Evaluation of the Cytochrome b5/Cytochrome b5 Reductase Pathway

Lauren A. Trepanier1, Sunil U. Bajad1, Joseph R. Kurian1

1 University of Wisconsin–Madison, Madison, Wisconsin
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 4.16
DOI:  10.1002/0471140856.tx0416s24
Online Posting Date:  June, 2005
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

NADH cytochrome b5 reductase (b5R; EC 1.6.2.2; Diaphorase I; NADH: ferricytochrome b5 oxidoreductase) is an FAD‐containing protein, which, along with the hemoprotein cytochrome b5 (cyt b5), mediates electron transfer from NADH to fatty acid desaturases, P450 oxidases, methemoglobin, and ascorbyl free radical. In addition, b5R and cyt b5 can directly catalyze the reduction of hydroxylamine and amidoxime metabolites. This unit provides protocols for measuring the activity and mRNA expression of the cytochrome b5/cytochrome b5 reductase pathway, and for obtaining heterologous expression and purification of the soluble forms of each protein.

Keywords: Cytochrome b5 reductase; cytochrome b5; hydroxylamine; ferrihemoglobin reduction; qRT‐PCR; protein purification

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Ferrihemoglobin Reduction as a Marker of Cytochrome b5 Reductase Activity in Erythrocytes
  • Support Protocol 1: Preparation of RBC Lysate
  • Alternate Protocol 1: Ferrihemoglobin Reduction Activity in Mononuclear Leukocytes
  • Support Protocol 2: Isolation of Peripheral Blood Mononuclear Cells
  • Basic Protocol 2: Quantitative Reverse Transcriptase Polymerase Chain Reaction for Expression of Cytochrome b5 Reductase and Cytochrome b5
  • Basic Protocol 3: Expression of Human Recombinant Soluble Cytochrome b5 Reductase or Cytochrome b5 in E. Coli
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Ferrihemoglobin Reduction as a Marker of Cytochrome b5 Reductase Activity in Erythrocytes

  Materials
  • 0.027 M disodium EDTA, pH 7.0: dissolve 392 mg Na 2EDTA in 50 ml H 2O; adjust pH to 7.0 using 1 M NaOH
  • 50 mM sodium citrate buffer, pH 4.7 (see recipe)
  • 0.5 mM potassium ferricyanide: dissolve 3.292 mg K 3Fe(CN) 6 in 20 ml H 2O (prepare fresh; protect from light)
  • 1.224% (w/v) human hemoglobin (see recipe)
  • RBC lysate from subject of interest, diluted 1:20 (see protocol 2)
  • 2 mM NADH: dissolve 2.836 mg NADH in 2 ml H 2O (degrades in solution at room temperature; prepare fresh within 1 hr of use.)
  • 1.5‐ml amber microcentrifuge tubes
  • Quartz spectrophotometer cuvettes
  • Spectrophotometer

Support Protocol 1: Preparation of RBC Lysate

  Materials
  • Heparinized blood
  • Phosphate‐buffered saline, pH 7.4 (PBS; appendix 2A or purchase from Sigma)
  • Stabilizing solution (see recipe)
  • Tabletop centrifuge
  • 1.5‐ml amber microcentrifuge tubes
  • Co‐oximeter (Instrumentation Laboratory; http://www.ilus.com/)

Alternate Protocol 1: Ferrihemoglobin Reduction Activity in Mononuclear Leukocytes

  • Leukocytes (PBMC; see protocol 4)
  • Bath sonicator
  • Bradford protein assay kit (Bio‐Rad)

Support Protocol 2: Isolation of Peripheral Blood Mononuclear Cells

  Materials
  • Heparinized whole blood from subject of interest, freshly obtained
  • Hanks' Balanced Salt Solution (HBSS; appendix 2A) containing 5 mM EDTA, pH 7.4
  • Lymphocyte Separation Medium (LSM; Mediatech Inc.)
  • ACK lysis buffer (Cambrex Biosciences; http://www.cambrex.com)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 50‐ml conical centrifuge tubes
  • Tabletop centrifuge

