Conditional Manipulation of Gene Function in Human Cells with Optimized Inducible shRNA

Alessandro Bertero1, Loukia Yiangou2, Stephanie Brown3, Daniel Ortmann3, Matthias Pawlowski4, Ludovic Vallier5

1 Department of Pathology, University of Washington, Seattle, Washington, 2 Division of Cardiovascular Medicine, University of Cambridge, Cambridge, 3 Department of Surgery, University of Cambridge, Cambridge, 4 Department of Clinical Neuroscience, University of Cambridge, Cambridge, 5 Wellcome Trust Sanger Institute, Hinxton
Publication Name:  Current Protocols in Stem Cell Biology
Unit Number:  Unit 5C.4
DOI:  10.1002/cpsc.45
Online Posting Date:  February, 2018
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library


The difficulties involved in conditionally perturbing complex gene expression networks represent major challenges toward defining the mechanisms controlling human development, physiology, and disease. We developed an OPTimized inducible KnockDown (OPTiKD) platform that addresses the limitations of previous approaches by allowing streamlined, tightly‐controlled, and potent loss‐of‐function experiments for both single and multiple genes. The method relies on single‐step genetic engineering of the AAVS1 genomic safe harbor with an optimized tetracycline‐responsive cassette driving one or more inducible short hairpin RNAs (shRNAs). OPTiKD provides homogeneous, dose‐responsive, and reversible gene knockdown. When implemented in human pluripotent stem cells (hPSCs), the approach can be then applied to a broad range of hPSC‐derived mature cell lineages that include neurons, cardiomyocytes, and hepatocytes. Generation of OPTiKD hPSCs in commonly used culture conditions is simple (plasmid based), rapid (two weeks), and highly efficient (>95%). Overall, this method facilitates the functional annotation of the human genome in health and disease. © 2018 by John Wiley & Sons, Inc.

Keywords: knockdown; shRNA; human pluripotent stem cells; gene editing

PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Design of Oligonucleotides for shRNA Cloning
  • Basic Protocol 2: Generation of Inducible shRNA Targeting Vector
  • Alternate Protocol 1: Generation of Several Inducible shRNA Targeting Vector in Parallel
  • Support Protocol 1: Generation of Targeting Vector with Multiple Inducible shRNAs
  • Basic Protocol 3: Generation of OPTiKD hPSCs
  • Support Protocol 2: Clonal Isolation and Genotyping of OPTiKD hPSCs
  • Basic Protocol 4: Validation of OPTiKD hPSCs
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
PDF or HTML at Wiley Online Library


Basic Protocol 1: Design of Oligonucleotides for shRNA Cloning

  • SnapGene software (GSL Biotech LLC)

Basic Protocol 2: Generation of Inducible shRNA Targeting Vector

  • pAAV‐Puro_siKD plasmid [Addgene, cat. no. 86695; alternatively contact the corresponding authors ( ; )]
  • FastDigest BglII (ThermoFisher, cat. no. FD0083)
  • FastDigest SalI (ThermoFisher, cat. no. FD0644)
  • FastAP Thermosensitive Alkaline Phosphatase (1 U/µl; ThermoFisher, cat. no. EF0654)
  • 10× FastDigest Green Buffer (ThermoFisher, cat. no. B72)
  • Ultrapure DNase/RNase‐free distilled water (ThermoFisher, cat. no. 10977015)
  • 6× gel loading dye (New England Biolabs, cat. no. B7024S)
  • 1% (w/v) agarose gel in TBE containing 0.5 μg/ml ethidium bromide (see recipe; use molecular biology grade agarose; ThermoFisher, cat. no. 17850)
  • 1 Kb plus DNA ladder (ThermoFisher, cat. no. 10787018)
  • QIAEX II Gel Extraction Kit (Qiagen, cat. no. 20021)
  • “Top” single‐stranded oligonucleotide for shRNA (custom oligonucleotide; protocol 1, step 8)
  • “Bottom” single‐stranded oligonucleotide for shRNA (custom oligonucleotide; protocol 1, step 8)
  • T4 DNA Ligase Reaction Buffer (New England Biolabs, cat. no. B0202S)
  • T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201S)
  • 4% (w/v) agarose gel in TBE containing 0.5 μg/ml ethidium bromide (see recipe; use UltraPure Low Melting Point Agarose; ThermoFisher, cat. no. 16520050)
  • Rapid DNA Ligation Kit (ThermoFisher, cat. no. K1422)
  • α‐select Gold Efficiency E. coli (Bioline, cat. no. BIO‐85027)
  • SOC medium (ThermoFisher, cat. no. 15544034)
  • LB agar plates containing 100 µg/ml ampicillin (see recipe)
  • siKD_fw primer (custom oligonucleotide, see Table 5.4.1)
  • siKD_rev primer (custom oligonucleotide, see Table 5.4.1)
  • dNTP mix (Promega, cat. no. U1511)
  • GoTaq Flexi DNA Polymerase (Promega, cat. no. M8291)
  • Luria Bertani (LB) broth containing 100 µg/ml ampicillin (see recipe)
  • 1.5% (w/v) agarose gel in TBE containing 0.5 μg/ml ethidium bromide (see recipe; use standard molecular biology grade agarose)
  • QIAprep Spin Miniprep Kit (Qiagen, cat. no. 27104)
  • Glycerol for molecular biology, >99% (Sigma‐Aldrich, cat. no. G5516‐100ML)
  • QIAfilter Plasmid Midi Kit (Qiagen, cat. no. 12243)
Table 5.0.1   MaterialsOligonucleotides for Cloning Experiments

