Generation of Inducible shRNAi Human Embryonic Stem Cell Lines

Stuart Avery1

1 Institute of Medical Biology, A*STAR, Singapore
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 5C.1
DOI:  10.1002/9780470151808.sc05c01s18
Online Posting Date:  September, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes the generation of tetracycline‐inducible short hairpin RNA interference (shRNAi) human embryonic stem cell (hESC) lines. Using this vector‐based approach enables stable and long‐term expression of target hairpins under the control of doxycycline/tetracycline. Target degradation can be controlled in both a dose‐ and time‐dependent manner that can even be switched off, depending upon the particular requirements of the study. Curr. Protoc. Stem Cell Biol. 18:5C.1.1‐5C.1.14. © 2011 by John Wiley & Sons, Inc.

Keywords: RNA interference; shRNAi; tetracycline; doxycycline; inducible; human embryonic stem cells (hESCs); stable transfection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Design and Cloning of RNAi Targets
  • Basic Protocol 2: Generation and Screening of Stable Clones Expressing TetR Protein and Target shRNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Design and Cloning of RNAi Targets

  Materials
  • pSUPERIOR.neo (Oligoengine)
  • Target specific sense and anti‐sense oligonucleotides at 200 µM (see annotations to step 2, below)
  • 5× annealing buffer (see recipe)
  • Restriction endonucleases BglII and XhoI (New England Biolabs)
  • NEBuffer 3 (New England Biolabs)
  • 10× (1 mg/ml) bovine serum albumin (BSA)
  • 1% agarose gel prepared with TAE or TBE buffer (Voytas, )
  • Gel‐extraction kit (Qiagen)
  • 10 mM Tris⋅Cl, pH 8.5 (or elution buffer from Qiagen gel‐extraction kit)
  • T4 DNA ligase (New England Biolabs) and ligase buffer
  • Electrocompetent or chemically competent bacterial host strain such as DH5α
  • LB agar plates (see recipe) containing 100 µg/ml ampicillin
  • PCR primers (use at 0.3 µM each primer):
    • pSUPERIOR sense: agaattcgaacgctgacgtc
    • pSUPERIOR antisense: ggaacaaaagctgggtaccg
  • Taq DNA polymerase (New England Biolabs)
  • DNA miniprep or maxi prep kit
  • Oligoengine 2.0 software (http://www.oligoengine.com/products/oe2.html)
  • Thermal cycler
  • Spectrophotometer
  • 16°C water bath
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and transformation of bacteria (Seidman et al., )

Basic Protocol 2: Generation and Screening of Stable Clones Expressing TetR Protein and Target shRNA

