Analysis of the Aryl Hydrocarbon Receptor (AhR) Signal Transduction Pathway

Michael S. Denison1, Jane M. Rogers1, S. Renee Rushing1, Carol L. Jones1, Selwyna C. Tetangco1, Sharon Heath‐Pagliuso1

1 University of California, Davis, Davis, California
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 4.8
DOI:  10.1002/0471140856.tx0408s11
Online Posting Date:  May, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Analysis of the Ah Receptor Signal Transduction Pathway (Michael S. Denison, Jane M. Rohers, S. Renee Rushing. Carol L. Jones, Selwyna C. Tetangico, and Sharon Heath‐Pagliuso, University of California, Davis, California).The protocols in this unit will allow researchers to detect the Ah receptor and characterize its functional activities (i.e., ligand binding, transformation and DNA binding, and gene expression) in their biological test system and to use these methods to detect chemical and biochemical events that affect this signaling system.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Sucrose Density Gradient Analysis of Cytosolic Ah Receptor Ligand Binding
  • Alternate Protocol 1: Hydroxyapatite Solid‐Phase Analysis of Ah Receptor Ligand Binding
  • Support Protocol 1: Preparation of Hepatic Cytosol
  • Support Protocol 2: Preparation of Cytosol from Cells in Culture
  • Basic Protocol 2: Gel Retardation Analysis of AhR‐DNA Binding
  • Alternate Protocol 2: Competitive Gel Retardation Analysis of AhR‐DNA Binding
  • Support Protocol 3: Preparation of Nuclear Extracts from Cells in Culture
  • Support Protocol 4: Preparation of 32P‐Labeled Double‐Stranded Oligonucleotides for Gel Retardation Analysis
  • Basic Protocol 3: Immunoblot of AhR and Arnt
  • Basic Protocol 4: Detection of Human and Mouse AhR, Arnt, CYP1A1, and CYP1B1 mRNA by RT‐PCR
  • Basic Protocol 5: Northern Blot Detection of Human CYP1A1
  • Support Protocol 5: Isolation of Total RNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Sucrose Density Gradient Analysis of Cytosolic Ah Receptor Ligand Binding

  Materials
  • Cytosol sample (see Support Protocols protocol 31 and protocol 42)
  • Bio‐Rad protein assay
  • HEDG buffer (see recipe)
  • 1 µM [3H]TCDD in DMSO (specific activity 10 to 50 Ci/mmol; Eagle‐Picher Technologies or Terrachem)
  • DMSO
  • 100 µM TCDF in DMSO (Accustandard, Cambridge Isotope Laboratories, or Wellington Laboratories)
  • Test ligand in DMSO
  • Dextran‐coated charcoal (see recipe)
  • 60% (w/v) sucrose in HEDG or HEDGK4 (see reciperecipes)
  • 200 cpm/µl [14C]formaldehyde‐labeled protein sedimentation standards (e.g., BSA, catalase; Dottavio‐Martin and Ravel, )
  • Scintillation cocktail
  • 12 × 75–mm glass culture tubes
  • Heat‐sealable, vertical, 13 × 51–mm ultracentrifuge tubes (Beckman) and sealing device
  • Sucrose gradient maker and fractionator (optional)
  • Ultracentrifuge with slow acceleration/deceleration modes and vertical rotor (Beckman VTi65.2 or equivalent), 4°C
  • 18‐G solid‐metal wire
  • 7‐ml scintillation vials
  • Needle (optional)
  • Liquid scintillation counter with dual isotope counting function
NOTE: All steps should be performed at 4°C.