Primer name Sequence (5′ → 3′)
Generation of inducible shRNA targeting vector (Basic protocol 2)
Generation of vector with multiple inducible shRNAs (Support protocol 1)

 aThe 3′‐most common portion of each forward primer is: 5′‐CGAACGCTGACGTCATCAAC‐3′. The 5′‐most portion is specific to the desired overlap to be created following PCR amplification (Table 5C.4.2).
 bThe 3′‐most common portion of each reverse primer is: 5′‐GTAACGCGGAACTCCATATATGG‐3′. The 5′‐most portion is specific to the desired overlap to be created following PCR amplification (Table 5C.4.2).
  • UV transilluminator
  • PCR tubes
  • Thermocycler with heated lid
  • Heated water bath
  • Humidified bacterial incubator
  • Sanger sequencing facility (or commercial provider)
  • Bacterial culture orbital shaker
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Alternate Protocol 1: Generation of Several Inducible shRNA Targeting Vector in Parallel

  Additional Materials (also see protocol 2)
  • MicroAmp Optical 96‐Well Reaction Plate (ThermoFisher, cat. no. N8010560)
  • MicroAmp Clear Adhesive Film (ThermoFisher, cat. no. 4306311)
  • 8 or 12‐channel pipettor appropriate for volumes between 1 and 200 µl
  • Sterilin 100‐mm Square Petri Dishes, 25 Compartments (Dynalon, cat. no. 8700‐0357
  • ColiRollers Plating Beads (Novagen, cat. no. 71013‐3)

Support Protocol 1: Generation of Targeting Vector with Multiple Inducible shRNAs

  • pAAV‐Puro_siKD plasmid [Addgene, cat. no. 86695; alternatively contact the corresponding authors ( ; )]
  • FastDigest Bsp119I (ThermoFisher, cat. no. FD0124)
  • FastDigest HincII (ThermoFisher, cat. no. FD0494)
  • pAAV‐Puro_siKD‐shRNA (with custom shRNAs of interest; protocol 2)
  • Q5 Hot Start High‐Fidelity 2× Master Mix (New England Biolabs, cat. no. M0494S)
  • 5′_fw (custom oligonucleotide, see Table 5.4.1)
  • BL1_fw (custom oligonucleotide, see Table 5.4.1)
  • BL2_fw (custom oligonucleotide, see Table 5.4.1)
  • BL1_rev (custom oligonucleotide, see Table 5.4.1)
  • BL2_rev (custom oligonucleotide, see Table 5.4.1)
  • 3′_rev (custom oligonucleotide, see Table 5.4.1)
  • QIAquick PCR Purification Kit (Qiagen, 28104)
  • 1.5% (w/v) agarose gel in TBE containing 0.5 μg/ml ethidium bromide (see recipe)
  • NEBuilder HiFi DNA Assembly Cloning Kit (New England Biolabs, cat. no. E5520S)
  • MsiKD_fw (custom oligonucleotide, see Table 5.4.1)
  • BL1seq_fw (custom oligonucleotide, see Table 5.4.1)
  • BL2seq_fw (custom oligonucleotide, see Table 5.4.1)
  • MsiKD_rev (custom oligonucleotide, see Table 5.4.1)
  • FastDigest NdeI (ThermoFisher, cat. no. FD0583)
Additional reagents and equipment for molecular cloning experiments (see Basic Protocol 2)

