Manipulation of Expression of Arsenic (+3 Oxidation State) Methyltransferase in Cultured Cells

Zuzana Drobna1, Miroslav Styblo2, David J. Thomas3

1 University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, 2 Center for Environmental Medicine, Asthma, and Lung Biology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, 3 Pharmacokinetics Branch, Experimental Toxicology Division, National Health and Environmental Effects Research Laboratory, Office of Research and Development, U.S. Environmental Protection Agency, Research Triangle Park, North Carolina
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 4.35
DOI:  10.1002/0471140856.tx0435s43
Online Posting Date:  February, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Methylation of inorganic arsenic to produce mono‐, di‐, or trimethylated products is the central process in the cellular metabolism of arsenic. Identification of arsenic (+3 oxidation state) methyltransferase (As3mt) as the enzyme that could catalyze all the steps in the pathway for arsenic methylation suggests that expression of this enzyme could be a useful target for manipulation. Here, methods are described for heterologous expression of the rat As3mt gene in a human urothelial cell line that normally does not express this enzyme and for silencing of the AS3MT gene by RNA interference in a human hepatoma cell line. These tools can be applied to elucidating the role of methylation in the toxic and carcinogenic effects of arsenicals. Curr. Protoc. Toxicol. 43:4.35.1‐4.35.24. © 2010 by John Wiley & Sons, Inc.

Keywords: arsenic; arsenic (+3 oxidation state) methyltransferase; UROtsa cells (human urothelial cells); heterologous expression; human hepatoma cells (HepG2 cells); RNA interference; shRNA

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Heterologous Expression of Rat As3mt in a Cultured Human Cell Line
  • Basic Protocol 2: Silencing of Human AS3MT Gene Expression by RNA Interference
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Heterologous Expression of Rat As3mt in a Cultured Human Cell Line

  Materials
  • Rat liver cDNA
  • rAs3mt cDNA: full‐length rAs3mt cDNA is amplified from rat liver cDNA using PCR Primers (5′‐GATCGACTCGAGTTCCTGAGACCCTCTGCCAAC‐3′ and 5′‐GATCGAGAATTCCTAGCAGCTTTTCCTTTTGCC‐3′) (Walton et al., )
  • Expression vector: retroviral vector, e.g., pLEGFP‐N1, pRetroQ‐AcGFP1‐N1/C1 (Clontech)
  • XhoI and EcoRI
  • pRSET vector (Invitrogen)
  • Buffer 2 (New England Biolabs)
  • Molecular biology–grade water
  • T4 DNA ligase
  • QIAprep Spin Miniprep kit
  • Ultra‐competent DH5α E. coli strain (Stratagene) for transformation with a rAs3mt expressing vector
  • SOC medium (Invitrogen) for E. coli transformation
  • LB‐agar plates containing 100 µg/ml ampicillin (see recipe)
  • 10 mM dNTP mix (Invitrogen, cat. no. 18427‐013)
  • Taq polymerase kit (Invitrogen, cat. no. 10342‐020) containing:
    • 10× PCR buffer
    • MgCl 2
  • Primers for sequencing of the rAs3mt insert in the expression vector of choice—the primers specific for pLEGFP‐N1/rAS3MT vector are as follows:
    • CMV/forward 5′‐GGATAGCGGTTTGACTCACGC‐3′
    • EGFP‐N/reverse 5′‐CGTCGCCGTCCAGCTCGACCAG‐3′
  • Luria‐Bertani (LB) broth (Invitrogen) containing 100 µg/ml ampicillin
  • 6‐well collagen I–coated culture plates (BD Biosciences, cat. no. 356400)
  • AmphoPack‐293 retrovirus packaging cell line (Clontech) for production of recombinant retroviral particles
  • AmphoPack‐293 medium (see recipe)
  • OPTI‐MEM medium (Invitrogen)
  • Fugene6 (Roche)
  • 100 µg/ml ampicillin (Sigma)
  • 250 µg/ml geneticin (G418, Invitrogen)
  • UROtsa cell line (Rossi et al., )
  • UROtsa medium (see recipe)
  • Polybrene (1,5‐dimethyl‐1,5‐diazaundecamethylene polymethobromide, hexadimethrine bromide, Sigma‐Aldrich)
  • Primers for analysis of rAs3mt mRNA expression in transduced UROtsa/F35 cells:
    • Forward 5′‐ATTTTGGATCTGGGCAGTGGGAGT‐3′
    • Reverse 5′‐AGTGACCAAACGTGGAGGGCAGA‐3′
  • Primers for analysis of β‐actin mRNA expression in cells:
    • Forward 5′‐TCATGAAGTGTGACGTTGACATCCGT‐3′
    • Reverse 5′‐CCTAGAAGCATTTGCGGTGCACGATG‐3′
  • Primary anti‐As3mt antibody/antiserum
  • RIPA lysis buffer (see recipe)
  • Corresponding secondary antibody conjugated with horseradish peroxidase [HRP; e.g., anti‐rabbit HRP‐conjugated antibody (Santa Cruz Biotechnology, cat. no. sc‐2004)]
  • Purified or recombinant rAs3mt to be used as a positive control (unit 4.34)
  • Enhanced chemiluminescence (ECL) reagent for detection of the antibody‐antigen complexes (Super Signal West Pico ECL reagent; Pierce, cat. no. 34077)
  • Laminar‐flow level‐2 biological safety cabinet for sterile cell manipulations and safe handling of viral particles
  • 37°C shaking incubator
  • 37°C humidified cell culture incubator with 95% air, 5% CO 2 atmosphere
  • Conventional or real‐time PCR cycler
  • 200‐µl PCR tubes
  • 60‐mm culture plates
  • 0.45‐µm low‐protein‐binding cellulose acetate or polysulfonic filter
  • Electroblot module for transfer of proteins separated by PAGE to PVDF membranes (e.g., Mini Trans‐Blot Cell; Bio‐Rad, cat. no. 170‐3930)
  • X‐ray or autoradiography films and cassettes
  • Imaging system for detection and quantification of the HRP signal (e.g., GeneGnome imaging system; Syngene)
  • Additional reagents and equipment for digesting DNA with restriction enzymes (Bloch and Grossman, ), PCR (Kramer and Coen, ), real‐time PCR (Drobna et al., ), immunoblot analysis (Drobna et al., ), SDS‐PAGE (Gallagher, ), and quantitation of iAs (unit 4.32)

