CYP1B1 Detection

Rao L. Divi1, Andreas Luch2, Mukesh Verma1, Brinda Mahadevan3

1 Methods and Technologies Branch, Division of Cancer Control and Population Sciences, National Cancer Institute, NIH, Bethesda, Maryland, 2 German Federal Institute for Risk Assessment, Berlin, Germany, 3 Global Occupational Toxicology, Abbott Laboratories, Abbott Park, Illinois
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 4.38
DOI:  10.1002/0471140856.tx0438s51
Online Posting Date:  February, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes procedures for measuring CYP1B1 gene expression by reverse transcription real‐time PCR (qRT‐PCR), CYP1B1 protein levels by western blotting, and CYP1B1 enzyme activity through conversion of 7‐ethoxyresorufin substrate. To achieve specific measurement of CYP1B1 activity in the presence of CYP1A1 and CYP1A2, CYP1B1 inhibition and a subtractive approach have been adopted. 2,4,3′,5′‐Tetramethoxystilbene (TMS) is a potent and selective competitive inhibitor of CYP1B1 with an IC50 of 3 nM for EROD and ∼90 nM for E2 4‐hydroxylation. Binding studies with purified CYP1B1 suggests that TMS interferes in the proximity of the heme region of CYP1B1 with high affinity. Compared to other potent inhibitors such as α‐naphthoflavone, which is a known CYP1 family inhibitor with no selectivity between CYP1B1 and CYP1A2, TMS is ∼50‐ and 520‐fold selective for inhibition of CYP1B1 when compared to CYP1A1 and CYP1A2, respectively. Thus, TMS can serve as a helpful chemical scalpel for dissecting CYP1B1 activity from the overall activity of CYP1 family members against ethoxyresorufin. Curr. Protoc. Toxicol. 51:4.38.1‐4.38.26. © 2012 by John Wiley & Sons, Inc.

Keywords: cytochrome P4501B1; quantitative gene expression; CYP1B1 enzyme activity; western blotting; CYP1B1 inhibition

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Genomic DNA as Standard for Real‐Time PCR for Measuring CYP1B1 mRNA Copy Number (Absolute Quantification) in Universal cDNA
  • Support Protocol 1: Isolation of RNA from Cultured Cells for Detection of CYP1B1 Expression by Copy Number Using qRT‐PCR
  • Support Protocol 2: Reverse Transcription of RNA from NHMEC and MCF‐7 Cells for Detection of CYP1B1 Expression by Copy Number Using qRT‐PCR
  • Support Protocol 3: Purification of cDNA for Detection of CYP1B1 Expression by Copy Number Using qRT‐PCR
  • Basic Protocol 2: Detection of CYP1B1 by Gel Electrophoresis and Immunoblotting
  • Basic Protocol 3: Measurement of CYP1B1 Activity by the EROD Assay: A Subtractive Inhibition Approach in the Presence of 2,3′,4,5′ Tetramethoxystilbene
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Genomic DNA as Standard for Real‐Time PCR for Measuring CYP1B1 mRNA Copy Number (Absolute Quantification) in Universal cDNA

  Materials
  • DNA standards: genomic DNA (gDNA) and human universal cloned DNA (HUcDNA)
  • RNase‐free water
  • CYP1B1 qRT‐PCR primers, forward and reverse (mRNA sequence: NM_00104)
    • Forward primer: 5′ to 3′ (22 nt; T m: 56.3°C; GC: 45.5%): TGTCCTGGCCTTCCTTTATGA
    • Reverse primer: 5′ to 3′ (20 nt; T m: 52.1°C; GC: 55%): AGACAGAGGTGTTGGCAGTG
  • 2× iQ SYBR Green Supermix (Bio‐Rad) containing: dNTPs, 50 U/ml iTaq DNA polymerase, 6 mM MgCl 2, SYBR Green I, and 20 nM fluorescein
  • Spectrophotometer
  • 1.5‐ml microcentrifuge tubes
  • 96‐well qRT‐PCR plates
  • qRT‐PCR plate sealing film
  • Centrifuge with micro‐plate rotor
  • qRT‐PCR thermal cycler with accompanying acquisition software (i.e., Bio‐Rad MyiQ)

