Biochemical and Genetic Analysis of NAD(P)H:Quinone Oxidoreductase 1 (NQO1)

David Siegel1, Jadwiga K. Kepa1, David Ross1

1 University of Colorado at Denver and Health Sciences Center, Denver, Colorado
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 4.22
DOI:  10.1002/0471140856.tx0422s32
Online Posting Date:  May, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

NAD(P)H:quinone oxidoreductase 1 (NQO1, DT‐diaphorase, E.C. 1.6.99.2) is an FAD containing obligate two‐electron reductase that catalyzes the reduction of a broad range of substrates. This unit will describe methods for the detection of NQO1 protein in formalin‐fixed, paraffin‐embedded tissues by immunohistochemistry; detection of NQO1 protein in fresh tissues or cell lines by immunoblot analysis; measurement of NQO1 catalytic activity in fresh and frozen tissues and cell lines using spectrophotometric assays based upon the reduction of 2,6‐dichlorophenol‐indophenol (DCPIP) or coupled menadione‐cytochrome reduction; and determination of the NQO1*2 polymorphism by PCR‐RFLP.

Keywords: NAD(P)H:quinone oxidoreductase; flavin; dicumarol; quinone reduction

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Detection of NQO1 by Immunohistochemistry
  • Basic Protocol 2: Detection of NQO1 by Immunoblot Analysis
  • Basic Protocol 3: Measurement of NQO1 Catalytic Activity by DCPIP Reduction
  • Alternate Protocol 1: Measurement of NQO1 Activity by Coupled Menadione‐Cytochrome c Reduction Assay
  • Basic Protocol 4: Detection of the NQO1*2 Polymorphism by Polymerase Chain Reaction/Restriction Fragment Length Polymorphism Assay
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Detection of NQO1 by Immunohistochemistry

  Materials
  • 5‐µm tissue sections, mounted on glass slides in duplicate
  • Xylene
  • 70%, 95%, and 100% ethanol
  • Antigen unmasking solution (see recipe)
  • 3% (v/v) hydrogen peroxide: prepare fresh by diluting 30% hydrogen peroxide in phosphate‐buffered saline (PBS; prepared with double‐distilled H 2O; see appendix 2A)
  • Phosphate‐buffered saline (PBS; appendix 2A): prepare with double‐distilled water
  • Blocking buffer (see recipe)
  • Primary antibody solution: prepare 0.5 ml per sample fresh by diluting antibody (e.g., 200 µg/ml anti‐NQO1 mouse monoclonal antibody, clone A180, IgG1; Santa Cruz Biotechnology) 1:50 in blocking buffer (see recipe)
  • Control antibody solution: prepare 0.5 ml per sample fresh by diluting nonspecific antibody (e.g., purified mouse monoclonal IgG1‐kappa, nonspecific, clone MOPC 21; Sigma) to 2 µg/ml in blocking buffer (see recipe)
  • TBST (see recipe)
  • Immunoperoxidase‐based secondary antibody kit for mouse IgG (e.g., ABC Elite; Vector Laboratories); use components to prepare the following solutions fresh:
    • Biotinylated horse anti‐mouse IgG secondary antibody solution: add a single drop (50 µl) of biotinylated horse anti‐mouse IgG secondary antibody to 10 ml of blocking buffer (see recipe)
    • Avidin‐labeled HRP solution: add 4 drops (200 µl) of avidin solution to 10 ml TBST (see recipe), mix, add 4 drops (200 µl) of HRP solution, mix, and let stand 30 min at room temperature before using
  • 3,3′‐diaminobenzidine (DAB)/hydrogen peroxide solution (see recipe)
  • Mayer's hematoxylin stain (e.g., BioGenex)
  • 30 mM ammonium hydroxide
  • Aqueous mounting medium (e.g., Supermount; BioGenex)
  • Glass staining jars
  • Microwave pressure cooker
  • Microwave oven
  • Glass plate (12 in. × 12 in.) covered with Parafilm
  • Glass coverslips
NOTE: Perform all incubations at room temperature.

