Oxidant‐Induced Regulation of Glutathione Synthesis

Rui‐Ming Liu1, Jinah Choi2, Henry J. Forman1

1 University Of Alabama At Birmingham, Birmingham, Alabama, 2 University Of Southern California, Los Angeles, California
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 6.7
DOI:  10.1002/0471140856.tx0607s08
Online Posting Date:  August, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes protocols for characterizing the expression of two glutathione biosynthesis enzymes: gamma‐glutamylcysteine synthase (GCS) and gamma‐glutamyl transpeptidase (GGT) in response to oxidants. GCS catalyzes the first and rate‐limiting step of glutathione synthesis, while GGT degrades extracellular glutathione (GSH) to provide the amino acids required for intracellular synthesis of GSH. Northern blot hybridization is used to quantitatively assess the mRNAs for the two enzymes in response to oxidant. Nuclear run‐on is used to determine the rate of transcription.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Northern Analysis of γ‐Glutamylcysteine Synthetase and γ‐Glutamyl Transpeptidase mRNA Content
  • Support Protocol 1: Radiolabeling γ‐Glutamylcysteine Synthetase Light and Heavy Subunit cDNA Probes
  • Support Protocol 2: Radiolabeling of γ‐Glutamyl Transpeptidase cRNA Probe
  • Basic Protocol 2: Nuclear Run‐On Analysis of γ‐Glutamylcysteine Synthetase and γ‐Glutamyl Transpeptidase Gene Transcription Rates
  • Basic Protocol 3: Immunoblot Analysis of γ‐Glutamylcysteine Synthetase Protein Content
  • Support Protocol 3: γ‐Glutamyl Transpeptidase Activity Assay
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Northern Analysis of γ‐Glutamylcysteine Synthetase and γ‐Glutamyl Transpeptidase mRNA Content

  Materials
  • Cells to be analyzed
  • Oxidant, e.g. 5 to 20 µM 2,3‐dimethoxyl, 4‐naphthoquinone (DMUQ)
  • Actinomycin D
  • Agarose
  • DEPC‐treated H 2O, water treated with 0.1% DEPC
  • 1× and 10× MOPS running buffer (see recipe)
  • 37% (w/v) formaldehyde
  • RNA loading mixture (see recipe)
  • RNA molecular weight markers
  • 2× SSC (unit 3.5)
  • Hybridization solution (e.g., QuikHyb, Stratagene)
  • Salmon sperm DNA
  • Radiolabeled γ‐glutamylcysteine synthetase light or heavy subunit (GCS‐LS or GCS‐HS) cDNA probe (see protocol 2) or radiolabeled γ‐glutamyl transpeptidase (GGT) cRNA probe (see protocol 3)
  • 2× SSC/0.1% (w/v) SDS
  • 0.1× SSC/0.1% (w/v) SDS, 50°C, and 70° to 75°C
  • 65°C and boiling water baths
  • Nylon membrane
  • Capillary blot transfer system
  • UV cross‐linker (e.g., Stratalinker 1800, Stratagene)
  • Hybridization oven (e.g., Hybaid), 60°C (optional)
  • X‐ray film (e.g., Kodak X‐Omat film, Eastman Kodak) or InstantImager (Packard Instrument)
  • Additional reagents and equipment for isolating total RNA (use commercially available reagents and protocols or see appendix 3E), agarose gel electrophoresis ( appendix 3A), and capillary transfer and probing of RNA (see northern blotting, appendix 3E)
CAUTION: Ethidium bromide (in RNA loading mixture) is a mutagen and must be handled carefully.

Support Protocol 1: Radiolabeling γ‐Glutamylcysteine Synthetase Light and Heavy Subunit cDNA Probes

  Materials
  • 5 × 106 rat epithelial L2 cells
  • Primers: 12.5 pmol for 50‐µl reactions
  •  GCS‐LS 5′ sense: 5′‐AGACCGGGAACCTGCTCAAC‐3′
  •  GCS‐LS 3′ antisense: 5′‐CATCACCCTGATGCCTAAGC‐3′
  •  GCS‐HS 5′ sense: 5′‐AGACACGGCATCCTCCAGTT‐3′
  •  GCS‐HS 3′ antisense: 5′‐CTGACACGTAGCTCGGTAA‐3′
  • Rad‐Prime DNA labeling system (Life Technologies), or equivalent, containing:
  •  1:1:1 (v/v/v) dATP/dGTP/dTTP
  •  2.5× reaction buffer
  •  Klenow fragment of E. coli DNA polymerase I
  •  Stop buffer
  • 10 µCi/µl [α‐32P]dCTP (800 Ci/mmol; e.g., ICN Biomedicals)
  • 1× STE buffer (see recipe)
  • Scintillation fluid (e.g., Scintisafe Econo 1 cocktail; Fisher)
  • 37°C and boiling water baths
  • NucTrap push column (Stratagene)
  • Additional reagents and equipment for reverse transcription ( appendix 3A) and PCR ( appendix 3C)