Support Protocol 1: Isolation of RNA from Cultured Cells for Detection of CYP1B1 Expression by Copy Number Using qRT‐PCR

  Materials
  • Cells cultured in 25‐ml culture flasks
  • 1× phosphate buffered saline (PBS; appendix 2A)
  • RNAqueous‐4PCR kit (Ambion, cat. no. AM1914)
  • 64% ethanol
  • Cell scraper
  • Sterile 1.5‐ml polypropylene microcentrifuge tubes
  • Microcentrifuge (Eppendorf, cat. no. 022620623)
  • Thermomixer (Eppendrorf, cat. no. 022670107)
  • RNase‐free pipets and tips
  • NanoDrop (Thermo Scientific)

Support Protocol 2: Reverse Transcription of RNA from NHMEC and MCF‐7 Cells for Detection of CYP1B1 Expression by Copy Number Using qRT‐PCR

  Materials
  • Retroscript kit (Ambion, Applied Biosystems)
  • RNA isolated from cells
  • 85°C water bath
  • 42°C microcentrifuge tube shaker

Support Protocol 3: Purification of cDNA for Detection of CYP1B1 Expression by Copy Number Using qRT‐PCR

  Materials
  • Centriprep centrifugal filter unit with Ultracel‐10 membrane (Microcon YM‐10 filters; Millipore)
  • 1× TE
  • Isolated RNA
  • 1.5‐ml microcentrifuge tubes
  • Nanodrop

Basic Protocol 2: Detection of CYP1B1 by Gel Electrophoresis and Immunoblotting

  Materials
  • Cells
  • 1× PBS ( appendix 2A)
  • Lysis buffer (see recipe)
  • BCA protein assay kit (Pierce Biotechnology, cat. no. 23227)
  • SDS‐PAGE sample loading buffer ( appendix 2A)
  • 12% SDS/polyacrylamide gel
  • PVDF membranes (0.2 µM; Invitrolon PVDF, Invitrogen, cat. no. LC2005)
  • Blocking buffer (see recipe)
  • Anti‐CYP1B1 antibodies (WB‐1B1, anti‐human CYP1B, BD Biosciences, cat. no. 458211)
  • PBST (see recipe)
  • AP‐conjugated secondary antibody (Jackson Immunoresearch, cat. no. 111‐056‐047)
  • CDP‐Star solution (Applied Biosystems, cat. no. T2147)
  • Sonicator (Ultrasonic Processor, Sonics & Materials), optional
  • Refrigerated centrifuge
  • 1.5‐ml microcentrifuge tubes
  • 2.0‐ml micro‐ultracentrifuge tubes (Beckman)
  • Ultracentrifuge (Beckman)
  • SDS‐PAGE equipment
  • Chemiluminescent imaging device (e.g., Lumi‐Imager, Roche Applied Science)
  • Analysis software for image processing and quantification (e.g., LumiAnalyst, Roche Applied Science)

Basic Protocol 3: Measurement of CYP1B1 Activity by the EROD Assay: A Subtractive Inhibition Approach in the Presence of 2,3′,4,5′ Tetramethoxystilbene