Basic Protocol 3: Generation of OPTiKD hPSCs

  • Human pluripotent stem cells (hPSCs; user specific; see appropriate units in this manual)
  • Complete Essential 8 (E8) medium (see recipe)
  • Opti‐MEM reduced serum medium with GlutaMAX (ThermoFisher, cat. no. 51985034)
  • Dulbecco's phosphate‐buffered saline (DPBS) without calcium and magnesium (ThermoFisher, cat. no. 14190250)
  • Versene solution (ThermoFisher, cat. no. 15040066)
  • 10 mM Y‐27632 stock solution (see recipe)
  • 0.4% trypan blue (ThermoFisher, cat. no. 15250061)
  • GeneJuice transfection reagent (EMD Millipore, cat. no. 70967)
  • pZFN_AAVS1‐R‐KKR [contact the corresponding authors ( ; )]
  • pZFN_AAVS1‐L‐ELD [contact the corresponding authors ( ; )]
  • pAAV‐Puro_siKD‐shRNA or pAAV‐Puro_MsiKD‐shRNAs ( protocol 2, Alternate Protocol, or protocol 4)
  • AAVS1‐CAGGS‐EGFP (Addgene, cat. no. 22212)
  • 10 mg/ml puromycin dihydrochloride (Sigma Aldrich, cat. no. P9620‐10ML)
  • Recombinant human Laminin‐521‐coated 6‐well culture plates (see recipe)
  • 15‐ml conical centrifuge tubes
  • Inverted microscope equipped with fluorescent lamp and filters for FITC (EGFP) detection
  • Hemacytometer
Additional reagents and equipments for culture of human pluripotent stem cells (Costa et al., )

Support Protocol 2: Clonal Isolation and Genotyping of OPTiKD hPSCs

  • OPTiKD colonies ( protocol 5)
  • DNeasy Blood & Tissue Kit (Qiagen, cat. no. 69504)
  • LongAmp Taq DNA Polymerase (New England Biolabs, cat. no. M0323S)
  • 10 mM dNTP mix (Promega, cat. no. U1511)
  • Locus_fw (custom oligonucleotide, see Table 5.4.4)
  • Locus_rev (custom oligonucleotide, see Table 5.4.4)
  • OPTtetR_fw (custom oligonucleotide, see Table 5.4.4)
  • Puro_rev (custom oligonucleotide, see Table 5.4.4)
  • Puro_rev2 (custom oligonucleotide, see Table 5.4.4)
  • Backbone_fw (custom oligonucleotide, see Table 5.4.4)
  • Backbone_rev (custom oligonucleotide, see Table 5.4.4)
  • Dimethyl sulfoxide (DMSO), PCR‐grade (Sigma Aldrich, cat. no. D9170)
  • 1% (w/v) agarose gel in TBE containing 0.5 μg/ml ethidium bromide (see recipe; use molecular biology grade agarose; ThermoFisher, cat. no. 10787018)
Table 5.0.4   MaterialsPrimers for Genotyping of OPTiKD Clonal Lines

PCR type Primer name Primer location Primer sequence (5′ → 3′) Amplicon wild‐type aa Amplicon target b Amplicon plasmid c Temp. ann d Ext. time d
Locus Locus_fw Genomic, 5′ to 5′ HA CTGTTTCCCCTTCC CAGGCAGGTCC 1692 bp No band No band 65°C 1′ 30”
5′ INT Locus_fw Genomic, 5′ to 5′ HA CTGTTTCCCCTT CCCAGGCAGGTCC No band 991 bp No band 65°C 1′
Puro_rev Puromycin resistance TCGTCGCGGGTGGC GAGGCGCACCG
3′‐INT OPTTetR_fw OPTtetR cDNA CCACCGAGAA GCAGTACGAG No band 1447 bp No band 60°C 1′ 30”
5′‐BB Backbone_fw Backbone, 5′ to 5′ HA ATGCTTCCGGCTC GTATGTT No band No band 1227 bp 60°C 1′ 30”
Puro_rev2 Puromycin resistance TGAGGAAGAGTTC TTGCAGCTC
3′‐BB OPTTetR_fw OPTtetR cDNA CCACCGAGAAGC AGTACGAG No band No band 1802 bp 60°C 2′
Backbone_rev Backbone, 3′ to 3′ HA ATGCACCACCGGG TAAAGTT

 aResult of PCR on wild‐type AAVS1 allele.
 bResult of PCR on OPTiKD‐targeted AAVS1 allele.
 cResult of PCR on targeting vector (positive control for off‐target plasmid integration).
 dVariable parameter in PCR protocol (step 14 of protocol 6).
  • Recombinant human Laminin‐521‐coated 12‐well culture plates (see recipe)
  • Permanent marking pen
  • 8‐ or 12‐channel pipettor appropriate for volumes between 2 and 7 µl
  • MicroAmp Optical 96‐Well Reaction Plate (ThermoFisher, cat. no. N8010560)
  • MicroAmp Clear Adhesive Film (ThermoFisher, cat. no. 4306311)
  • Additional reagents and equipment for agarose gel electrophoresis and hPSC culture (see Basic Protocols protocol 22 and protocol 53; Voytas, ; Costa et al., )