Basic Protocol 2: Detection of NQO1 by Immunoblot Analysis

  Materials
  • Tissue samples or cell lines in culture
  • Liquid nitrogen
  • RIPA buffer (see recipe) or homogenization buffer (see recipe)
  • Complete‐mini protease inhibitor tablet (e.g., Roche)
  • 2× Laemmli SDS sample buffer (see recipe)
  • Phosphate‐buffered saline (PBS; appendix 2A; prepared with double‐distilled water)
  • 12% SDS‐PAGE gel (e.g., precast minigel; Bio‐Rad)
  • SDS‐PAGE running buffer (see recipe)
  • Molecular weight markers, 14 to 220 kDa (e.g., Rainbow molecular weight markers; Amersham Biosciences)
  • Methanol
  • Transfer buffer (see recipe)
  • TBST (see recipe)
  • Blocking buffer (see recipe)
  • Primary antibody: e.g., anti‐NQO1 mouse monoclonal antibody (clone A180; Santa Cruz Biotechnology)
  • Secondary antibody: e.g., HRP‐conjugated goat anti‐mouse IgG secondary antibody (Jackson ImmunoResearch)
  • Luminol/hydrogen peroxide–based chemiluminescence detection kit (e.g., Western Lighting chemiluminescence reagent; Perkin‐Elmer)
  • Homogenizer (e.g., PowerGen 500; Fisher Scientific)
  • Probe sonicator (e.g., Branson Sonifier 250; Fisher Scientific)
  • 10‐ml ultracentrifuge tubes
  • 1.7‐ml microcentrifuge tubes
  • Electrophoresis apparatus and DC power supply
  • Pipettor with gel‐loading tip
  • Polyvinylidene fluoride (PVDF) membrane (e.g., Immobilon‐P; Millipore): cut to 3 in. × 3.5 in.
  • Transfer pads, two per membrane (supplied with transfer apparatus)
  • Whatman no. 1 filter paper (cut to 3 in. × 3.5 in.), two pieces per membrane
  • Glass dish, sized to hold gels
  • Wet transfer blotting apparatus
  • Platform shaker
  • X‐ray film cassette
  • Overhead transparency film or plastic wrap
  • Darkroom with red light
  • X‐ray film (e.g., hyperfilm ECL; Amersham Biosciences)
  • X‐ray film developer
  • Empty plastic container (4 in. × 3.5 in. × 2 in.)
  • Additional reagents and equipment for determining protein concentration ( appendix 3I)

Basic Protocol 3: Measurement of NQO1 Catalytic Activity by DCPIP Reduction

  Materials
  • Tissue sample or cell lines in culture
  • Phosphate‐buffered saline (PBS; appendix 2A; prepared with double‐distilled water)
  • Homogenization buffer (see recipe)
  • Reaction buffer (see recipe)
  • 10 mM of β‐NADH or β‐NADPH solution: prepare fresh in 25 mM Tris⋅Cl, pH 7.4 (see appendix 2A)
  • 2 mM 2,6‐dichlorophenol‐indophenol (DCPIP; e.g., Sigma) solution
  • 2 mM dicumarol (e.g., Sigma) solution: prepare fresh in 0.13 N NaOH
  • Homogenizer (e.g., PowerGen 500; Fisher)
  • Probe sonicator (e.g., Branson Sonifier 250; Fisher Scientific)
  • 10‐ml ultracentrifuge tube
  • 1.7‐ml microcentrifuge tube
  • Recording spectrophotometer
  • 1‐ml plastic disposable cuvettes
  • Parafilm
  • Additional reagents and equipment for determining protein concentration ( appendix 3I)

Alternate Protocol 1: Measurement of NQO1 Activity by Coupled Menadione‐Cytochrome c Reduction Assay

  • 10 mM horse heart cytochrome c (Sigma): prepare fresh in H 2O
  • 10 mM menadione (e.g., Sigma): prepare fresh in ethanol

Basic Protocol 4: Detection of the NQO1*2 Polymorphism by Polymerase Chain Reaction/Restriction Fragment Length Polymorphism Assay