Basic Protocol 2: Quantitative Reverse Transcriptase Polymerase Chain Reaction for Expression of Cytochrome b5 Reductase and Cytochrome b5

  Materials
  • Source for RNA: e.g., peripheral blood mononuclear cells (PBMC; see protocol 4)
  • RNA‐preserving solution: e.g., RNAlater (optional; Ambion)
  • Phosphate‐buffered saline, pH 7.4 (PBS; appendix 2A)
  • RNA isolation kit: e.g., RNAqueous‐4PCR (Ambion)
  • DNase/RNase‐free H 2O
  • cDNA preparation kit: e.g., SYBR Green PCR/RT‐PCR kit (Applied Biosystems)
  • Primers (prepare in DNase/RNase‐free H 2O; store in aliquots at −20°C):
    • 6.66 µM 18S rRNA forward primer: 5′‐CGCCGCTAGAGGTGAAATTCT‐3′
    • 6.66 µM 18S rRNA reverse primer: 5′‐CGAACCTCCGACTTTCGTTCT‐3′
    • 10.0 µM b 5R forward primer: 5′‐AGGGCAAAGGGAAGTTCGCCAT‐3′
    • 10.0 µM b 5R reverse primer: 5′‐ACAGACTTCACTGTCCTGATGATA‐3′
    • 10.0 µM cyt b 5 forward primer: 5′‐CTGCACCACAAGGTGTACGA‐3′
    • 10.0 µM cyt b 5 reverse primer: 5′‐ACCTCCAGCTTGTTCCCTTA‐3′
  • UV spectrophotometer
  • DNase/RNase‐free pipet tips with filters
  • 250‐µl clear DNase/RNase‐free tubes
  • Standard thermal cycler (for reverse transcription)
  • 96‐well PCR plates (e.g., Bio‐Rad)
  • Real time PCR cycler (e.g., Bio‐Rad iCycler)
  • Optical quality sealing tape (e.g., Bio‐Rad)
  • Tabletop centrifuge with microtiter plate carrier

Basic Protocol 3: Expression of Human Recombinant Soluble Cytochrome b5 Reductase or Cytochrome b5 in E. Coli