Alternate Protocol 1: Hydroxyapatite Solid‐Phase Analysis of Ah Receptor Ligand Binding

  Additional Materials (also see Basic Protocol)
  • Hydroxyapatite (HAP; Bio‐Rad Biogel HTP)
  • HEG buffer (see recipe)
  • Cytosol (see protocol 3 or protocol 42)
  • 200 nM [3H]TCDD in DMSO (specific activity 10 to 50 Ci/mmol; Eagle‐Picher Technologies or Terrachem)
  • 20 µM TCDF in DMSO (Accustandard, Cambridge Isotope Laboratories, or Wellington Laboratories)
  • HEGT buffer (see recipe)
  • 95% ethanol
  • Buchner funnel containing #1 Whatman filter paper with vacuum source
  • 1‐ml micropipettor in which the opening of the disposable pipet tip has been enlarged
  • Benchtop centrifuge with swinging bucket rotor for microcentrifuge tubes
NOTE: All binding assay steps are performed at 4°C

Support Protocol 1: Preparation of Hepatic Cytosol

  Materials
  • Liver (or tissue) samples
  • HEDG buffer (see recipe)
  • Bio‐Rad protein assay
  • Cheesecloth
  • Polytron or motorized Teflon‐glass homogenizer
  • 40‐ml Oakridge polypropylene capped centrifuge tubes
  • Sorvall SS34 rotor or equivalent
  • Funnel plugged with glass wool
  • 25‐ml polycarbonate ultracentrifuge tubes
  • Beckman SW70Ti (or equivalent)
  • Additional reagents and equipment for liver perfusion (unit 14.2)
NOTE: Perform all steps at 4°C.

Support Protocol 2: Preparation of Cytosol from Cells in Culture

  Materials
  • Confluent 100‐ or 150‐mm plates of cells
  • Phosphate‐buffered saline (PBS; see recipe)
  • 0.5% (w/v) trypsin/0.05% (w/v) tetrasodium EDTA (Life Technologies)
  • HED buffer (see recipe)
  • HED2G buffer (see recipe)
  • Bio‐Rad protein assay
  • Teflon glass homogenizer
  • 4‐ml Sorvall polycarbonate microultracentrifuge tubes
  • Sorvall RCM100 microultracentrifuge and RPT80 rotor, or equivalent

Basic Protocol 2: Gel Retardation Analysis of AhR‐DNA Binding

  Materials
  • 95% ethanol
  • 1× and 10× TAE buffer (see recipe)
  • 30% acrylamide/0.8% bisacrylamide ( appendix 3F)
  • 10% (w/v) ammonium persulfate (APS), fresh
  • TEMED (N,N,N′,N′‐tetramethylethylenediamine)
  • Cytosol (see Support Protocols protocol 31 and protocol 42) or nuclear extracts (see protocol 7)
  • Bio‐Rad protein assay
  • HEDG buffer (see recipe)
  • Chemical to be tested
  • HEDGK8 buffer (see recipe)
  • Cytosolic and nuclear poly(dI⋅dC) (Roche Diagnostics) in HEDG buffer
  • 32P‐labeled double‐stranded wild‐type DRE‐oligonucleotide (see protocol 8)
  • 10× Ficoll GRA gel‐loading buffer (see recipe)
  • HEDGK4 buffer (see recipe)
  • Polyacrylamide gel electrophoresis (PAGE) apparatus (e.g., V16‐2; Life Technologies) with 1.5‐mm spacers ( appendix 3F)
  • Syringe with bent needle
  • Peristaltic pump with two pump heads and appropriate tubing
  • Micropipettor with gel‐loading tip or 50‐µl Hamilton syringe
  • 3 MM blotting paper
  • Additional reagents and equipment for PAGE ( appendix 3F) and detection and quantitation of radiolabeled proteins in gels and blots ( appendix 3D)
NOTE: When water is indicated in the procedure, use MilliQ‐purified water or equivalent

Alternate Protocol 2: Competitive Gel Retardation Analysis of AhR‐DNA Binding

  • Cytosolic and nuclear poly(dI⋅dC) in HEDG buffer (see recipe for buffer; Roche Diagnostics)
  • Competitor DNA in HEDG buffer: unlabeled wild‐type and mutant DRE oligonucleotides (see recipes), or other competitor DNA fragments

Support Protocol 3: Preparation of Nuclear Extracts from Cells in Culture

  Materials
  • Culture medium
  • 1 µM TCDD in DMSO
  • DMSO
  • 100‐mm plates of confluent cells
  • 10 mM HEPES buffer (see recipe)
  • MDH buffer (see recipe)
  • MDHK buffer (see recipe)
  • HEDGK4 buffer (see recipe)
  • Bio‐Rad protein assay
  • 6‐ml Dounce homogenizer with loose‐fitting pestle cooled on ice
  • 15‐ml polyethylene tubes
  • 1‐ml micropipettor with a pipet tip in which the opening has been enlarged
  • 0.5‐ml polypropylene microultracentrifuge tubes
  • Sorvall RCM100 microultracentrifuge and RP100AT2 rotor, or equivalent

