Analysis of Mismatch Repair in Human Nuclear Extracts

Huixian Wang1, John B. Hays1

1 Oregon State University, Corvallis, Oregon
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 3.10
DOI:  10.1002/0471140856.tx0310s28
Online Posting Date:  June, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes an assay for completed mismatch correction along with a precise and sensitive assay for mismatch‐repair excision intermediates and a simple and efficient procedure for construction of mismatch repair substrates. These substrates are derived by ligating synthetic oligomers into a gapped plasmid generated using the sequence‐specific N.BstNBI nicking endonuclease, then the sequence‐specific nicking endonuclease N.AlwI, to introduce single nicks for initiation of excision. These methods can be easily adapted for construction and analysis of DNA‐lesion‐containing substrates to study DNA‐repair pathways other than mismatch repair.

Keywords: mismatch repair; error correction; excision; N.AlwI; N.BstNBI

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Analysis of Mismatch Error Correction and Excision
  • Support Protocol 1: Construction of MMR Plasmid Substrates
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Analysis of Mismatch Error Correction and Excision

  Materials
  • HeLa S3 cells (ATCC #CCL‐2.2), growing in large‐scale suspension culture in spinner flasks
  • Wash buffer (see recipe), ice cold
  • Hypotonic buffer (see recipe), ice cold
  • Extraction buffer (see recipe), ice cold
  • 5 M NaCl
  • Ammonium sulfate
  • Dialysis buffer (see recipe)
  • MMR buffer (see recipe) with and without added dNTPs
  • Liquid nitrogen
  • Nicked mismatched DNA substrate: sCPDC(g/t)n (see protocol 2)
  • Nicked control homoduplex DNA substrate: s19CPD(a/t)n (see protocol 2)
  • Stop solution (see recipe)
  • TE buffer–saturated phenol (unit 2.2)
  • 70% and 100% ethanol
  • AseI digestion buffer (see recipe)
  • AseI restriction endonuclease
  • RNase A
  • AhdI restriction endonuclease
  • AhdI digestion buffer (see recipe)
  • γ‐32P‐labeled oligomer probe of interest: typically 30 nt, prepared by standard methods (e.g., Tabor, )
  • Klenow fragment of DNA polymerase I
  • dNTP stock solutions: 100 mM dATP, dCTP, dGTP, and dTTP
  • Refrigerated centrifuge with adaptors to accommodate centrifuge bottles
  • 40‐ml Dounce tissue grinder (Wheaton Scientific)
  • Rotator/shaker (Barnstead/Thermolyne Labquake or equivalent)
  • 12,000 to 14,000 MWCO dialysis membrane
  • Conductivity meter
  • Gel imaging system (e.g., UV‐7500; UVP)
  • ImageQuant software (Amersham Biosciences)
  • 85°C water bath
  • Additional reagents and equipment for trypan blue staining ( appendix 3B), dialysis ( appendix 3H), protein assay ( appendix 3G), agarose gel electrophoresis and staining of gels (Voytas, ), and phosphor imaging ( appendix 3D)

Support Protocol 1: Construction of MMR Plasmid Substrates

  Materials
  • E. coli strain SCS110 (dam endA; Clontech)
  • Plasmids (contact Dr. John Hays; ):
    • pUC19CPDC [to prepare s19CPDC(g/t) substrate DNA]
    • pUC19CPD [to prepare homoduplex control substrate s19CPD(a/t)]
  • N.BstNBI restriction endonuclease and corresponding buffer
  • 32‐mer (32‐nt) anti‐sense‐strand oligomer
  • BND‐cellulose resin (Sigma)
  • TE buffer, pH 7.4 ( appendix 2A)
  • 20% (v/v) ethanol
  • 2.0, 1.0, and 0.5 M NaCl in 20% ethanol
  • TE buffer, pH 7.4, containing 0.3 M NaCl
  • TE buffer, pH 7.4, containing 1.0 M NaCl
  • CFS buffer (see recipe)
  • 5′‐GCGGATATTAATGTGACGGTAGCGAGTCGCTC‐3′ oligomer
  • Ligation buffer (see recipe)
  • 100 mM ATP stock solution
  • 1 M dithiothreitol (DTT) stock solution
  • T4 DNA ligase
  • N.AlwI nicking endonuclease and corresponding buffer
  • TE buffer–saturated phenol (unit 2.2)
  • 70% and 100% ethanol
  • 55° and 16°C water bath
  • Centricon‐100 microconcentrators (Millipore)
  • Buchner funnel
  • Rotator/shaker (Barnsted/Thermolyne Labquake or equivalent)
  • 30‐ml, 2.5 × 7.5–cm glass chromatography column
  • Additional reagents and equipment for calcium chloride–mediated transformation (Seidman et al., ), DNA minipreps (Engebrecht et al., ), agarose gel electrophoresis (Voytas, ), alkaline lysis and cesium chloride purification (Heilig et al., ), and dialysis ( appendix 3H)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bloomfield, V.A., Crothers, D.M. and Tinoco, I.J. 2000. Nucleic Acids: Structures, Properties, and Functions, pp. 36‐40. University Science Books, Sausalito, Calif.
   Challberg, M.D. and Kelly, T.J. 1979. Adenovirus DNA replication in vitro: Origin and direction of daughter strand synthesis. J. Mol. Biol. 135:999‐1012.
   Elbing, K. and Brent, R. 2002. Growth in liquid media. In Current Protocols in Molecular Biol ogy (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 1.2.1‐1.2.2. John Wiley & Sons, Hoboken, N.J.
   Engebrecht, J., Brent, R., and Kaderbhai, M.A. 1991. Minipreps of plasmid DNA. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Sei dman, J.A. Smith, and K. Struhl, eds.) pp. 1.6.1‐1.6.10. John Wiley & Sons, Hoboken, N.J.
   Gillam, I., Millward, S., Blew, D., von Tiger strom, M., Wimmer, E., and Tenner, G.M. 1967. The separation of soluble ribonucleic acids on benzoylated diethylaminoethyl cellulose. Biochemistry 6:3043‐3056.
   Heilig, J.S., Elbing, K.L., and Brent, R. 1998. Large‐scale preparation of plasmid DNA. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Sei dman, J.A. Smith, and K. Struhl, eds.) pp. 1.7.1‐1.7.16. John Wiley & Sons, Hoboken, N. J.
   Seidman, C.E., Sheen, J., and Jessen, T. 1998. Introduction of plasmid DNA into cells. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Sei dman, J.A. Smith, and K. Struhl, eds.) pp. 1.8.1‐1.8.10. John Wiley & Sons, Hoboken, N. J.
   Tabor, S. 1998. Phosphatases and kinases. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 3.10.2‐3.10.3. John Wiley & Sons, Hoboken, N.J.
   Voytas, D. 2000. Agarose gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 3.10.2‐3.10.3. John Wiley & Sons, Hoboken, N.J.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library