Support Protocol 2: Radiolabeling of γ‐Glutamyl Transpeptidase cRNA Probe

  Materials
  • pBluescript γ‐glutamyl transpeptidase (GGT) plasmid
  • NotI restriction enzyme and appropriate buffer
  • 1% (w/v) agarose gel
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (with TE‐saturated phenol, unit 2.2)
  • Riboprobe in vitro transcription system (Promega), or equivalent, containing:
  •  5× transcription‐optimized buffer
  •  100 mM dithiothreitol (DTT; also see appendix 2A)
  •  40 U/µl ribonuclease inhibitor (RNasin)
  •  Aqueous ATP/GTP/UTP (2.5 mM each nucleotide)
  •  15 to 20 U/µl T7 RNA polymerase
  •  RQ1 RNase‐free DNase
  • 10 µCi/µl [α‐32P]CTP (800 Ci/mmol; ICN Biomedicals)
  • DEPC‐treated H 2O: water treated with 0.1% DEPC
  • 0.1 M EDTA, pH 8.0 ( appendix 2A)
  • 10 mg/ml tRNA (Life Technologies)
  • 7.5 M ammonium acetate ( appendix 2A)
  • 100% ethanol, ice cold
  • Scintillation fluid and counter
  • Additional reagents and equipment for restriction enzyme digestion, agarose gel electrophoresis, and spectrophotometric quantification of DNA ( appendix 3A)

Basic Protocol 2: Nuclear Run‐On Analysis of γ‐Glutamylcysteine Synthetase and γ‐Glutamyl Transpeptidase Gene Transcription Rates

  Materials
  • Cells to be analyzed, at ∼80% confluence (≥20 × 106)
  • Oxidant (e.g., tert‐butylhydroquinone) in cell culture medium
  • PBS ( appendix 2A), ice cold
  • NP‐40 lysis buffer (see recipe)
  • Glycerol storage buffer (see recipe)
  • Target plasmid DNA, e.g., γ‐glutamylcysteine synthetase light subunit (GCS‐LS; Liu et al., ), heavy subunit (GCS‐HS; Liu et al., ), or γ‐glutamyl transpeptidase (GGT; Liu et al., )
  • Restriction enzymes (to linearize plasmid DNA) and appropriate buffers
  • 10 N NaOH
  • 6× and 12× SSC (unit 3.5)
  • 2.5 M (NH 4) 2SO 4, autoclave and store at 4°C
  • 1.0 M MgCl 2, autoclave and store at 4°C
  • 5.0 M NaCl, autoclave and store at 4°C
  • 0.25 M EDTA, pH 8.0 ( appendix 2A)
  • 1.0 M MnCl 2, autoclave and store at 4°C
  • 2.0 M Tris⋅Cl, pH 7.9 ( appendix 2A)
  • 57 mM phenylmethylsulfonyl fluoride (PMSF) in ethanol (store at −20°C)
  • 0.1 M dithiothreitol (DTT; appendix 2A)
  • 100 mM riboGTP, ATP, and CTP
  • 40 U/µl ribonuclease inhibitor (RNasin)
  • DEPC‐treated H 2O: water treated with 0.1% DEPC
  • 100 mM phosphocreatine (ICN Biomedicals)
  • 10 mCi/ml [α‐32P]UTP (650 Ci/mmol; e.g., ICN Biomedicals)
  • Glycerol
  • 50 µg/µl yeast tRNA
  • 10 U/µl RNase‐free DNase I
  • DNase I buffer
  • 2× proteinase K buffer (see recipe)
  • 20 mg/ml proteinase K
  • Rapid RNA Isolation Kit (Amresco), or equivalent
  • 70% (v/v) ethanol
  • Scintillation fluid
  • Hybridization buffer (e.g., QuikHyb, Stratagene)
  • 2× SSC/0.1% (v/v) SDS
  • 0.1× SSC/0.1% (v/v) SDS, 50°C
  • Biodyne nylon membrane (Life Technologies)
  • Filtration manifold system (e.g., Life Technologies) connected to vacuum pump
  • UV cross‐linker (e.g., Stratalinker 1800, Stratagene)
  • Blotting paper
  • 5‐ml sterile polypropylene centrifuge tube
  • 30°C and 42°C water baths
  • Spin column (e.g., Pharmacia)
  • 20‐ml glass scintillation vials and scintillation counter
  • Hybridization oven (e.g., Hybaid), 60°C
  • X‐ray film (e.g., Kodak X‐Omat film, Eastman Kodak) or InstantImager (Packard Instruments)
  • Additional reagents and equipment for restriction enzyme digestion ( appendix 3A)