Support Protocol 4: Preparation of 32P‐Labeled Double‐Stranded Oligonucleotides for Gel Retardation Analysis

  Materials
  • DRE oligonucleotides, single‐stranded and purified (wild type and mutant; see recipe)
  • Oligonucleotide reannealing buffer (see recipe)
  • 10 U/µl T4 polynucleotide kinase (New England Biolabs) and 10× T4 kinase buffer (see recipe)
  • 5000 to 8000 Ci/mmol [γ‐32P]ATP
  • TE buffer (see recipe)
  • Sephadex G‐50 spin column (e.g., CpG Spin‐pure G‐50; also see recipe) equilibrated with TE buffer
  • HEDG buffer (see recipe)
  • 20 µg/ml ethidium bromide in TE buffer
  • Heated rotary evaporator (e.g., Speedvac; Savant)
  • 0.5‐ml screw‐cap microcentrifuge tubes
  • UV transilluminator

Basic Protocol 3: Immunoblot of AhR and Arnt

  Materials
  • 4× PAGE running gel buffer (see recipe)
  • 4× PAGE stacking gel buffer (see recipe)
  • 95% ethanol
  • Immunoblot tank buffer (see recipe)
  • Mammalian cells or whole cell lysate, cytosol (see Support Protocols protocol 31 and protocol 42), or nuclear extracts (see protocol 7)
  • PBS (see recipe)
  • 1× trypsin (Life Technologies)
  • Lysis buffer, fresh (see recipe)
  • Bio‐Rad protein assay
  • 2× immunoblot treatment buffer, frozen (see recipe)
  • Prestained protein standards (e.g., Bio‐Rad Kaleidoscope), frozen
  • Towbin transfer buffer (see recipe)
  • Nitrocellulose (Amersham Hybond‐ECL) or PVDF (NEN Polyscreen) transfer membrane
  • 100% methanol (for PVDF membranes only)
  • Phosphorescent paint (obtain from an art supply store or hobby shop)
  • Blotto (see recipe)
  • Primary antibody: rabbit anti‐AhR and mouse anti‐Arnt antibodies (Affinity Bioreagents, Novus Biologicals, or Santa Cruz Biotechnology)
  • TBST (see recipe)
  • Secondary antibody: Anti‐rabbit or ‐mouse antibody conjugated to horseradish peroxidase (Pierce)
  • Tris buffered saline (TBS; see recipe)
  • Renaissance Western Blot Chemiluminescence Reagent Plus, Enhanced Luminol (NEN Life Science Products)
  • Stripping buffer (see recipe)
  • 100‐mm tissue culture plates
  • Chromatography paper (Whatman 3 MM or equivalent)
  • Transfer apparatus (Idea Scientific)
  • Plastic sheet protectors
  • Autoradiography film
  • Rocking platform (Labquake)
  • Shallow plastic box or tray with lid, slightly larger than blot
  • Additional reagents and equipment for PAGE ( appendix 3F) and autoradiography ( appendix 3D)
NOTE: When water is indicated in the procedure, use MilliQ‐purified water or equivalent.

Basic Protocol 4: Detection of Human and Mouse AhR, Arnt, CYP1A1, and CYP1B1 mRNA by RT‐PCR

  Materials
  • Single‐stranded oligonucleotide primers (Table 4.8.1)
  • Total RNA (see protocol 12)
  • Oligo(dT) 12‐18 primer (Life Technologies or InVitrogen)
  • 200 U/µl Superscript II reverse transcriptase with 5× first‐strand buffer and 0.1 M dithiothreitol (DTT; Life Technologies or InVitrogen)
  • 2 mM dNTP mix (Life Technologies or InVitrogen)
  • Random hexamers (Life Technologies or InVitrogen)
  • 25 mM MgCl 2
  • 5 U/µl Platinum Taq DNA polymerase (InVitrogen) and 10× PCR buffer (Life Technologies)
  • 1% agarose gel in 1× TAE buffer (see recipe)
  • 1 mg/ml ethidium bromide solution (see recipe)
  • 100 bp or 1 Kb DNA ladder (Life Technologies)
    Table 4.8.1   MaterialsPCR Primers for Amplification of Human and Mouse AhR, Arnt, CYP1A1, CYP1B1, and Housekeeping Gene Products (GAPDH and HPRT)