  Materials
  • Genomic DNA
  • 10× PCR buffer (see recipe)
  • 2 mM each dNTP
  • 150 to 180 µg/ml oligonucleotide primers (dissolved separately in sterile H 2O and stored at −20°C):
    • NQO1 top 5′‐CCTCAGAGTGGCATTCTGCATTTC‐3′
    • NQO1 bottom 5′‐TCTCCTCATCCTGTACCTCTTTTTC‐3′
  • 5 U/µl Taq DNA polymerase
  • Buffer B (included with HinfI restriction enzyme; Promega)
  • 10 U/µl HinfI (Promega)
  • 2% (w/v) E‐agarose gels (Invitrogen)
  • Molecular weight markers (1‐kb ladder; Invitrogen), optional
  • Additional reagents and equipment for performing agarose gel electrophoresis (e.g., see appendix 3A or unit 2.2)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Baulig, A., Garlatti, M., Bonvallot, V., Marchand, A., Barouki, R., Marano, F., and Baeza‐Squiban, A. 2003. Involvement of reactive oxygen species in the metabolic pathways triggered by diesel exhaust particles in human airway epithelial cells. Am. J. Physiol. Lung Cell Mol. Physiol. 285:L671‐L679.
   Beall, H.D., Liu, Y., Siegel, D., Bolton, E.M., Gibson, N.W., and Ross, D. 1996. Role of NAD(P)H:quinone oxidoreductase (DT‐diaphorase) in cytotoxicity and induction of DNA damage by streptonigrin. Biochem. Pharmacol. 51:645‐652.
   Beyer, R.E., Segura‐Aguilar, J., Di Bernardo, S., Cavazzoni, M., Fato, R., Fiorentini, D., Galli, M.C., Setti, M., Landi, L., and Lenaz, G. 1996. The role of DT‐diaphorase in the maintenance of the reduced antioxidant form of coenzyme Q in membrane systems. Proc. Natl. Acad. Sci. U.S.A. 93:2528‐2532.
   Boothman, D.A., Meyers, M., Fukunaga, N., and Lee, S.W. 1993. Isolation of x‐ray‐inducible transcripts from radioresistant human melanoma cells. Proc. Natl. Acad. Sci. U.S.A. 90:7200‐7204.
   Cresteil, T. and Jaiswal, A.K. 1991. High levels of expression of the NAD(P)H:quinone oxidoreductase (NQO1) gene in tumor cells compared to normal cells of the same origin. Biochem. Pharmacol. 42:1021‐1027.
   Eickelmann, P., Schulz, W.A., Rohde, D., Schmitz‐Drager, B., and Sies, H. 1994. Loss of heterozygosity at the NAD(P)H:quinone oxidoreductase locus associated with increased resistance against mitomycin C in a human bladder carcinoma cell line. Biol. Chem. Hoppe Seyler 375:439‐445.
   Ernster, L. 1967. DT‐diaphorase. Meth. Enzymol. 10:309‐317.
   Guo, W., Reigan, P., Siegel, D., Zirrolli, J., Gustafson, D., and Ross, D. 2005. Formation of 17‐allylamino‐demethoxygeldanamycin (17‐AAG) hydroquinone by NAD(P)H:quinone oxidoreductase 1: Role of 17‐AAG hydroquinone in heat shock protein 90 inhibition. Cancer Res. 65:10006‐10015.
   Kelsey, K.T., Ross, D., Traver, R.D., Christiani, D.C., Zuo, Z.F., Spitz, M.R., Wang, M., Xu, X., Lee, B.K., Schwartzm B.S., and Wiencke, J.K. 1997. Ethnic variation in the prevalence of a common NAD(P)H quinone oxidoreductase polymorphism and its implications for anti‐cancer chemotherapy. Br. J. Cancer. 76:852‐854.
   Kiffmeyer, W.R., Langer, E., Davies, S.M., Envall, J., Robison, L.L., and Ross, J.A. 2004. Genetic polymorphisms in the Hmong population: Implications for cancer etiology and survival. Cancer 100:411‐417.
   Lind, C., Hochstein, P., and Ernster, L. 1982. DT‐diaphorase as a quinone reductase: A cellular control device against semiquinone and superoxide radical formation. Arch. Biochem. Biophys. 216:178‐185.
   Marchand, A., Barouki, R., and Garlatti, M. 2004. Regulation of NAD(P)H:quinone oxidoreductase 1 gene expression by CYP1A1 activity. Mol. Pharmacol. 65:1029‐1037.