  Materials
  • b 5R and cyt b 5 cDNA, human soluble forms (contact the authors at )
  • pCR T7 TOPO TA expression vector (Invitrogen): NT or CT
  • Chemically competent E. Coli: e.g., One Shot Chemically Competent Cells [BL21(DE3) cells] from Invitrogen
  • SOC medium (supplied with the One Shot Chemically Competent Cells from Invitrogen)
  • LB broth (see recipe)
  • 100 mg/ml ampicillin stock solution (see recipe)
  • 10 mM IPTG (see recipe)
  • Binding buffer, pH 8.0 (see recipe)
  • Complete Mini Protease Inhibitor Cocktail tablets (Roche Diagnostics; optional)
  • Lysozyme (Sigma; optional)
  • Ni‐NTA agarose resin (25 ml ethanol suspension; Invitrogen)
  • Elution solutions 1, 2, and 3 (see recipe)
  • SDS‐PAGE loading buffer: add 50 µl 2‐mercaptoethanol (Sigma) to 950 µl Laemmli sample buffer (Bio‐Rad); prepare fresh for each purification
  • Tris‐HCl precast polyacrylamide gels (Bio‐Rad) compatible with Mini PROTEAN 3 Electrophoresis Cell: 12% gel (for b 5R expression) or 15% (for cyt b 5 expression)
  • 1× Tris‐glycine electrode buffer (see unit 2.2 for 10× buffer)
  • Phosphate‐buffered saline, pH 7.4 (PBS; appendix 2A or purchase from Sigma)
  • Bradford protein assay kit (Bio‐Rad)
  • 2 mM hemin (see recipe)
  • QIAprep Plasmid Prep kit (Qiagen)
  • 42°C water bath
  • 37°C warm room with rotary shakers
  • 100‐ and 2000‐ml Erlenmeyer flasks, sterile
  • 250‐ml culture tubes
  • Refrigerated centrifuge capable of holding 250‐ml culture tubes, capable of 12,000 × g
  • Safety goggles and ear plugs
  • Sonic Dismembranator with microtip attachment (Fisher)
  • 15‐ or 50‐ml conical polypropylene centrifuge tubes
  • 10‐ml Poly‐Prep columns (Bio‐Rad)
  • 0.5‐ml microcentrifuge tubes
  • Mini PROTEAN 3 Electrophoresis Cell (Bio‐Rad)
  • 95°C heating block
  • Dialysis cassettes (Pierce): 10,000 MWCO (for b 5R expression) or 3,500 MWCO (for cyt b 5 expression)
  • 1000‐ml beaker
  • 15‐ml Centriplus centrifugal concentrators (Millipore): 10,000 NMWL (for b 5R expression) or 3,000 NMWL (for cyt b 5 expression)
  • Additional reagents and equipment for protein electrophoresis and gel staining ( appendix 3F) and dialysis and concentration of protein solutions ( appendix 3H)
NOTE: All solutions and equipment coming into contact with living cells must be sterile, and aseptic technique should be used accordingly.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Beutler, E. 1975. A Manual of Biochemical Methods. 2nd ed. Grune & Stratton, New York.
   Giordano, S. and Steggles, A. 1991. The human liver and reticulocyte cytochrome b5 mRNAs are products from a single gene. Biochem. Biophys. Res. Commun. 178:38‐44.
   Hildebrandt, A. and Estabrook, R. 1971. Evidence for the participation of cytochrome b5 in hepatic microsomal mixed‐function oxidation reactions. Arch. Biochem. Biophys. 143:66‐79.
   Hultquist, D. and Passon, P. 1971. Catalysis of methaemoglobin reduction by erythrocyte cytochrome b5 and cytochrome b5 reductase. Nature New Biol. 229:252‐254.
   Ito, A., Hayashi, S., and Yoshida, T. 1981. Participation of a cytochrome b5‐like hemoprotein of outer mitochondrial membrane (OM cytochrome b) in NADH‐semidehydroascorbic acid reductase activity of rat liver. Biochem. Biophys. Res. Commun. 101:591‐598.
   Kurian, J., Bajad, S., Miller, J., Chin, N., and Trepanier, L. 2004. NADH cytochrome b5 reductase and cytochrome b5 catalyze the microsomal reduction of xenobiotic hydroxylamines and amidoximes in humans. J. Pharmacol. Exp. Ther. 311:1171‐1178.
   Leroux, A., Vieira, L., and Kahn, A. 2001. Transcriptional and translational mechanisms of cytochrome b5 reductase isozyme generation in humans. Biochem. J. 355:529‐535.
   Oshino, N., Imai, Y., and Sato, R. 1971. A function of cytochrome b5 in fatty acid desaturation by rat liver microsomes. J. Biochem. (Tokyo) 69:155‐167.
   Shirabe, K., Landi, M., Takeshita, M., Uziel, G., Fedrizzi, E., and Borgese, N. 1995. A novel point mutation in a 3′ splice site of the NADH‐cytochrome b5 reductase gene results in impaired NADH‐dependent ascorbate regeneration in cultured fibroblasts of a patient with Type II hereditary methemoglobinemia. Am. J. Hum. Genet. 57:302‐310.
   Tomatsu, S., Kobayashi, Y., Fukumaki, Y., Yubisui, T., Orii, T., and Sakaki, Y. 1989. The organization and the complete nucleotide sequence of the human NADH‐cytochrome b5 reductase gene. Gene 80:353‐361.
Internet Resources
   http://www.ambion.com/techlib/basics/rtpcr
  Web site with basic background for the qRT‐PCR technique.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library