Basic Protocol 4: Validation of OPTiKD hPSCs

  • Tetracycline hydrochloride (Sigma‐Aldrich, cat. no. T7660; see recipe for stock solution)
PDF or HTML at Wiley Online Library



Literature Cited

Literature Cited
  Avior, Y., Sagi, I., & Benvenisty, N. (2016). Pluripotent stem cells in disease modelling and drug discovery. Nature Reviews, Molecular Cell Biology, 17, 170–182. doi: 10.1038/nrm.2015.27
  Bertero, A., Pawlowski, M., Ortmann, D., Snijders, K., Yiangou, L., Cardoso de Brito, M., … Vallier, L. (2016). Optimized inducible shRNA and CRISPR/Cas9 platforms for in vitro studies of human development using hPSCs. Development, 143143, 4405–4418. doi: 10.1242/dev.138081.
  Boettcher, M., & McManus, M. T. (2015). Choosing the right tool for the job: RNAi, TALEN, or CRISPR. Molecular Cell, 58, 575–585. doi: 10.1016/j.molcel.2015.04.028.
  Boudreau, R. L., Martins, I., & Davidson, B. L. (2009). Artificial MicroRNAs as siRNA shuttles: Improved safety as compared to shRNAs in vitro and in vivo. Molecular Therapy, 17, 169–175. doi: 10.1038/mt.2008.231.
  Brummelkamp, T. R., Bernards, R., & Agami, R. (2002). A system for stable expression of short interfering RNAs in mammalian cells. Science, 296, 550–553. doi: 10.1126/science.1068999.
  Cao, F., Xie, X., Gollan, T., Zhao, L., Narsinh, K., Lee, R. J., & Wu, J. C. (2010). Comparison of gene‐transfer efficiency in human embryonic stem cells. Molecular Imaging and Biology, 12, 15–24. doi: 10.1007/s11307‐009‐0236‐x.
  Chatzispyrou, I. A., Held, N. M., Mouchiroud, L., Auwerx, J., & Houtkooper, R. H. (2015). Tetracycline antibiotics impair mitochondrial function and its experimental use confounds research. Cancer Research, 75, 4446–4449. doi: 10.1158/0008‐5472.CAN‐15‐1626.
  Chen, G., Gulbranson, D. R., Hou, Z., Bolin, J. M., Ruotti, V., Probasco, M. D., … Thomson, J. A. (2011). Chemically defined conditions for human iPSC derivation and culture. Nature Methods, 8, 424–429. doi: 10.1038/nmeth.1593.
  Chen, Y., Cao, J., Xiong, M., Petersen, A. J., Dong, Y., Tao, Y., … Zhang, S.‐C. (2015). Engineering human stem cell lines with inducible gene knockout using CRISPR/Cas9. Cell Stem Cell, 17, 233–244. doi: 10.1016/j.stem.2015.06.001.
  Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., … Zhang, F. (2013). Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823. doi: 10.1126/science.1231143.
  Cooper, G. M., & Shendure, J. (2011). Needles in stacks of needles: Finding disease‐causal variants in a wealth of genomic data. Nature Review, Genetics, 12, 628–640. doi: 10.1038/nrg3046.
  Costa, M., Dottori, M., Sourris, K., Jamshidi, P., Hatzistavrou, T., Davis, R., … Stanley, E. G. (2007). A method for genetic modification of human embryonic stem cells using electroporation. Nature Protocols, 2, 792–796. doi: 10.1038/nprot.2007.105.
  Costa, M., Sourris, K., Hatzistavrou, T., Elefanty, A. G., Stanley, E. G., Costa, M., … Stanley, E. G. (2008). Expansion of Human Embryonic Stem Cells In Vitro. In Current Protocols in Stem Cell Biology p. 1C.1.1–1C.1.7. John Wiley & Sons, Inc., Hoboken, NJ, USA. doi: 10.1002/9780470151808.sc01c01s5.
  Cullen, B. R. (2006). Enhancing and confirming the specificity of RNAi experiments. Nature Methods, 3, 677–681. doi: 10.1038/nmeth913.
  DeKelver, R. C., Choi, V. M., Moehle, E. a, Paschon, D. E., Hockemeyer, D., Meijsing, S. H., … Urnov, F. D. (2010). Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease‐driven transgenesis into a safe harbor locus in the human genome. Genome Research, 20, 1133–1142. doi: 10.1101/gr.106773.110.