   Ross, D., Siegel, D., Beall, H., Prakash, A.S., Mulcahy, R.T., and Gibson, N.W. 1993. DT‐diaphorase in activation and detoxification of quinones. Bioreductive activation of mitomycin C. Cancer Metastasis Rev. 12:83‐101.
   Schlager, J.J. and Powis, G. 1990. Cytosolic NAD(P)H:(quinone‐acceptor) oxidoreductase in human normal and tumor tissue: Effects of cigarette smoking and alcohol. Int. J. Cancer. 45:403‐409.
   Siegel, D. and Ross, D. 2000. Immunodetection of NAD(P)H:quinone oxidoreductase 1 (NQO1) in human tissues. Free Radic. Biol. Med. 29:246‐253.
   Siegel, D., Gibson, N.W., Preusch, P.C., and Ross, D. 1990. Metabolism of mitomycin C by DT‐diaphorase: Role in mitomycin C‐induced DNA damage and cytotoxicity in human colon carcinoma cells. Cancer Res. 50:7483‐7489.
   Siegel, D., Beall, H., Senekowitsch, C., Kasai, M., Arai, H., Gibson, N.W., and Ross, D. 1992. Bioreductive activation of mitomycin C by DT‐diaphorase. Biochemistry. 31:7879‐7885.
   Siegel, D., Bolton, E.M., Burr, J.A., Liebler, D.C., and Ross, D. 1997. The reduction of alpha‐tocopherolquinone by human NAD(P)H:quinone oxidoreductase: The role of alpha‐tocopherolhydroquinone as a cellular antioxidant. Mol. Pharmacol. 52:300‐305.
   Siegel, D., Franklin, W.A., and Ross, D. 1998. Immunohistochemical detection of NAD(P)H:quinone oxidoreductase in human lung and lung tumors. Clin. Cancer Res. 4:2065‐2070.
   Siegel, D., McGuinness, S.M., Winski, S.L., and Ross, D. 1999. Genotype‐phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics 9:113‐121.
   Siegel, D., Anwar, A., Winski, S.L., Kepa, J.K., Zolman, K.L., and Ross, D. 2001. Rapid polyubiquitination and proteasomal degradation of a mutant form of NAD(P)H:quinone oxidoreductase 1. Mol. Pharmacol. 59:263‐268.
   Siegel, D., Gustafson, D.L., Dehn, D.L., Han, J.Y., Boonchoong, P., Berliner, L.J., and Ross, D. 2004. NAD(P)H:quinone oxidoreductase 1: Role as a superoxide scavenger. Mol. Pharmacol. 65:1238‐1247.
   Sreerama, L., Hedge, M.W., and Sladek, N.E. 1995. Identification of a class 3 aldehyde dehydrogenase in human saliva and increased levels of this enzyme, glutathione S‐transferases, and DT‐diaphorase in the saliva of subjects who continually ingest large quantities of coffee or broccoli. Clin. Cancer Res. 1:1153‐1163.
   Strassburg, A., Strassburg, C.P., Manns, M.P., and Tukey, R.H. 2002. Differential gene expression of NAD(P)H:quinone oxidoreductase and NRH:quinone oxidoreductase in human hepatocellular and biliary tissue. Mol. Pharmacol. 61:320‐325.
   Thor, H., Smith, M.T., Hartzell, P., Bellomo, G., Jewell, S.A., and Orrenius, S. 1982. The metabolism of menadione (2‐methyl‐1,4‐naphthoquinone) by isolated hepatocytes. A study of the implications of oxidative stress in intact cells. J. Biol. Chem. 257:12419‐12425.
   Traver, R.D., Horikoshi, T., Danenberg, K.D., Stadlbauer, T.H., Danenberg, P.V., Ross, D., and Gibson, N.W. 1992. NAD(P)H:quinone oxidoreductase gene expression in human colon carcinoma cells: Characterization of a mutation which modulates DT‐diaphorase activity and mitomycin sensitivity. Cancer Res. 52:797‐802.
   Traver, R.D., Siegel, D., Beall, H.D., Phillips, R.M., Gibson, N.W., Franklin, W.A., and Ross, D. 1997. Characterization of a polymorphism in NAD(P)H:quinone oxidoreductase (DT‐diaphorase). Br. J. Cancer. 75:69‐75.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library