Basic Protocol 2: Silencing of Human AS3MT Gene Expression by RNA Interference

  Materials
  • Anti‐hAS3MT shRNA construct (the construct shown in Fig. was custom synthesized by Operon Biotechnologies and purified by PAGE)
  • Expression vector: pSIREN‐RetroQ retroviral vector encoding for ampicillin and puromycin resistance genes (Clontech)
  • TE buffer
  • 10× T4 DNA ligase buffer
  • Bovine serum albumin (BSA)
  • Nuclease‐free water
  • T4 DNA ligase
  • XL10‐Gold Ultracompetent E. coli cells (Stratagene)
  • SOC medium (Invitrogen)
  • 10‐cm LB‐agar plates containing 100 µg/ml ampicillin (see recipe)
  • Luria‐Bertani (LB) broth (Invitrogen) containing 100 µg/ml ampicillin
  • QIAprep Spin Miniprep Kit (Qiagen)
  • MluI and XhoI (New England Biolabs)
  • NEB buffer #3
  • Molecular biology–grade water
  • U6 promoter–specific primer (5′‐GGGCAGGAAGAGGGCCTAT‐3′)
  • AmphoPack‐293 cells for production of recombinant retroviral particles encoding for shRNA (Clontech)
  • 6‐well collagen I–coated plates (BD Biosciences, cat. no. 356400)
  • AmphoPack‐293 medium (see recipe)
  • OPTI‐MEM medium (Invitrogen)
  • GeneJuice (Novagen, Darmstad, Germany)
  • Puromycin (10 mg/ml; Sigma) for selection of transfected AmphoPack‐293 and transduced HepG2 cells
  • HepG2 cells (ATCC HB8065)
  • HepG2 medium (see recipe)
  • Polybrene
  • Primers for analysis of hAS3MT expression:
    • Forward: 5′‐CGTCTATACGAGCCTTGAA‐3′
    • Reverse: 5′‐TTAGCAGCTTTTCTTTGTGC‐3′ that amplify a 616‐bp cDNA sequence
  • 37°C shaking incubator
  • 37°C, 5% CO 2 incubator
  • Additional reagents and equipment for restriction enzyme digestion (Bloch and Grossman, ), conventional (Drobna et al., ) or real‐time PCR (Drobna et al., ), and immunoblot analysis (Drobna et al., )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. 1999. Short Protocols in Molecular Biology, 4th ed. Wiley, New York.
   Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.) 2009. Current Protocols in Molecular Biology. John Wiley & Sons. Hoboken, N.J.
   Bloch, K.D. and Grossmann, B. 1995. Digestion of DNA with restriction endonucleases. Curr. Protoc. Mol. Biol. 31:3.1.1‐3.1.21.
   Drobna, Z., Waters, S.B., Walton, F.S., LeCluyse, E.L., Thomas, D.J., and Styblo, M. 2004. Interindividual variation in the metabolism of arsenic in cultured primary human hepatocytes. Toxicol. Appl. Pharmacol. 201:166‐177.
   Drobna, Z., Waters, S.B., Devesa, V., Harmon, A.W., Thomas, D.J., and Styblo, M. 2005. Metabolism and toxicity of arsenic in human urothelial cells expressing rat arsenic (+3 oxidation state) methyltransferase. Toxicol. Appl. Pharmacol. 207:147‐159.
   Drobna, Z., Xing, W., Thomas, D.J., and Styblo, M. 2006. shRNA silencing of AS3MT expression minimizes arsenic methylation capacity of HepG2 cells. Chem. Res. Toxicol. 19:894‐898.
