N.E., Wagner, R., Lee, G.O., Antosiewicz‐Bourget, J., Teng, J.M., and Thomson, J.A. 2011. Chemically defined conditions for human iPSC derivation and culture. Nat. Methods 8:424‐429. doi: 10.1038/nmeth.1593.
  Cho, S.W., Kim, S., Kim, J.M., and Kim, J.S. 2013. Targeted genome engineering in human cells with the Cas9 RNA‐guided endonuclease. Nat. Biotechnol. 31:230‐232. doi: 10.1038/nbt.2507.
  Cho, S.W., Kim, S., Kim, Y., Kweon, J., Kim, H.S., Bae, S., and Kim, J.S. 2014. Analysis of off‐target effects of CRISPR/Cas‐derived RNA‐guided endonucleases and nickases. Genome Res. 24:132‐141. doi: 10.1101/gr.162339.113.
  Christian, M., Cermak, T., Doyle, E.L., Schmidt, C., Zhang, F., Hummel, A., Bogdanove, A.J., and Voytas, D.F. 2010. Targeting DNA double‐strand breaks with TAL effector nucleases. Genetics 186:757‐761. doi: 10.1534/genetics.110.120717.
  Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., and Zhang, F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823. doi: 10.1126/science.1231143.
  Dambournet, D., Hong, S.H., Grassart, A., and Drubin, D.G. 2014. Tagging endogenous loci for live‐cell fluorescence imaging and molecule counting using ZFNs, TALENs, and Cas9. Meth. Enzymol. 546:139‐160. doi: 10.1016/B978‐0‐12‐801185‐0.00007‐6.
  Dang, Y., Jia, G., Choi, J., Ma, H., Anaya, E., Ye, C., Shankar, P., and Wu, H. 2015. Optimizing sgRNA structure to improve CRISPR‐Cas9 knockout efficiency. Genome Biol. 16:280. doi: 10.1186/s13059‐015‐0846‐3.
  Davis, K.M., Pattanayak, V., Thompson, D.B., Zuris, J.A., and Liu, D.R. 2015. Small molecule‐triggered Cas9 protein with improved genome‐editing specificity. Nat. Chem. Biol. 11:316‐318. doi: 10.1038/nchembio.1793.
  Ding, Q., Regan, S.N., Xia, Y., Oostrom, L.A., Cowan, C.A., and Musunuru, K. 2013b. Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Cell Stem Cell 12:393‐394. doi: 10.1016/j.stem.2013.03.006.
  Ding, Q., Lee, Y.K., Schaefer, E.A., Peters, D.T., Veres, A., Kim, K., Kuperwasser, N., Motola, D.L., Meissner, T.B., Hendriks, W.T., Trevisan, M., Gupta, R.M., Moisan, A., Banks, E., Friesen, M., Schinzel, R.T., Xia, F., Tang, A., Xia, Y., Figueroa, E., Wann, A., Ahfeldt, T., Daheron, L., Zhang, F., Rubin, L.L., Peng, L.F., Chung, R.T., Musunuru, K., and Cowan, C.A. 2013a. A TALEN genome‐editing system for generating human stem cell‐based disease models. Cell Stem Cell 12:238‐251. doi: 10.1016/j.stem.2012.11.011.
  Doench, J.G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E.W., Donovan, K.F., Smith, I., Tothova, Z., Wilen, C., Orchard, R., Virgin, H.W., Listgarten, J., and Root, D.E. 2016. Optimized sgRNA design to maximize activity and minimize off‐target effects of CRISPR‐Cas9. Nat. Biotechnol. 34:184‐191. doi: 10.1038/nbt.3437.
  Doudna, J.A. and Charpentier, E. 2014. Genome editing. The new frontier of genome engineering with CRISPR‐Cas9. Science 346:1258096. doi: 10.1126/science.1258096.
  Draper, J.S., Moore, H.D., Ruban, L.N., Gokhale, P.J., and Andrews, P.W. 2004. Culture and characterization of human embryonic stem cells. Stem Cells Dev. 13:325‐336. doi: 10.1089/scd.2004.13.325.
  Featherstone, C. and Jackson, S.P. 1999. DNA double‐strand break repair. Curr. Biol. 9:R759‐761. doi: 10.1016/S0960‐9822(00)80005‐6.
  Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and Sander, J.D. 2013. High‐frequency off‐target mutagenesis induced by CRISPR‐Cas nucleases in human cells. Nat. Biotechnol. 31:822‐826. doi: 10.1038/nbt.2623.
  Gagnon, J.A., Valen, E., Thyme, S.B., Huang, P., Akhmetova, L., Pauli, A., Montague, T.G., Zimmerman, S., Richter, C., and Schier, A.F. 2014. Efficient mutagenesis by Cas9 protein‐mediated oligonucleotide insertion and large‐scale assessment of single‐guide RNAs. PloS One 9:e98186. doi: 10.1371/journal.pone.0098186.
  Gaj, T., Gersbach, C.A., and Barbas, C.F., 3rd. 2013. ZFN, TALEN, and CRISPR/Cas‐based methods for genome engineering. Trends Biotechnol. 31:397‐405. doi: 10.1016/j.tibtech.2013.04.004.
  Gallagher, S.R. 2012. One‐dimensional SDS gel electrophoresis of proteins. Curr. Protoc. Mol. Biol. 97:10.2A.1‐10.2A.44.
  Gibson, D.G. 2011. Enzymatic assembly of overlapping DNA fragments. Meth. Enzymol. 498:349‐361. doi: 10.1016/B978‐0‐12‐385120‐8.00015‐2.
  Gibson, D.G., Young, L., Chuang, R.Y., Venter, J.C., Hutchison, C.A., 3rd., and Smith, H.O. 2009. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6:343‐345. doi: 10.1038/nmeth.1318.
  Gonzalez, F., Zhu, Z., Shi, Z.D., Lelli, K., Verma, N., Li, Q.V., and Huangfu, D. 2014. An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells. Cell Stem Cell 15:215‐226. doi: 10.1016/j.stem.2014.05.018.
  Hendel, A., Kildebeck, E.J., Fine, E.J., Clark, J.T., Punjya, N., Sebastiano, V., Bao, G., and Porteus, M.H. 2014. Quantifying genome‐editing outcomes at endogenous loci with SMRT sequencing. Cell Rep. 7:293‐305. doi: 10.1016/j.celrep.2014.02.040.
  Hendriks, W.T., Warren, C.R., and Cowan, C.A. 2016. Genome editing in human pluripotent stem cells: Approaches, pitfalls, and solutions. Cell Stem Cell 18:53‐65. doi: 10.1016/j.stem.2015.12.002.
  Hill, J.T., Demarest, B.L., Bisgrove, B.W., Su, Y.C., Smith, M., and Yost, H.J. 2014. Poly peak parser: Method and software for identification of unknown indels using sanger sequencing of polymerase chain reaction products. Dev. Dyn. 243:1632‐1636. doi: 10.1002/dvdy.24183.
  Hindson, B.J., Ness, K.D., Masquelier, D.A., Belgrader, P., Heredia, N.J., Makarewicz, A.J., Bright, I.J., Lucero, M.Y., Hiddessen, A.L., Legler, T.C., Kitano, T.K., Hodel, M.R., Petersen, J.F., Wyatt, P.W., Steenblock, E.R., Shah, P.H., Bousse, L.J., Troup, C.B., Mellen, J.C., Wittmann, D.K., Erndt, N.G., Cauley, T.H., Koehler, R.T., So, A.P., Dube, S., Rose, K.A., Montesclaros, L., Wang, S., Stumbo, D.P., Hodges, S.P., Romine, S., Milanovich, F.P., White, H.E., Regan, J.F., Karlin‐Neumann, G.A., Hindson, C.M., Saxonov, S., and Colston, B.W. 2011. High‐throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal. Chem. 83:8604‐8610. doi: 10.1021/ac202028g.
  Hodgkins, A., Farne, A., Perera, S., Grego, T., Parry‐Smith, D.J., Skarnes, W.C., and Iyer, V. 2015. WGE: A CRISPR database for genome engineering. Bioinformatics 31:3078‐3080. doi: 10.1093/bioinformatics/btv308.
  Hsu, P.D., Lander, E.S., and Zhang, F. 2014. Development and applications of CRISPR‐Cas9 for genome engineering. Cell 157:1262‐1278. doi: 10.1016/j.cell.2014.05.010.
  Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., and Zhang, F. 2013. DNA targeting specificity of RNA‐guided Cas9 nucleases. Nat. Biotechnol. 31:827‐832. doi: 10.1038/nbt.2647.