  Doyon, Y., Vo, T. D., Mendel, M. C., Greenberg, S. G., Wang, J., Xia, D. F., … Holmes, M. C. (2011). Enhancing zinc‐finger‐nuclease activity with improved obligate heterodimeric architectures. Nature Methods, 8, 74–79. doi: 10.1038/nmeth.1539.
  Drost, J., van Jaarsveld, R. H., Ponsioen, B., Zimberlin, C., van Boxtel, R., Buijs, A., … Urnov, F. D. (2015). Sequential cancer mutations in cultured human intestinal stem cells. Nature, 521, 43–47. doi: 10.1038/nature14415.
  Ellis, J. (2005). Silencing and variegation of gammaretrovirus and lentivirus vectors. Human Gene Therapy, 16, 1241–1246. doi: 10.1089/hum.2005.16.1241.
  Fakhr, E., Zare, F., & Teimoori‐Toolabi, L. (2016). Precise and efficient siRNA design: A key point in competent gene silencing. Cancer Gene Therapy, 23, 73–82. doi: 10.1038/cgt.2016.4.
  Fath, S., Bauer, A. P., Liss, M., Spriestersbach, A., Maertens, B., Hahn, P., … Wagner, R. (2011). Multiparameter RNA and codon optimization: A standardized tool to assess and enhance autologous mammalian gene expression. PloS One, 6, e17596. doi: 10.1371/journal.pone.0017596.
  Fogarty, N. M. E., McCarthy, A., Snijders, K. E., Powell, B. E., Kubikova, N., Blakeley, P., … Niakan, K. K. (2017). Genome editing reveals a role for OCT4 in human embryogenesis. Nature, 550, 67–73. doi: 10.1038/nature24033.
  Gaj, T., Gersbach, C. A., & Barbas, C. F. (2013). ZFN, TALEN, and CRISPR/Cas‐based methods for genome engineering. Trends in Biotechnology, 31, 397–405. doi: 10.1016/j.tibtech.2013.04.004.
  Gibson, D. G., Young, L., Chuang, R.‐Y., Venter, J. C., Hutchison, C. A., & Smith, H. O. (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nature Methods, 6, 343–345. doi: 10.1038/nmeth.1318.
  González, F., Zhu, Z., Shi, Z.‐D., Lelli, K., Verma, N., Li, Q. V., & Huangfu, D. (2014). An iCRISPR Platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells. Cell Stem Cell, 15, 215–226. doi: 10.1016/j.stem.2014.05.018.
  Gray, D. C., Hoeflich, K. P., Peng, L., Gu, Z., Gogineni, A., Murray, L. J., … Davis, D. P. (2007). pHUSH: A single vector system for conditional gene expression. BMC Biotechnology, 7, 61. doi: 10.1186/1472‐6750‐7‐61.
  Grimm, D., Streetz, K. L., Jopling, C. L., Storm, T. A., Pandey, K., Davis, C. R., … Kay, M. A. (2006). Fatality in mice due to oversaturation of cellular microRNA/short hairpin RNA pathways. Nature, 441, 537–541. doi: 10.1038/nature04791.
  Haenebalcke, L., Goossens, S., Naessens, M., Kruse, N., Farhang Ghahremani, M., Bartunkova, S., … Haigh, J. J., (2013). Efficient ROSA26‐based conditional and/or inducible transgenesis using RMCE‐compatible F1 hybrid mouse embryonic stem cells. Stem Cell Reviews, 9, 774–785. doi: 10.1007/s12015‐013‐9458‐z.
  Henriksen, J. R., Løkke, C., Hammerø, M., Geerts, D., Versteeg, R., Flaegstad, T., & Einvik, C. (2007). Comparison of RNAi efficiency mediated by tetracycline‐responsive H1 and U6 promoter variants in mammalian cell lines. Nucleic Acids Research, 35, e67. doi: 10.1093/nar/gkm193.
  Herbst, F., Ball, C. R., Tuorto, F., Nowrouzi, A., Wang, W., Zavidij, O., … Glimm, H. (2012). Extensive methylation of promoter sequences silences lentiviral transgene expression during stem cell differentiation in vivo. Molecular Therapy, 20, 1014–1021. doi: 10.1038/mt.2012.46.
  Hockemeyer, D., Soldner, F., Beard, C., Gao, Q., Mitalipova, M., DeKelver, R. C., … Jaenisch, R. (2009). Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc‐finger nucleases. Nature Biotechnology, 27, 851–857. doi: 10.1038/nbt.1562.
  Hockemeyer, D., Wang, H., Kiani, S., Lai, C. S., Gao, Q., Cassady, J. P., … Jaenisch, R. (2011). Genetic engineering of human pluripotent cells using TALE nucleases. Nature Biotechnology, 29, 731–734. doi: 10.1038/nbt.1927.