    Target 5′‐primer 3′‐primer
    Human PCR primers
    AhR 5′‐GTGACTTGTACAGCATAATG‐3′ 5′‐ATCTTCTGACACAGCTGTTG‐3′
    Arnt 5′‐GAATTGGACATGGTACCAGG‐3′ 5′‐AAGCTGATGGCTGGACAATG‐3′
    CYP1A1 5′‐CCTTTGAGAAGGGCCACATC‐3′ 5′‐GATGGGTTGACCCATAGCTT‐3′
    CYP1B1 5′‐TATCCTGATGTGCAGACTCG‐3′ 5′‐TCCTTGTTGATGAGGCCATC‐3′
    GAPDH 5′‐GAGCCACATCGCTCAGAC‐3′ 5′‐CTTCTCATGGTTCACACCC‐3′
    Mouse PCR Primers
    AhR 5′‐GTGTCTGCCATTGTCTCTGTTC‐3′ 5′‐CAATACAGACAAACAAATAGGCAG‐3′
    Arnt 5′‐CCCCTCCTGTAACCATTGTC‐3′ 5′‐ACGGAGGGAGAGGACTTTTAT‐3′
    CYP1A1 5′‐CCAGGATGCTCACCCGCCCAG‐3′ 5′‐ATGTAGGGTGAACAGAGGTGC‐3′
    CYP1B1 5′‐AATGAGGAGTTCGGGCGCACA‐3′ 5′‐GGCGTGTGGAATGGTGACAGG‐3′
    HPRT 5′‐GTAATGATCAGTCAACGGGGGAC‐3′ 5′‐CCAGCAAGCTTGCAACCTTAACCA‐3′

  • Thin‐walled PCR tubes
  • PCR thermocycler with heated lid
  • 100 bp or 1 Kb DNA ladder (Life Technologies)
  • DNA/RNA gel electrophoresis apparatus and power supply
  • Additional reagents and equipment for performing agarose gel electrophoresis ( appendix 3A)
CAUTION: Ethidium bromide is a mutagen and should be handled, stored, and disposed of with appropriate care.NOTE: Use RNase‐free water for solutions that come in direct contact with the RNA.

Basic Protocol 5: Northern Blot Detection of Human CYP1A1

  Materials
  • Total RNA sample (see protocol 12)
  • RNase‐free H 2O
  • 1 mg/ml ethidium bromide (see recipe)
  • Northern sample buffer (see recipe)
  • 1× MOPS buffer (see recipe)
  • NaOH/SSC (see recipe)
  • Tris/SSC (see recipe)
  • 10× SSC (see recipe)
  • hCYP1A1 plasmid (pBR322 vector; ATCC #57258)
  • EcoRI restriction endonuclease
  • GAPDH or β‐Actin cDNA probes (Clontech Laboratories; optional)
  • Oligolabeling kit (Amersham Pharmacia Biotech):
  •  Reagent mix
  •  Klenow fragment
  • [α‐32P]dCTP (3000 Ci/mmol)
  • Spin‐Pure Sephadex G50 spin column or equivalent
  • Scintillation cocktail
  • Northern hybridization buffer, 65°C (see recipe)
  • 0.5× and 2× SSC (see recipe)/0.1% (w/v) SDS
  • Fluorescent ruler
  • Whatman 3 MM paper
  • 1‐ml screw‐cap microcentrifuge tube
  • 95°C water bath
  • Roller bottle hybridization oven and appropriate bottle
  • Additional reagents and equipment for northern blot analysis ( appendix 3E), agarose gel purification ( appendix 3A), and autoradiography ( appendix 3D)
NOTE: Use RNase‐free water (Life Technologies) for solutions that come in direct contact with the RNA.