   Fomenko, D.E., Xing, W., Adair, B.M., Thomas, D.J., and Gladyshev, V.N. 2007. High‐throughput identification of catalytic redox‐active cysteine residues. Science 315:387‐389.
   Freshney, R.I. 2000. Culture of Animal Cells, 4th ed. Wiley‐Liss, New York.
   Gallagher, S. 2006. One‐Dimensional SDS gel electrophoresis of proteins. Curr. Protoc. Mol. Biol. 75:10.2A.1‐10.2A.37.
   Gordon, J.A. 1991. Use of vanadate as protein‐phosphotyrosine phosphatase inhibitor. Methods Enzymol. 201:477‐482.
   Joshua‐Tor, L. 2006. The Argonautes. Cold Spring Harb. Symp. Quant. Biol. 71:67‐72.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
   Kumar, L.D. and Clarke, A.R. 2007. Gene manipulation through the use of small interfering RNA (siRNA): From in vitro to in vivo applications. Adv. Drug Deliv. Rev. 59:87‐100
   Lin, S., Shi, Q., Nix, F.B., Styblo, M., Beck, M.A., Herbin‐Davis, K.M., Hall, L.L., Simeonsson, J.B., and Thomas, D.J. 2002. A novel S‐adenosyl‐L‐methionine:arsenic(III) methyltransferase from rat liver cytosol. J. Biol. Chem. 277:10795‐10803.
   Petzoldt, J.L., Leigh, I.M., Duffy, P.G., Sexton, C., and Masters, J.R. 1995. Immortalisation of human urothelial cells. Urol. Res. 23:377‐380.
   Rossi, M.R., Masters, J.R., Park, S., Todd, J.H., Garrett, S.H., Sens, M.A., Somji, S., Nath, J., and Sens, D.A. 2001. The immortalized UROtsa cell line as a potential cell culture model of human urothelium. Environ. Health Perspect. 109:801‐808.
   Sambrook, J. and Russell, D. 2001. Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
   Thomas, D.J., Li, J., Waters, S.B., Xing, W., Adair, B.M., Drobna, Z., Devesa, V., and Styblo, M. 2007. Arsenic (+3 oxidation state) methyltransferase and the methylation of arsenicals. Exp. Biol. Med. 232:3‐13.
   Tijsterman, M. and Plasterk, R.H. 2004. Dicers at RISC; the mechanism of RNAi. Cell 117:1‐3.
   Walton, F.S., Waters, S.B., Jolley, S.L., LeCluyse, E.L., Thomas, D.J., and Styblo, M. 2003. Selenium compounds modulate the activity of recombinant rat AsIII‐methyltransferase and the methylation of arsenite by rat and human hepatocytes. Chem. Res. Toxicol. 16:261‐265.
   Waters, S.B., Devesa, V., Fricke, M.W., Creed, J.T., Styblo, M., and Thomas, D.J. 2004. Glutathione modulates recombinant rat arsenic (+3 oxidation state) methyltransferase‐catalyzed formation of trimethylarsine oxide and trimethylarsine. Chem. Res. Toxicol. 17:1621‐1629.
   Wood, T.C., Salavagionne, O.E., Mukherjee, B., Wang, L., Klumpp, A.F., Thomae, B.A., Eckloff, B.W., Schaid, D.J., Wieben, E.D., and Weinshilboum, R.M. 2006. Human arsenic methyltransferase (AS3MT) pharmacogenetics: Gene resequencing and functional genomics studies. J. Biol. Chem. 281:7364‐7373.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library