  Materials
  • Human embryonic stem cells (hESCs; unit 1.5)
  • mTeSR1 medium (StemCell Technologies)
  • 10 mM Y‐27632 dihydrochloride monohydrate stock solution (Sigma‐Aldrich, mol. wt. 338.27); dissolve 1 mg in 295.5 µl sterile distilled H 2O and store in aliquots at 70°C
  • Dulbecco's phosphate‐buffered saline (DPBS; Invitrogen, cat. no. 14190)
  • Accutase (Invitrogen)
  • Amaxa Human Stem Cell Nucleofector Kit 1 or 2 (see below; Lonza)
  • pCAGTetRnls vector (Addgene, cat. no. 26599)
  • 10 mg/ml puromycin stock solution (Invitrogen)
  • 1 mg/ml collagenase IV solution (see recipe)
  • DMEM/F12 1:1 medium (Invitrogen)
  • Mouse TET‐02 anti‐TetR (MoBiTec, http://www.mobitec.com/)
  • Donkey anti‐mouse‐HRP conjugated secondary antibody (Santa Cruz Biotechnology)
  • pSUPERIOR vector containing a target‐specific shRNAi sequence ( protocol 1)
  • 50 mg/ml Geneticin stock solution (Invitrogen)
  • Doxycycline working stock (see recipe)
  • Matrigel‐coated (see recipe) 12.5‐cm2 tissue culture flasks and 12‐well plates (6‐cm2 tissue culture dishes optional; BD Falcon)
  • Centrifuge and centrifuge tubes
  • Nucleofector device and cuvettes (Lonza)
  • Extra‐fine tipped Pasteur pipets (Alpha Laboratories; http://www.alphalabs.co.uk/)
  • Additional reagents and equipment for generating and passaging hESCs (unit 1.5), counting cells (unit 1.3), and immunoblotting (Gallagher et al., ; Zafarana et al., )
NOTE: All cell culture work should be performed following good aseptic technique in a Class II biological hazard flow hood or laminar‐flow hood.NOTE: All incubations are performed in a 37°C, 5% CO 2 humidified incubator, unless otherwise noted.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Avery, S., Zafarana, G., Gokhale, P.J., and Andrews, P.W. 2010. The role of SMAD4 in human embryonic stem cell self‐renewal and stem cell fate. Stem Cells 28:863‐873.
   Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K., and Tuschl, T. 2001. Duplexes of 21‐nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411:494‐498.
   Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., and Mello, C.C. 1998. Potent and specific genetic interference by double‐stranded RNA in Caenorhabditis elegans. Nature 391:806‐811.
   Gallagher, S., Winston, S.E., Fuller, S.A., and Hurrell, J.G. 2008. Immunoblotting and immunodetection. Curr. Protoc. Immunol. 83:8.10.1‐8.10.28.
   Gossen, M. and Bujard, H. 1992. Tight control of gene expression in mammalian cells by tetracycline‐responsive promoters. Proc. Natl. Acad. Sci. U.S.A. 89:5547‐5551.
   Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. 1995. Transcriptional activation by tetracyclines in mammalian cells. Science 268:1766‐1769.
   Hannon, G.J. 2002. RNA interference. Nature 418:244‐251.
   Hohenstein, K.A., Pyle, A.D., Chern, J.Y., Lock, L.F., and Donovan, P.J. 2008. Nucleofection mediates high‐efficiency stable gene knockdown and transgene expression in human embryonic stem cells. Stem Cells 26:1436‐1443.
   Lee, Y.J., Nah, H.Y., Hong, S.H., Lee, J.W., Jeon, I., Pak, J.H., Huh, J.R., Kim, S.H., Chae, H.D., Kang, B.M., Kim, C.G., and Kim, C.H. 2008. Spa‐1 regulates the maintenance and differentiation of human embryonic stem cells. Int. J. Dev. Biol. 52:43‐53.
   McManus, M.T. and Sharp, P.A. 2002. Gene silencing in mammals by small interfering RNAs. Nat. Rev. Genet. 3:737‐747.
   McManus, M.T., Petersen, C.P., Haines, B.B., Chen, J., and Sharp, P.A. 2002. Gene silencing Using micro‐RNA designed hairpins. RNA 8:842‐850.
   Paddison, P.J., Caudy, A.A., Bernstein, E., Hannon, G.J., and Conklin, D.S. 2002. Short hairpin RNAs (shRNAs) induce sequence‐specific silencing in mammalian cells. Genes Dev. 16:948‐958.
   Paul, C.P., Good, P.D., Winer, I., and Engelke, D.R. 2002. Effective expression of small interfering RNA in human cells. Nat. Biotechnol. 20:505‐508.
   Rodriguez, R.T., Velkey, J.M., Lutzko, C., Seerke, R., Kohn, D.B., O'Shea, K.S., and Firpo, M.T. 2007. Manipulation of OCT4 levels in human embryonic stem cells results in induction of differential cell types. Exp. Biol. Med. 232:1368‐1380.
   Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 2001. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 3:1.8.1‐1.8.10.
   van de Wetering, M., Oving, I., Muncan, V., Pon Fong, M.T., Brantjes, H., van Leenen, D., Holstege, F.C., Brummelkamp, T.R., Agami, R., and Clevers, H. 2003. Specific inhibition of gene expression using a stably integrated, inducible small‐interfering‐RNA vector. EMBO Rep. 4:609‐615.
   Vieyra, D.S. and Goodell, M.A. 2007. Pluripotentiality and conditional transgene regulation in human embryonic stem cells expressing insulated tetracycline‐ON transactivator. Stem Cells 25:2559‐2566.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Zafarana, G., Avery, S.R., Avery, K., Moore, H.D., and Andrews, P.W. 2009. Specific knockdown of OCT4 in human embryonic stem cells by inducible short hairpin RNA interference. Stem Cells 27:776‐782.
   Zhou, B.Y., Ye, Z., Chen, G., Gao, Z.P., Zhang, Y.A., and Cheng, L. 2007. Inducible and reversible transgene expression in human stem cells after efficient and stable gene transfer. Stem Cells 25:779‐789.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library