  Jackson, A. L., Bartz, S. R., Schelter, J., Kobayashi, S. V., Burchard, J., Mao, M., … Linsley, P. S. (2003). Expression profiling reveals off‐target gene regulation by RNAi. Nature Biotechnology, 21, 635–637. doi: 10.1038/nbt831.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816–821. doi: 10.1126/science.1225829.
  Joung, J. K., & Sander, J. D. (2013). TALENs: A widely applicable technology for targeted genome editing. Nature Reviews, Molecular Cell Biology, 14, 49–55. doi: 10.1038/nrm3486.
  Kappel, S., Matthess, Y., Kaufmann, M., & Strebhardt, K. (2007). Silencing of mammalian genes by tetracycline‐inducible shRNA expression. Nature Protocols, 2, 3257–3269. doi: 10.1038/nprot.2007.458.
  Kim, H., & Kim, J. S. (2014). A guide to genome engineering with programmable nucleases. Nature Reviews, Genetics, 15, 321–334. doi: 10.1038/nrg3686.
  Krishnan, M., Park, J. M., Cao, F., Wang, D., Paulmurugan, R., Tseng, J. R., … Wu, J. C. (2006). Effects of epigenetic modulation on reporter gene expression: Implications for stem cell imaging. FEBS Journal, 20, 106–108. doi: 10.1096/fj.05‐4551fje.
  Kun, Q., Tzu‐Ling, H., Hong, C., Lisle, W. B., Yuejun, C., Jingyuan, C., … Su‐Chun, Z. (2014). A simple and efficient system for regulating gene expression in human pluripotent stem cells and derivatives. Stem Cells, 32, 1230–1238. doi: 10.1002/stem.1653.
  Lambeth, L. S., & Smith, C. A. (2013). Short hairpin RNA‐mediated gene silencing. Methods in Molecular Biology, 942, 205–232. doi: 10.1007/978‐1‐62703‐119‐6_12.
  Laperle, A., Hsiao, C., Lampe, M., Mortier, J., Saha, K., Palecek, S. P., & Masters, K. S. (2015). α‐5 laminin synthesized by human pluripotent stem cells promotes self‐renewal. Stem Cell Reports, 5, 195–206. doi: 10.1016/j.stemcr.2015.06.009.
  Lian, X., Hsiao, C., Wilson, G., Zhu, K., Hazeltine, L. B., Azarin, S. M., … Palecek, S. P. (2012). Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. PNAS, 109, E1848–57. doi: 10.1073/pnas.1200250109.
  Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) method. Methods, 25, 402–408. doi: 10.1006/meth.2001.1262.
  Lu, H. F., Chai, C., Lim, T. C., Leong, M. F., Lim, J. K., Gao, S., … Wan, A. C. A. (2014). A defined xeno‐free and feeder‐free culture system for the derivation, expansion and direct differentiation of transgene‐free patient‐specific induced pluripotent stem cells. Biomaterials, 35, 2816–2826. doi: 10.1016/j.biomaterials.2013.12.050.
  Luo, C., Lü, D., Pan, J., & Long, M. (2016). Improving the gene transfection in human embryonic stem cells: Balancing with cytotoxicity and pluripotent maintenance. ACS Applied Materials & Interfaces, 8, 8367–8375. doi: 10.1021/acsami.6b00353.
  Ma, H., Wu, Y., Dang, Y., Choi, J.‐G., Zhang, J., & Wu, H. (2014). Pol III promoters to express small RNAs: delineation of transcription initiation. Molecular Therapy, 3, e161. doi: 10.1038/mtna.2014.12.
  Mali, P., Yang, L., Esvelt, K. M., Aach, J., Guell, M., DiCarlo, J. E., … Church, G. M. (2013). RNA‐guided human genome engineering via Cas9. Science, 339, 823–826. doi: 10.1126/science.1232033.
  Mandal, P. K., Ferreira, L. M. R., Collins, R., Meissner, T. B., Boutwell, C. L., Friesen, M., … Cowan, C. A. (2014). Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell Stem Cell, 15, 643–652. doi: 10.1016/j.stem.2014.10.004.
  Mandegar, M. A., Huebsch, N., Frolov, E. B., Shin, E., Truong, A., Olvera, M. P., … Conklin, B. R. (2016). CRISPR interference efficiently induces specific and reversible gene silencing in human iPSCs. Cell Stem Cell, 18, 541–553. doi: 10.1016/j.stem.2016.01.022.