  Hughesman, C., Fakhfakh, K., Bidshahri, R., Lund, H.L., and Haynes, C. 2015. A new general model for predicting melting thermodynamics of complementary and mismatched B‐form duplexes containing locked nucleic acids: Application to probe design for digital PCR detection of somatic mutations. Biochemistry 54:1338‐1352. doi: 10.1021/bi500905b.
  Ichida, J.K. and Kiskinis, E. 2015. Probing disorders of the nervous system using reprogramming approaches. EMBO J. 34:1456‐1477. doi: 10.15252/embj.201591267.
  Jasin, M. and Rothstein, R. 2013. Repair of strand breaks by homologous recombination. Cold Spring Harb. Perspect. Biol. 5:a012740. doi: 10.1101/cshperspect.a012740.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821. doi: 10.1126/science.1225829.
  Kim, Y.G., Cha, J., and Chandrasegaran, S. 1996. Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain. Proc. Natl. Acad. Sci. U. S. A. 93:1156‐1160. doi: 10.1073/pnas.93.3.1156.
  Kim, S., Kim, D., Cho, S.W., Kim, J., and Kim, J.S. 2014. Highly efficient RNA‐guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24:1012‐1019. doi: 10.1101/gr.171322.113.
  Kime, C., Mandegar, M.A., Srivastava, D., Yamanaka, S., Conklin, B.R., and Rand, T.A. 2016. Efficient CRISPR/Cas9‐based genome engineering in human pluripotent stem cells. Curr. Protoc. Hum. Genet. 88:21.4.1‐21.4.23. doi: 10.1002/0471142905.hg2104s88.
  Knight, S.C., Xie, L., Deng, W., Guglielmi, B., Witkowsky, L.B., Bosanac, L., Zhang, E.T., El Beheiry, M., Masson, J.B., Dahan, M., Liu, Z., Doudna, J.A., and Tjian, R. 2015. Dynamics of CRISPR‐Cas9 genome interrogation in living cells. Science 350:823‐826. doi: 10.1126/science.aac6572.
  Lieber, M.R. 2010. The mechanism of double‐strand DNA break repair by the nonhomologous DNA end‐joining pathway. Annu. Rev. Biochem. 79:181‐211. doi: 10.1146/annurev.biochem.052308.093131.
  Ludwig, T. and A Thomson, J. 2007. Defined, feeder‐independent medium for human embryonic stem cell culture. Curr. Protoc. Stem. Cell Biol. 2:1C.2.1‐1C.2.16. doi: 10.1002/9780470151808.sc01c02s2.
  Maeder, M.L., Linder, S.J., Cascio, V.M., Fu, Y., Ho, Q.H., and Joung, J.K. 2013. CRISPR RNA‐guided activation of endogenous human genes. Nat. Methods 10:977‐979. doi: 10.1038/nmeth.2598.
  Mali, P., Aach, J., Stranges, P.B., Esvelt, K.M., Moosburner, M., Kosuri, S., Yang, L., and Church, G.M. 2013a. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nat. Biotechnol. 31:833‐838. doi: 10.1038/nbt.2675.
  Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013b. RNA‐guided human genome engineering via Cas9. Science 339:823‐826. doi: 10.1126/science.1232033.
  Malik, N. and Rao, M.S. 2013. A review of the methods for human iPSC derivation. Methods Mol. Biol. 997:23‐33. doi: 10.1007/978‐1‐62703‐348‐0_3.
  Mayshar, Y., Ben‐David, U., Lavon, N., Biancotti, J.C., Yakir, B., Clark, A.T., Plath, K., Lowry, W.E., and Benvenisty, N. 2010. Identification and classification of chromosomal aberrations in human induced pluripotent stem cells. Cell Stem Cell 7:521‐531. doi: 10.1016/j.stem.2010.07.017.
  Mekhoubad, S., Bock, C., de Boer, A.S., Kiskinis, E., Meissner, A., and Eggan, K. 2012. Erosion of dosage compensation impacts human iPSC disease modeling. Cell Stem Cell 10:595‐609. doi: 10.1016/j.stem.2012.02.014.
  Merkle, F.T. and Eggan, K. 2013. Modeling human disease with pluripotent stem cells: From genome association to function. Cell Stem Cell 12:656‐668. doi: 10.1016/j.stem.2013.05.016.