  Materials
  • MCF‐7 cells (ATCC #HTB‐22) cultured as monolayers in 12‐well plates
  • Cell growth medium
  • AhR agonists (i.e., Benzo[a]pyrene, dioxins, etc.), optional
  • DMSO, cell culture or molecular biology grade
  • Ethoxyresorufin (7‐ethoxy‐3H‐phenoxazin‐3‐one; Sigma, cat. no. E3763)
  • Salicylamide (Sigma, cat. no. 842300)
  • Resorufin sodium salt (7‐hydroxy‐3H‐phenoxazin‐3‐one, sodium salt; Sigma, cat. no. R3257)
  • 2,3′,4,5′ Tetramethoxystilbene (TMS; Cayman Chemical, cat. no. 10038)
  • Nitrogen source
  • Dulbecco's phosphate buffered saline (DPBS; appendix 2A)
  • Radio‐immunoprecipitation assay (RIPA) buffer (Sigma‐Aldrich cat. no. R0278)
  • BCA protein assay kit (Pierce)
  • 1.5‐ml microcentrifuge tubes
  • Opaque 96‐well plates (Greiner Bio One, cat. no. 655095)
  • Microplate fluorescence reader (Infinite 200, Tecan)
  • 37°C incubator
  • Sonicator (Ultrasonic Processor, Sonics & Materials)
  • 96‐well clear plates
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Aldridge, G.M., Podrebarac, D.M., Greenough, W.T., and and Weiler, I.J. 2008. The use of total protein stains as loading controls: An alternative to high‐abundance single‐protein controls in semi‐quantitative immunoblotting. J. Neurosci. Methods 172:250‐254.
   Barnett, J.A., Urbauer, D.L., Murray, G.I., Fuller, G.N., and Heimberger, A.B. 2007. Cytochrome P450 1B1 expression in glial cell tumors: An immunotherapeutic target. Clin. Cancer Res. 13:3559‐3567.
   Berstein, L.M., Zimarina, T.S., Tsyrlina, E.V., Kovalevskii, A.I., and Imianitov, E.N. 2004. Genetic polymorphism of steroidogenic enzymes and steroid receptor level in tumors of the reproductive system. Vopr. Onkol. 50:169‐173.
   Brauers, A., Manegold, E., Buettner, R., Baron, J.M., Merk, H.F., and Jakse, G. 2000. Cytochrome P450 isoenzyme mRNA expression pattern in human urinary bladder malignancies and normal urothelium. Cancer Detect. Prev. 24:356‐363.
   Bruno, R.D. and Njar, V.C. 2007. Targeting cytochrome P450 enzymes: A new approach in anti‐cancer drug development. Bioorg. Med. Chem. 15:5047‐5060.
   Bustin, S.A. 2000. Absolute quantification of mRNA using real‐time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25:169‐193.
   Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., and Wittwer, C.T. 2009. The MIQE guidelines: Minimum information for publication of quantitative real‐time PCR experiments. Clin. Chem. 55:611‐622.
   Chun, Y.J. and Kim, S. 2003. Discovery of cytochrome P450 1B1 inhibitors as new promising anti‐cancer agents. Med. Res. Rev. 23:657‐668.
   Chun, Y.J., Kim, S., Kim, D., Lee, S.K., and Guengerich, F.P. 2001. A new selective and potent inhibitor of human cytochrome P450 1B1 and its application to antimutagenesis. Cancer Res. 61:8164‐8170.
   Cikos, S., Bukovska, A., and Koppel, J. 2007. Relative quantification of mRNA: Comparison of methods currently used for real‐time PCR data analysis. BMC Mol. Biol. 8:113.
   Gibson, P., Gill, J.H., Khan, P.A., Seargent, J.M., Martin, S.W., Batman, P.A., Griffith, J., Bradley, C., Double, J.A., Bibby, M.C., and Loadman, P.M. 2003. Cytochrome P450 1B1 (CYP1B1) is overexpressed in human colon adenocarcinomas relative to normal colon: Implications for drug development. Mol. Cancer Ther. 2:527‐534.