  Massé, J., Piquet‐Pellorce, C., Viet, J., Guerrier, D., Pellerin, I., & Deschamps, S. (2011). ZFPIP/Zfp462 is involved in P19 cell pluripotency and in their neuronal fate. Experimental Cell Research, 317, 1922–1934. doi: 10.1016/j.yexcr.2011.04.015.
  Miyazaki, J., Satoshi, T., Araki, K., Tashiro, F., Tominaga, A., Takatsu, K., & Yamamura, K.‐I. (1989). Expression vector system based on the chicken beta‐actin promoter directs efficient production of interleukin‐5. Gene, 79, 269–277. doi: 10.1016/0378‐1119(89)90209‐6.
  Moffat, J., Grueneberg, D. A., Yang, X., Kim, S. Y., Kloepfer, A. M., Hinkle, G., … Root, D. E. (2006). A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high‐content screen. Cell, 124, 1283–1298. doi: 10.1016/j.cell.2006.01.040.
  Moullan, N., Mouchiroud, L., Wang, X., Ryu, D., Williams, E., Mottis, A., … Auwerx, J. (2015). Tetracyclines disturb mitochondrial function across eukaryotic models: A call for caution in biomedical research. Cell Reports, 10, 1681–1691. doi: 10.1016/j.celrep.2015.02.034.
  Nakagawa, S., & Cuthill, I. C. (2007). Effect size, confidence interval and statistical significance: A practical guide for biologists. Biological Reviews of the Cambridge Philosophical Society, 82, 591–605. doi: 10.1111/j.1469‐185X.2007.00027.x.
  Oceguera‐Yanez, F., Kim, S. Il, Matsumoto, T., Tan, G. W., Xiang, L., Hatani, T., … Woltjen, K. (2016). Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Methods, 101, 43–55. doi: 10.1016/j.ymeth.2015.12.012.
  Ordovas, L., Boon, R., Pistoni, M., Chen, Y., Wolfs, E., Guo, W., … Verfaillie, C. M. (2015). Efficient recombinase‐mediated cassette exchange in hPSCs to study the hepatocyte lineage reveals AAVS1 locus‐mediated transgene inhibition. Stem Cell Reports, 5, 918–931. doi: 10.1016/j.stemcr.2015.09.004.
  Ott, M. G., Schmidt, M., Schwarzwaelder, K., Stein, S., Siler, U., Koehl, U., … Grez, M. (2006). Correction of X‐linked chronic granulomatous disease by gene therapy, augmented by insertional activation of MDS1‐EVI1, PRDM16 or SETBP1. Nature Medicine, 12, 401–409. doi: 10.1038/nm1393.
  Pawlowski, M., Ortmann, D., Bertero, A., Tavares, J. M., Pedersen, R. A., Vallier, L., … Kotter, M. (2017). Inducible and deterministic forward programming of human pluripotent stem cells into neurons, skeletal myocytes, and oligodendrocytes. Stem Cell Reports, 8, 803–812. doi: 10.1016/j.stemcr.2017.02.016.
  Pei, Y., & Tuschl, T. (2006). On the art of identifying effective and specific siRNAs. Nature Methods, 3, 670–676. doi: 10.1038/nmeth911.
  Pourquié, O., Bruneau, B., Keller, G., & Smith, A. (2015). Looking inwards: Opening a window onto human development. Development, 142, 1–2. doi: 10.1242/dev.119727.
  Ranganathan, V., Wahlin, K., Maruotti, J., & Zack, D. J. (2014). Expansion of the CRISPR‐Cas9 genome targeting space through the use of H1 promoter‐expressed guide RNAs. Nature Communications, 5, 4516. doi: 10.1038/ncomms5516.
  Raya, A., Rodríguez‐Pizà, I., Guenechea, G., Vassena, R., Navarro, S., Barrero, M. J., … Belmonte, J. C. (2009). Disease‐corrected haematopoietic progenitors from Fanconi anaemia induced pluripotent stem cells. Nature, 460, 53–59. doi: 10.1038/nature08129.
  Rodin, S., Antonsson, L., Niaudet, C., Simonson, O. E., Salmela, E., Hansson, E. M., … Tryggvason, K. (2014). Clonal culturing of human embryonic stem cells on laminin‐521/E‐cadherin matrix in defined and xeno‐free environment. Nature Communications, 5, 1–13. doi: 10.1038/ncomms4195.