  Merkle, F.T., Neuhausser, W.M., Santos, D., Valen, E., Gagnon, J.A., Maas, K., Sandoe, J., Schier, A.F., and Eggan, K. 2015. Efficient CRISPR‐Cas9‐mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus. Cell Rep. 11:875‐883. doi: 10.1016/j.celrep.2015.04.007.
  Miyaoka, Y., Chan, A.H., Judge, L.M., Yoo, J., Huang, M., Nguyen, T.D., Lizarraga, P.P., So, P.L., and Conklin, B.R. 2014. Isolation of single‐base genome‐edited human iPS cells without antibiotic selection. Nat. Methods 11:291‐293. doi: 10.1038/nmeth.2840.
  Montague, T.G., Cruz, J.M., Gagnon, J.A., Church, G.M., and Valen, E. 2014. CHOPCHOP: A CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Res. 42:W401‐407. doi: 10.1093/nar/gku410.
  Moore, J.C., Atze, K., Yeung, P.L., Toro‐Ramos, A.J., Camarillo, C., Thompson, K., Ricupero, C.L., Brenneman, M.A., Cohen, R.I., and Hart, R.P. 2010. Efficient, high‐throughput transfection of human embryonic stem cells. Stem Cell Res. Ther. 1:23. doi: 10.1186/scrt23.
  Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N., and Yamanaka, S. 2008. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 26:101‐106. doi: 10.1038/nbt1374.
  Nguyen, H.T., Geens, M., Mertzanidou, A., Jacobs, K., Heirman, C., Breckpot, K., and Spits, C. 2014. Gain of 20q11.21 in human embryonic stem cells improves cell survival by increased expression of Bcl‐xL. Mol. Hum. Reprod. 20:168‐177. doi: 10.1093/molehr/gat077.
  Olsen, P.A., Randol, M., Luna, L., Brown, T., and Krauss, S. 2005. Genomic sequence correction by single‐stranded DNA oligonucleotides: Role of DNA synthesis and chemical modifications of the oligonucleotide ends. J. Gene. Med. 7:1534‐1544. doi: 10.1002/jgm.804.
  Park, I.H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A., Lensch, M.W., Cowan, C., Hochedlinger, K., and Daley, G.Q. 2008. Disease‐specific induced pluripotent stem cells. Cell 134:877‐886. doi: 10.1016/j.cell.2008.07.041.
  Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., and Liu, D.R. 2013. High‐throughput profiling of off‐target DNA cleavage reveals RNA‐programmed Cas9 nuclease specificity. Nat. Biotechnol. 31:839‐843. doi: 10.1038/nbt.2673.
  Perez‐Pinera, P., Kocak, D.D., Vockley, C.M., Adler, A.F., Kabadi, A.M., Polstein, L.R., Thakore, P.I., Glass, K.A., Ousterout, D.G., Leong, K.W., Guilak, F., Crawford, G.E., Reddy, T.E., and Gersbach, C.A. 2013. RNA‐guided gene activation by CRISPR‐Cas9‐based transcription factors. Nat. Methods 10:973‐976. doi: 10.1038/nmeth.2600.
  Pruszak, J., Sonntag, K.C., Aung, M.H., Sanchez‐Pernaute, R., and Isacson, O. 2007. Markers and methods for cell sorting of human embryonic stem cell‐derived neural cell populations. Stem Cells 25:2257‐2268. doi: 10.1634/stemcells.2006‐0744.
  Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P., and Lim, W.A. 2013. Repurposing CRISPR as an RNA‐guided platform for sequence‐specific control of gene expression. Cell 152:1173‐1183. doi: 10.1016/j.cell.2013.02.022.
  Qiu, P., Shandilya, H., D'Alessio, J.M., O'Connor, K., Durocher, J., and Gerard, G.F. 2004. Mutation detection using Surveyor nuclease. BioTechniques 36:702‐707.
  Quail, M.A., Smith, M., Coupland, P., Otto, T.D., Harris, S.R., Connor, T.R., Bertoni, A., Swerdlow, H.P., and Gu, Y. 2012. A tale of three next generation sequencing platforms: Comparison of Ion Torrent, Pacific Biosciences and Illumina MiSeq sequencers. BMC Genomics 13:341. doi: 10.1186/1471‐2164‐13‐341.