Support Protocol 5: Isolation of Total RNA

  Materials
  • 100‐mm plates of confluent control (DMSO) and treated (TCDD) cells
  • Medium
  • RNeasy mini kit (Qiagen) containing:
  •  Qiagen denaturing buffer
  •  RNeasy mini spin column and collection tube
  •  Wash buffers
  • 14.2 M 2‐mercaptoethanol
  • 100% and 70% ethanol, cold
  • 3 M sodium acetate, RNase free (see recipe)
  • 40 U/µl RNaseOUT recombinant ribonuclease inhibitor (Life Technologies)
  • 1‐ml plastic syringe with 20‐G needle
  • 65°C water bath
  • Additional reagents and equipment for trypsinizing cells (see protocol 4).
NOTE: Use RNase‐free water (Life Technologies) for solutions that come in direct contact with the RNA. All steps are performed at room temperature. Once RNA is isolated, it should be kept on ice or at −80°C.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bradfield, C.A. and Poland, A. 1988. A competitive binding assay for 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin and related ligands for the Ah receptor. Molec. Pharmacol. 34:682‐688.
   Burbach, K.M., Poland, A., and Bradfield, C.A. 1992. Cloning of the Ah‐receptor cDNA reveals a distinctive ligand‐activated transcription factor. Proc. Natl. Acad. Sci. U.S.A. 89:8185‐8189.
   Cuthill, S. and Poellinger, L. 1988. DNA binding properties of dioxin receptors in wild‐type and mutant mouse hepatoma cells. Biochemisty 27:2978‐2982.
   Denison, M.S. and Yao, E. 1991. Characterization of the interaction of transformed rat hepatic Ah receptor with a dioxin responsive transcriptional enhancer. Arch. Biochem. Biophys. 284:158‐166.
   Denison, M.S., Fine, J., and Wilkinson, C.F. 1984. Protamine sulfate precipitation: A new assay for the Ah receptor. Anal. Biochem. 142:28‐36.
   Denison, M.S., Vella, L.M., and Okey, A.B. 1986. Structure and function of the Ah receptor for 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin: Species differences in molecular properties of the receptor from mouse and rat hepatic cytosol. J. Biol. Chem. 261:3987‐3995.
   Denison, M.S., Fisher, J.M., and Whitlock, J.P. Jr. 1988a. Inducible, receptor‐dependent protein‐DNA interactions at a dioxin‐responsive transcriptional enhancer. Proc. Natl. Acad. Sci. U.S.A. 85:2528‐2532.
   Denison, M.S., Fisher, J.M., and Whitlock, J.P. Jr. 1988b. The DNA recognition site for the dioxin‐Ah receptor complex: Nucleotide sequence and functional analysis, J. Biol. Chem. 263:17721‐17724.
   Denison, M.S., Phelen, D., and Elferink, C.J. 1998a. The Ah receptor signal transduction pathway. In Xenobiotics, Receptors and Gene Expression (M.S. Denison and W. Helferich, eds.) pp.3‐33, Taylor and Francis, Philadelphia.
   Denison, M.S., Seidel, S.D., Rogers, W.J., Ziccardi, M., Winter, G.M., and Heath‐Pagliuso, S. 1998b. Natural and synthetic ligands for the Ah receptor. In Molecular Biology Approaches to Toxicology (A. Puga and K.B. Wallace, eds.) pp.393‐410, Taylor and Francis, Philadelphia.
   Denison, M.S., Phelan, D., Winter, G.M., and Ziccardi, M.H. 1998c. Carbaryl, a carbamate insecticide, is a ligand for the hepatic Ah (dioxin) receptor. Toxicol. Appl. Pharmacol. 152:406‐414.
   Dottavio‐Martin, D. and Ravel, J.M. 1978. Radiolabeling of proteins by reductive alkylation with [14C]formaldehyde and sodium cyanoborohydride. Anal. Biochem. 87:562‐565.
   Garrison, P.M., Aarts, J.M.M.J.G., Brouwer, A., Giesy, J.P., and Denison, M.S. 1996. Ah receptor‐mediated gene expression: Production of a recombinant mouse hepatoma cell bioassay system for detection of 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin‐like chemicals. Fund. Appl. Toxicol. 30:194‐203.