Basic Protocol 3: Immunoblot Analysis of γ‐Glutamylcysteine Synthetase Protein Content

  Materials
  • Cells to be analyzed
  • PBS ( appendix 2A), ice cold
  • Cell extraction buffer (see recipe)
  • 4× immunoblot sample loading buffer (see recipe)
  • 10% Tris/glycine gel (e.g., Pre‐cast Tris‐glycine mini gel, Novex/Invitrogen)
  • SDS electrophoresis buffer (e.g., Tris‐glycine SDS gel running buffer, Novex/Invitrogen or appendix 2A)
  • Protein molecular weight markers
  • Immunoblot transfer buffer (see recipe)
  • Methanol
  • Blocking solution (see recipe)
  • Anti‐γ‐glutamylcysteine‐synthetase‐heavy‐subunit (anti‐GCS‐HS) or ‐light‐subunit (anti‐GCS‐LS) polyclonal antibodies
  • T‐TBS: 0.05% (v/v) Tween 20 in TBS (see recipe)
  • Alkaline phosphatase (AP)–conjugated goat anti–rabbit IgG (e.g., Kirkegaard & Perry Laboratories)
  • Enzymatic chemiluminescence detection kit (e.g., ECL Plus, Amersham Pharmacia Biotech)
  • Sonicator
  • 95°C water bath
  • Vertical gel electrophoresis apparatus (e.g., Novex/Invitrogen)
  • Polyvinylidene difluoride (PVDF) membrane (0.45‐µm; e.g., Immobilon‐P PVDF membrane, Millipore)
  • Capillary transfer apparatus (e.g., Mini Trans‐Blot Cell, Bio‐Rad)
  • X‐ray film (e.g., Hyperfilm ECL, Amersham Pharmacia Biotech)
  • Additional reagents and equipment for determining protein concentration ( appendix 3A)