  Rahdar, M., McMahon, M.A., Prakash, T.P., Swayze, E.E., Bennett, C.F., and Cleveland, D.W. 2015. Synthetic CRISPR RNA‐Cas9‐guided genome editing in human cells. Proc. Natl. Acad. Sci. U. S. A. 112:E7110‐7117. doi: 10.1073/pnas.1520883112.
  Ramakrishna, S., Kwaku Dad, A.B., Beloor, J., Gopalappa, R., Lee, S.K., and Kim, H. 2014. Gene disruption by cell‐penetrating peptide‐mediated delivery of Cas9 protein and guide RNA. Genome Res. 24:1020‐1027. doi: 10.1101/gr.171264.113.
  Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A., and Zhang, F. 2013b. Genome engineering using the CRISPR‐Cas9 system. Nat. Protoc. 8:2281‐2308. doi: 10.1038/nprot.2013.143.
  Ran, F.A., Hsu, P.D., Lin, C.Y., Gootenberg, J.S., Konermann, S., Trevino, A.E., Scott, D.A., Inoue, A., Matoba, S., Zhang, Y., and Zhang, F. 2013a. Double nicking by RNA‐guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154:1380‐1389. doi: 10.1016/j.cell.2013.08.021.
  Sandoe, J. and Eggan, K. 2013. Opportunities and challenges of pluripotent stem cell neurodegenerative disease models. Nat. Neurosci. 16:780‐789. doi: 10.1038/nn.3425.
  Sanjana, N.E., Shalem, O., and Zhang, F. 2014. Improved vectors and genome‐wide libraries for CRISPR screening. Nat. Methods 11:783‐784. doi: 10.1038/nmeth.3047.
  Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl, D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. 2014. Genome‐scale CRISPR‐Cas9 knockout screening in human cells. Science 343:84‐87. doi: 10.1126/science.1247005.
  Silva, S.S., Rowntree, R.K., Mekhoubad, S., and Lee, J.T. 2008. X‐chromosome inactivation and epigenetic fluidity in human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. 105:4820‐4825. doi: 10.1073/pnas.0712136105.
  Silva, G., Poirot, L., Galetto, R., Smith, J., Montoya, G., Duchateau, P., and Paques, F. 2011. Meganucleases and other tools for targeted genome engineering: Perspectives and challenges for gene therapy. Curr. Gene. Ther. 11:11‐27. doi: 10.2174/156652311794520111.
  Slaymaker, I.M., Gao, L., Zetsche, B., Scott, D.A., Yan, W.X., and Zhang, F. 2016. Rationally engineered Cas9 nucleases with improved specificity. Science 351:84‐88. doi: 10.1126/science.aad5227.
  Soares, F.A., Sheldon, M., Rao, M., Mummery, C., and Vallier, L. 2014. International coordination of large‐scale human induced pluripotent stem cell initiatives: Wellcome Trust and ISSCR workshops white paper. Stem Cell Reports 3:931‐939. doi: 10.1016/j.stemcr.2014.11.006.
  Song, M., Kim, Y.H., Kim, J.S., and Kim, H. 2014. Genome engineering in human cells. Meth. Enzymol. 546:93‐118. doi: 10.1016/B978‐0‐12‐801185‐0.00005‐2.
  Southern, E. 2006. Southern blotting. Nat. Protoc. 1:518‐525. doi: 10.1038/nprot.2006.73.
  Spits, C., Mateizel, I., Geens, M., Mertzanidou, A., Staessen, C., Vandeskelde, Y., Van der Elst, J., Liebaers, I., and Sermon, K. 2008. Recurrent chromosomal abnormalities in human embryonic stem cells. Nat. Biotechnol. 26:1361‐1363. doi: 10.1038/nbt.1510.
  Sternberg, S.H., LaFrance, B., Kaplan, M., and Doudna, J.A. 2015. Conformational control of DNA target cleavage by CRISPR‐Cas9. Nature 527:110‐113. doi: 10.1038/nature15544.
  Steyer, B., Carlson‐Stevermer, J., Angenent‐Mari, N., Khalil, A., Harkness, T., and Saha, K. 2015. High content analysis platform for optimization of lipid mediated CRISPR‐Cas9 delivery strategies in human cells. Acta Biomater. 34:143‐58.