   Hakkola, J., Pasanen, M., Pelkonen, O., Hukkanen, J., Evisalmi, S., Anttila, S., Rane, A., Mantyla, M., Purkunen, R., Saarikoski, S., Tooming, M., and Raunio, H. 1997. Expression of CYP1B1 in human adult and fetal tissues and differential inducibility of CYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and cultured cells. Carcinogenesis 18:391‐397.
   Huggett, J., Dheda, K., Bustin, S., and Zumla, A. 2005. Real‐time RT‐PCR normalization: Strategies and considerations. Genes Immun. 6:279‐284.
   Jefcoate, C.R., Liehr, J.G., Santen, R.J., Sutter, T.R., Yager, J.D., Yue, W., Santner, S.J., Tekmal, R., Demers, L., Pauley, R., Naftolin, F., Mor, G., and Berstein, L. 2000. Tissue‐specific synthesis and oxidative metabolism of estrogens. J. Natl. Cancer Inst. Monogr. 27:95‐112.
   Lalam, N. 2006. Estimation of the reaction efficiency in polymerase chain reaction. J. Theor. Biol. 242:947‐953.
   Larionov, A., Krause, A., and Miller, W. 2005. A standard curve based method for relative real time PCR data processing. BMC. Bioinformatics. 6:62.
   Ling, D. and Salvaterra, P.M. 2011. Robust RT‐qPCR data normalization: Validation and selection of internal reference genes during post‐experimental data analysis. PLoS One 6:e17762.
   Muskhelishvili, L., Thompson, P.A., Kusewitt, D.F., Wang, C., and Kadlubar, F.F. 2001. In situ hybridization and immunohistochemical analysis of cytochrome P450 1B1 expression in human normal tissues. J. Histochem. Cytochem. 49:229‐236.
   Nelson, D.R., Zeldin, D.C., Hoffman, S.M., Maltais, L.J., Wain, H.M., and Nebert, D.W. 2004. Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative‐splice variants. Pharmacogenetics 14:1‐18.
   Peter, G.F., Chun, Y.J., Kim, D., Gillam, E.M., and Shimada, T. 2003. Cytochrome P450 1B1: A target for inhibition in anticarcinogenesis strategies. Mutat. Res. 523‐524:173‐182.
   Petrulis, J.R., Chen, G., Benn, S., LaMarre, J., and Bunce, N.J. 2001. Application of the ethoxyresorufin‐O‐deethylase (EROD) assay to mixtures of halogenated aromatic compounds. Environ. Toxicol. 16:177‐184.
   Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real‐time RT‐PCR. Nucleic Acids Res. 29:e45.
   Pfaffl, M.W. and Hageleit, M. 2001. Validities of mRNA quantification using recombinant RNA and recombinant DNA external calibration curves in real‐time RT‐PCR. Biotechnol. Lett. 23:275‐282.
   Pfaffl, M.W., Georgieva, T.M., Georgiev, I.P., Ontsouka, E., Hageleit, M., and Blum, J.W. 2002. Real‐time RT‐PCR quantification of insulin‐like growth factor (IGF)‐1, IGF‐1 receptor, IGF‐2, IGF‐2 receptor, insulin receptor, growth hormone receptor, IGF‐binding proteins 1, 2 and 3 in the bovine species. Domest. Anim. Endocrinol. 22:91‐102.
   Santostefano, M., Merchant, M., Arellano, L., Morrison, V., Denison, M.S., and Safe, S. 1993. Alpha‐naphthoflavone‐induced CYP1A1 gene expression and cytosolic aryl hydrocarbon receptor transformation. Mol. Pharmacol. 43:200‐206.
   Shimada, T. and Guengerich, F.P. 2006. Inhibition of human cytochrome P450 1A1‐, 1A2‐, and 1B1‐mediated activation of procarcinogens to genotoxic metabolites by polycyclic aromatic hydrocarbons. Chem. Res. Toxicol. 19:288‐294.