   Gasiewicz, T.A. and Neal, R.A. 1982. The examination and quantitation of tissue cytosolic receptors for 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin using hydroxylapatite. Anal. Biochem. 124:1‐11.
   Hahn, M.E. 1999. The aryl hydrocarbon: A comparative perspective. Comp. Biochem. Physiol. C121:23‐53.
   Hakkola, J., Pasanen, M., Pelkonen, O., Hjukkanen, J., Evisalmi, S., Anttila, S., Rane, A., Mantyla, M., Purkunen, R., Saarikoski, S., Tooming, M., and Raunio, H. 1997. Expression of CYP1B1 in human adult and fetal tissues and differential inducibility of CYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and cultured cells. Carcinogenesis. 81:391‐397.
   Hoffman, E.C., Reyes, H., Chu, F.‐F., Sander, F., Conley, L.H., Brooks, B.A., and Hankinson, O. 1991. Cloning of a factor required for activity of the Ah (dioxin) receptor. Science. 252:954‐958.
   Holmes, J.L. and Pollenz, R.S. 1997. Determination of aryl hydrocarbon receptor nuclear translocator protein concentration and subcellular localization in hepatic and nonhepatic cell culture lines: Development of quantitative western blotting protocols for calculation of aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator protein in total cell lysates.Molec. Pharmacol. 52:202‐211.
   Okey, A.B., Bondy, G.P., Mason, M.E., Kahl, G.F., Eisen, H.J., Guenthner, T.M., and Nebert, D.W. 1979. Regulatory gene product of the Ah locus: Characterization of the cytosolic inducer‐receptor complex and evidence for its nuclear translocation.J. Biol. Chem. 254:11636‐11648.
   Poland, A., Glover, E., and Kende, A.S. 1976. Stereospecific, high affinity binding of 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin by hepatic cytosol: Evidence that the binding species is receptor for induction of aryl hydrocarbon hydroxylase. Molec. Pharmacol. 251:4936‐4946.
   Prokipcak, R.D., Denison, M.S., and Okey, A.B. 1990. Nuclear Ah receptor from mouse hepatoma cells: Effects of partial proteolysis on relative molecular mass and DNA‐binding properties. Arch. Biochem. Biophys. 283:476‐483.
   Safe, S. 1990. Polychlorinated biphenyls (PCBs), dibenzo‐p‐dioxins (PCDDs), dibenzofurans (PCDFs), and related compounds: Environmental and mechanistic considerations which support the development of toxic equivalency factors (TEFs). Crit. Rev. Toxicol. 21:51‐88.
   Schmidt, J.V. and Bradfield, C.A. 1996. Ah receptor signaling pathways. Annu. Rev. Cell Devel. Biol. 12:55‐89.
   Shen, E.S. and Whitlock, J.P. Jr. 1992. Protein‐DNA interactions at a dioxin‐responsive enhancer: Mutational analysis of the DNA‐binding site for the liganded Ah receptor. J. Biol. Chem. 267:6815‐6819.
   Tsai, H.W. and Okey, A.B. 1981. Rapid vertical tube rotor gradient assay for binding of 2,3,7,8‐tetrachlorodibenzo‐p‐dioxin to the Ah receptor. Canad. J. Physiol. Pharmacol. 59:927‐931.
   Tscheudschilsuren, G., Hombach‐Klonisch, S., Kuchenhoff, A., Fischer, B., and Klonisch, T. 1999. Expression of the aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator during early gestation in the rabbit uterus. Toxicol. Appl. Pharmacol. 160:231‐237.
   Walsh, A.A., Tullis, K., Rice, R.H., and Denison, M.S. 1996. Identification of a novel cis‐acting negative regulatory element affecting transcription of the CYP1A1 gene in rat epidermal cells. J. Biol.Chem. 271:22746‐22753.
   Yao, E.F. and Denison, M.S. 1991. DNA sequence determinants for binding of transformed Ah receptor to a dioxin responsive element. Biochemistry 31:5060‐5067.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library