  Suzuki, K., Yu, C., Qu, J., Li, M., Yao, X., Yuan, T., Goebl, A., Tang, S., Ren, R., Aizawa, E., Zhang, F., Xu, X., Soligalla, R.D., Chen, F., Kim, J., Kim, N.Y., Liao, H.K., Benner, C., Esteban, C.R., Jin, Y., Liu, G.H., Li, Y., and Izpisua Belmonte, J.C. 2014. Targeted gene correction minimally impacts whole‐genome mutational load in human‐disease‐specific induced pluripotent stem cell clones. Cell Stem Cell 15:31‐36. doi: 10.1016/j.stem.2014.06.016.
  Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. 2007. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861‐872. doi: 10.1016/j.cell.2007.11.019.
  Thomson, J.A., Itskovitz‐Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. 1998. Embryonic stem cell lines derived from human blastocysts. Science 282:1145‐1147. doi: 10.1126/science.282.5391.1145.
  Urnov, F.D., Rebar, E.J., Holmes, M.C., Zhang, H.S., and Gregory, P.D. 2010. Genome editing with engineered zinc finger nucleases. Nat. Rev. Genet. 11:636‐646. doi: 10.1038/nrg2842.
  Varshney, G.K., Pei, W., LaFave, M.C., Idol, J., Xu, L., Gallardo, V., Carrington, B., Bishop, K., Jones, M., Li, M., Harper, U., Huang, S.C., Prakash, A., Chen, W., Sood, R., Ledin, J., and Burgess, S.M. 2015. High‐throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome Res. 25:1030‐1042. doi: 10.1101/gr.186379.114.
  Vazin, T. and Freed, W.J. 2010. Human embryonic stem cells: Derivation, culture, and differentiation: A review. Restor. Neurol. Neurosci. 28:589‐603. doi: 10.3233/RNN‐2010‐0543.
  Veres, A., Gosis, B.S., Ding, Q., Collins, R., Ragavendran, A., Brand, H., Erdin, S., Cowan, C.A., Talkowski, M.E., and Musunuru, K. 2014. Low incidence of off‐target mutations in individual CRISPR‐Cas9 and TALEN targeted human stem cell clones detected by whole‐genome sequencing. Cell Stem Cell 15:27‐30. doi: 10.1016/j.stem.2014.04.020.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., and Jaenisch, R. 2013. One‐step generation of mice carrying mutations in multiple genes by CRISPR/Cas‐mediated genome engineering. Cell 153:910‐918. doi: 10.1016/j.cell.2013.04.025.
  Xi, L., Schmidt, J.C., Zaug, A.J., Ascarrunz, D.R., and Cech, T.R. 2015. A novel two‐step genome editing strategy with CRISPR‐Cas9 provides new insights into telomerase action and TERT gene expression. Genome Biol. 16:231. doi: 10.1186/s13059‐015‐0791‐1.
  Yanagawa, Y., Kobayashi, T., Ohnishi, M., Kobayashi, T., Tamura, S., Tsuzuki, T., Sanbo, M., Yagi, T., Tashiro, F., and Miyazaki, J. 1999. Enrichment and efficient screening of ES cells containing a targeted mutation: The use of DT‐A gene with the polyadenylation signal as a negative selection maker. Transgenic Res. 8:215‐221. doi: 10.1023/A:1008914020843.
  Yang, H., Wang, H., Shivalila, C.S., Cheng, A.W., Shi, L., and Jaenisch, R. 2013a. One‐step generation of mice carrying reporter and conditional alleles by CRISPR/Cas‐mediated genome engineering. Cell 154:1370‐1379. doi: 10.1016/j.cell.2013.08.022.
  Yang, L., Guell, M., Byrne, S., Yang, J.L., De Los Angeles, A., Mali, P., Aach, J., Kim‐Kiselak, C., Briggs, A.W., Rios, X., Huang, P.Y., Daley, G., and Church, G. 2013b. Optimization of scarless human stem cell genome editing. Nucleic Acids Res. 41:9049‐9061. doi: 10.1093/nar/gkt555.
  Yu, J., Vodyanik, M.A., Smuga‐Otto, K., Antosiewicz‐Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., Slukvin, II, and Thomson, J.A. 2007. Induced pluripotent stem cell lines derived from human somatic cells. Science (New York, N.Y.) 318:1917‐1920. doi: 10.1126/science.1151526.