  Sadelain, M., Papapetrou, E. P., & Bushman, F. D. (2012). Safe harbours for the integration of new DNA in the human genome. Nature Reviews, Cancer, 12, 51–58. doi: 10.1038/nrc3179.
  Shearwin, K. E., Callen, B. P., & Egan, J. B. (2005). Transcriptional interference: A crash course. Trends in Genetics, 21, 339–345. doi: 10.1016/j.tig.2005.04.009.
  Sim, X., Cardenas‐Diaz, F. L., French, D. L., & Gadue, P. (2015). A Doxycycline‐inducible system for genetic correction of iPSC disease models. Methods in Molecular Biology, 1353, 13–23. doi: 10.1007/7651.
  Smith, J. R., Maguire, S., Davis, L. a., Alexander, M., Yang, F., Chandran, S., … Pedersen, R. a. (2008). Robust, persistent transgene expression in human embryonic stem cells is achieved with AAVS1‐targeted integration. Stem Cells, 26, 496–504. doi: 10.1634/stemcells.2007‐0039.
  Stein, S., Ott, M. G., Schultze‐Strasser, S., Jauch, A., Burwinkel, B., Kinner, A., … Grez, M. (2010). Genomic instability and myelodysplasia with monosomy 7 consequent to EVI1 activation after gene therapy for chronic granulomatous disease. Nature Medicine, 16, 198–204. doi: 10.1038/nm.2088.
  Trounson, A., & DeWitt, N. D. (2016). Pluripotent stem cells progressing to the clinic. Nature Reviews Molecular Cell Biology, 17, 194–200. doi: 10.1038/nrm.2016.10.
  Tsuneyoshi, N., Tan, E. K., Sadasivam, A., Poobalan, Y., Sumi, T., Nakatsuji, N., … Dunn, N. R. (2012). The SMAD2/3 corepressor SNON maintains pluripotency through selective repression of mesendodermal genes in human ES cells. Genes & Development, 26, 2471–2476. doi: 10.1101/gad.201772.112.
  Urnov, F. D., Rebar, E. J., Holmes, M. C., Zhang, H. S., & Gregory, P. D. (2010). Genome editing with engineered zinc finger nucleases. Nature Reviews, Genetics, 11, 636–646. doi: 10.1038/nrg2842.
  Vallier, L. (2011). Serum‐free and feeder‐free culture conditions for human embryonic stem cells. Springer Protocols, 690, 57–66. doi: 10.1007/978‐1‐60761‐962‐8.
  Vaux, D. L., Fidler, F., & Cumming, G. (2012). Replicates and repeats–what is the difference and is it significant? A brief discussion of statistics and experimental design. EMBO Reports, 13, 291–296. doi: 10.1038/embor.2012.36.
  Voytas, D. (2001). Agarose gel electrophoresis. Current Protocols in Molecular Biology, 51, 2.5A.1–2.5A.9. doi: 10.1002/0471142727.mb0205as51.
  Wang, S., Shi, Z., Liu, W., Jules, J., & Feng, X. (2006). Development and validation of vectors containing multiple siRNA expression cassettes for maximizing the efficiency of gene silencing. BMC Biotechnology, 6, 50. doi: 10.1186/1472‐6750‐6‐50.
  Watanabe, K., Ueno, M., Kamiya, D., Nishiyama, A., Matsumura, M., Wataya, T., … Sasai, Y. (2007). A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology, 25, 681–686. doi: 10.1038/nbt1310.
  Yao, S., Sukonnik, T., Kean, T., Bharadwaj, R. R., Pasceri, P., & Ellis, J. (2004). Retrovirus silencing, variegation, extinction, and memory are controlled by a dynamic interplay of multiple epigenetic modifications. Molecular Therapy, 10, 27–36. doi: 10.1016/j.ymthe.2004.04.007.
  Zafarana, G., Avery, S. R., Avery, K., Moore, H. D., & Andrews, P. W. (2009). Specific knockdown of OCT4 in human embryonic stem cells by inducible short hairpin RNA interference. Stem Cells, 27, 776–782. doi: 10.1002/stem.5.
  Zhang, F., & Lupski, J. R. (2015). Non‐coding genetic variants in human disease. Human Molecular Genetics, 24, R102–R110. doi: 10.1093/hmg/ddv259.
  Zwaka, T. P., & Thomson, J. A. (2003). Homologous recombination in human embryonic stem cells. Nature Biotechnology, 21, 319–321. doi: 10.1038/nbt788.
PDF or HTML at Wiley Online Library