   Shimada, T., Yamazaki, H., Mimura, M., Wakamiya, N., Ueng, Y.F., Guengerich, F.P., and Inui, Y. 1996. Characterization of microsomal cytochrome P450 enzymes involved in the oxidation of xenobiotic chemicals in human fetal liver and adult lungs. Drug Metab. Dispos. 24:515‐522.
   Shimada, T., Watanabe, J., Kawajiri, K., Sutter, T.R., Guengerich, F.P., Gillam, E.M., and Inoue, K. 1999. Catalytic properties of polymorphic human cytochrome P450 1B1 variants. Carcinogenesis 20:1607‐1613.
   Shimada, T., Inoue, K., Suzuki, Y., Kawai, T., Azuma, E., Nakajima, T., Shindo, M., Kurose, K., Sugie, A., Yamagishi, Y., Fujii‐Kuriyama, Y., and Hashimoto, M. 2002. Arylhydrocarbon receptor‐dependent induction of liver and lung cytochromes P450 1A1, 1A2, and 1B1 by polycyclic aromatic hydrocarbons and polychlorinated biphenyls in genetically engineered C57BL/6J mice. Carcinogenesis 23:1199‐1207.
   Shimada, T., Sugie, A., Shindo, M., Nakajima, T., Azuma, E., Hashimoto, M., and Inoue, K. 2003. Tissue‐specific induction of cytochromes P450 1A1 and 1B1 by polycyclic aromatic hydrocarbons and polychlorinated biphenyls in engineered C57BL/6J mice of arylhydrocarbon receptor gene. Toxicol. Appl. Pharmacol. 187:1‐10.
   Sutter, T.R., Tang, Y.M., Hayes, C.L., Wo, Y.Y., Jabs, E.W., Li, X., Yin, H., Cody, C.W., and Greenlee, W.F. 1994. Complete cDNA sequence of a human dioxin‐inducible mRNA identifies a new gene subfamily of cytochrome P450 that maps to chromosome 2. J. Biol. Chem. 269:13092‐13099.
   Taylor, M.C., McKay, J.A., Murray, G.I., Greenlee, W.F., Marcus, C.B., Burke, M.D., and Melvin, W.T. 1996. Cytochrome P450 1B1 expression in human malignant tumours. Biochem. Soc. Trans. 24:328S.
   Thier, R., Bruning, T., Roos, P.H., and Bolt, H.M. 2002. Cytochrome P450 1B1, a new keystone in gene‐environment interactions related to human head and neck cancer? Arch. Toxicol. 76:249‐256.
   Tokizane, T., Shiina, H., Igawa, M., Enokida, H., Urakami, S., Kawakami, T., Ogishima, T., Okino, S.T., Li, L.C., Tanaka, Y., Nonomura, N., Okuyama, A., and Dahiya, R. 2005. Cytochrome P450 1B1 is overexpressed and regulated by hypomethylation in prostate cancer. Clin. Cancer Res. 11:5793‐5801.
   Tsuchiya, Y., Nakajima, M., and Yokoi, T. 2005. Cytochrome P450‐mediated metabolism of estrogens and its regulation in human. Cancer Lett. 227:115‐124.
   Vandesompele, J., De, P.K., Pattyn, F., Poppe, B., Van, R.N., De, P.A., and Speleman, F. 2002. Accurate normalization of real‐time quantitative RT‐PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3:RESEARCH0034.
   Vasiliou, V. and Gonzalez, F.J. 2008. Role of CYP1B1 in glaucoma. Annu. Rev. Pharmacol. Toxicol. 48:333‐358.
   Watanabe, J., Shimada, T., Gillam, E.M., Ikuta, T., Suemasu, K., Higashi, Y., Gotoh, O., and Kawajiri, K. 2000. Association of CYP1B1 genetic polymorphism with incidence to breast and lung cancer. Pharmacogenetics 10:25‐33.
   Zimarina, T.C., Kristensen, V.N., Imianitov, E.N., and Bershtein, L.M. 2004. Polymorphisms of CYP1B1 and COMT in breast and endometrial cancer. Mol. Biol. (Mosk) 38:386‐393.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library