  Zetsche, B., Gootenberg, J.S., Abudayyeh, O.O., Slaymaker, I.M., Makarova, K.S., Essletzbichler, P., Volz, S.E., Joung, J., van der Oost, J., Regev, A., Koonin, E.V., and Zhang, F. 2015. Cpf1 is a single RNA‐guided endonuclease of a class 2 CRISPR‐Cas system. Cell 163:759‐771. doi: 10.1016/j.cell.2015.09.038.
  Zhang, F., Wen, Y., and Guo, X. 2014a. CRISPR/Cas9 for genome editing: Progress, implications and challenges. Hum. Mol. Genet. 23:R40‐46. doi: 10.1093/hmg/ddu125.
  Zhang, Y., Ge, X., Yang, F., Zhang, L., Zheng, J., Tan, X., Jin, Z.B., Qu, J., and Gu, F. 2014b. Comparison of non‐canonical PAMs for CRISPR/Cas9‐mediated DNA cleavage in human cells. Sci. Rep. 4:5405. doi: 10.1038/srep05405.
  Zuris, J.A., Thompson, D.B., Shu, Y., Guilinger, J.P., Bessen, J.L., Hu, J.H., Maeder, M.L., Joung, J.K., Chen, Z.Y., and Liu, D.R. 2015. Cationic lipid‐mediated delivery of proteins enables efficient protein‐based genome editing in vitro and in vivo. Nat. Biotechnol. 33:73‐80. doi: 10.1038/nbt.3081.
Key References
  Doudna and Charpentier, 2014. See above.
  An excellent history of gene targeting, the history of the CRISPR/Cas9 system, and the future of CRISPR/Cas9‐mediated genome engineering.
  Ran et al., 2013b. See above.
  Protocol papers published over the last several years providing detailed instructions for carrying out gene‐targeting experiments.
  Dambournet et al., 2014. See above.
  Recent review on TALEN and CRISPR/Cas9 mediated gene targeting and the advantages and disadvantages of each method.
  Song et al., 2014. See above.
  Two other reviews providing a basic overview of the CRISPR/Cas9 system and its future applications.
  Hendriks et al., 2016. See above.
  Hsu et al., 2014. See above.
  Zhang et al., 2014a. See above.
Internet Resources
  http://crispr.mit.edu/
  CRISPR Design Tool (Feng Zhang Laboratory). This tool is useful for the design of CRISPR sgRNAs. It allows for the design of both nucleases and paired nickases. For detailed instructions of use, refer to the help tab.
  https://chopchop.rc.fas.harvard.edu/
  CHOPCHOP CRISPR Design Tool (Alex Schier laboratory). Resource for the design of sgRNAs that provides a helpful visual interface. It also provides PCR primers that can be used for the SURVEYOR assay, Sanger sequencing of the targeted region, or the in vitro cutting assay with Cas9 protein for a wide range of organisms.
  http://www.broadinstitute.org/rnai/public/analysis‐tools/sgrna‐design
  sgRNA Design Tool (Broad Institute Genetic Perturbation Platform). This sgRNA Design tool uses a distinct algorithm to predict on‐target and off‐target activity for S. pyogenes Cas9 in human and mouse genomes.
  http://www.sanger.ac.uk/htgt/wge/
  WGE (Wellcome Trust Sanger Institute Genome Editing) tool. Convenient and visually oriented tool for finding CRISPR binding sites in the mouse or human genome using recent assemblies for up‐to‐date gene annotations and off‐target prediction.
  http://www.addgene.org/CRISPR/?gclid=CjwKEAiA__C1BRDqyJOQ8_Tq230SJABWBSxnsp4uXzZ7H‐iFnJ5QRhQ8dphNCpPvuwYI0fl08tu03hoC5u7w_wcB
  Addgene CRISPR/Cas9 Plasmids and Resources. This is Addgene's page dedicated to the CRISPR/Cas9 technology. It provides basic protocols and the various versions of plasmids dozens of labs have deposited over the past several years.
  https://groups.google.com/forum/#!forum/crispr
  Google Groups: Genome Engineering using CRISPR/Cas9 Systems Forum. This Google groups forum enables users to ask questions and see other questions that others using the CRISPR/Cas9 technology have asked.
  http://www.genome‐engineering.org/crispr/
  CRISPR Genome Engineering Resources (Feng Zhang Laboratory).This page contains protocols, tools, troubleshooting tips, and other resources pertaining to CRISPR/Cas9 genome engineering.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library