Support Protocol 3: γ‐Glutamyl Transpeptidase Activity Assay

  Materials
  • Cells to be analyzed
  • Oxidant
  • PBS ( appendix 2A)
  • Acivicin (Sigma‐Aldrich)
  • 0.2 M 2‐amino‐2‐methyl‐1‐3‐propandiol (ammediol)/HCl buffer, pH 8.6
  • 0.2 M glycylglycine
  • 10 mM L‐γ‐glutamyl‐7‐amino‐4‐methyl‐coumarin (γ‐glutamyl‐AMC) in methoxyethanol (e.g., Sigma‐Aldrich)
  • Triton X‐100
  • 0.05 M glycine, cold
  • 10 mM AMC in methoxyethanol (e.g., Sigma‐Aldrich)
  • Sonicator
  • Fluorescence spectrophotometer (excitation 370 nm, emission 440 nm)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Brown, T. and Mackey, K. 1997. Analysis of DNA by northern and slot‐blot hybridization. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl eds.) pp. 4.9.1‐4.9.16. John Wiley & Sons, New York.
   Cai, J., Huang, Z.Z., and Lu, S.C. 1997. Differential regulation of gamma‐glutamylcysteine synthetase heavy and light subunit gene expression. Biochem. J. 326:167‐172.
   Deneke, S.M. and Fanburg, B.L. 1989. Regulation of cellular glutathione. Am. J. Physiol. 257:L163‐L173.
   Galloway, D.C., Blake, D.G., Shepherd, A.G., and McLellan, L.I. 1997. Regulation of human gamma‐glutamylcysteine synthetase: Co‐ordinate induction of the catalytic and regulatory subunits in HepG2 cells. Biochem. J. 328:99‐104.
   Gipp, J.J., Bailey, H.H., and Mulcahy, R.T. 1995. Cloning and sequencing of the cDNA for the light subunit of human liver gamma‐glutamylcysteine synthetase and relative mRNA levels for heavy and light subunits in human normal tissues. Biochem. Biophys. Res. Commun. 206:584‐589.
   Huang, C.‐S., Anderson, M.E., and Meister, A. 1993. Amino acid sequence and function of the light subunit of rat kidney γ‐glutamyl cysteine synthetase. J. Biol. Chem. 268:20578‐20583.
   Iwanga, M., Mori, K., Iida, T., Urata, Y., Matsuo, T., Yasunaga, A., Shibata, S., and Kondo, T. 1998. Nuclear factor kappa B dependent induction of gamma glutamylcysteine synthetase by ionizing radiation in T98G human glioblastoma cells. Free Radic. Biol. Med 24:1256‐1268.
   Joyce‐Brady, M., Oakes, S.M., Wuthrich, D., and Laperche, Y. 1996. Three alternative promoters of the rat γ‐glutamyl transferase gene are active in developing lung and are differentially regulated by oxygen after birth. J. Clin. Invest 97:1774‐1779.
   Kugelman, A., Choy, H.A., Liu, R., Shi, M.M., Gozal, E., and Forman, H.J. 1994. γ‐Glutamyl transpeptidase is increased by oxidative stress in rat alveolar L2 epithelial cells. Am. J. Respir. Cell Mol. Biol. 11:586‐592.
   Liu, R.M., Hu, H., Robison, T.W., and Forman, H.J. 1996. Increased gamma‐glutamylcysteine synthetase and gamma‐glutamyl transpeptidase activities enhance resistance of rat lung epithelial L2 cells to quinone toxicity. Am. J. Respir. Cell Mol. Biol. 14:192‐197.
   Liu, R.M., Gao, L., Choi, J., and Forman, H.J. 1998a. Gamma‐glutamylcysteine synthetase: mRNA stabilization and independent subunit transcription by 4‐hydroxy‐2‐nonenal. Am. J. Physiol. 275:L861‐L869.
   Liu, R.M., Shi, M.M., Giulivi, C., and Forman, H.J. 1998b. Quinones increase gamma‐glutamyl transpeptidase expression by multiple mechanisms in rat lung epithelial cells. Am. J. Physiol. 274:L330‐L336.
   Luo, T.P., Hammarqvist, F., Andersson, K., and Wernerman, J. 1998. Surgical trauma decreases glutathione synthetic capacity in human skeletal muscle tissue. Am. J. Physiol. 275:E359‐E365.
   Meister, A. 1994. Glutathione, ascorbate, and cellular protection. Cancer Res. 54:1969s‐1975s.
   Meyer, L.J., Milburn, S.C., and Hershey, J.W.B. 1982. Immunochemical characterization of mammalian protein synthesis initiation factors. Biochemistry 21:4206‐4212.
   Meyer, L.J., Taylor, T.B., Kadunce, D.P., and Zone, J.J. 1990. Two groups of bullous pemphigoid antigens are identified by affinity‐purified antibodies. J. Invest. Dermatol. 94:611‐616.
   Moinova, H.R. and Mulcahy, R.T. 1998. An electrophile responsive element (EpRE) regulates beta‐naphthoflavone induction of the human gamma‐glutamylcysteine synthetase regulatory subunit gene. Constitutive expression is mediated by an adjacent AP‐1 site. J. Biol. Chem. 273:14683‐14689.
   Morales, A., Garcia‐Ruiz, C., Miranda, M., Mari, M., Colell, A., Ardite, E., and Fernandez‐Checa, J.C. 1997. Tumor necrosis factor increases hepatocellular glutathione by transcriptional regulation of the heavy subunit chain of gamma‐glutamylcysteine synthetase. J. Biol. Chem. 272:30371‐30379.
   Mulcahy, R.T., Bailey, H.H., and Gipp, J.J. 1995. Transfection of complementary DNAs for the heavy and light subunits of human gamma‐glutamylcysteine synthetase results in an elevation of intracellular glutathione and resistance to melphalan [published erratum appears in Cancer Res. 1996;56(1):225] 55:4771‐4775.
   Mulcahy, R.T., Wartman, M.A., Bailey, H.H., and Gipp, J.J. 1997. Constitutive and beta‐naphthoflavone‐induced expression of the human gamma‐glutamylcysteine synthetase heavy subunit gene is regulated by a distal antioxidant response element/TRE sequence. J. Biol. Chem. 272:7445‐7454.
   Ochi, T. 1993. Mechanism for the changes in levels of glutathione upon exposure of cultured mammalian cells to tertiary‐butylhydroperoxide and diamide. Arch. Toxicol. 67:401‐410.
   Rahman, I., Bel, A., Mulier, B., Lawson, M.F., Harrison, D.J., MacNee, W., and Smith, C.A. 1996a. Transcriptional regulation of gamma‐glutamylcysteine synthetase‐heavy subunit by oxidants in human alveolar epithelial cells. Biochem. Biophys. Res. Commun. 229:832‐837.
   Rahman, I., Smith, C.A., Lawson, M.F., Harrison, D.J., and MacNee, W. 1996b. Induction of gamma‐glutamylcysteine synthetase by cigarette smoke is associated with AP‐1 in human alveolar epithelial cells [published erratum appears in FEBS Lett. 1997;411(2‐3):393] FEBS Lett. 396:21‐25.
   Richman, P.G. and Meister, A. 1975. Regulation of γ‐glutamyl‐cysteine synthetase by nonallosteric feedback inhibition by glutathione. J. Biol. Chem. 250:1422‐1426.
   Rusakow, L.S., White, C.W., and Stabler, S.P. 1993. O2‐induced changes in lung and storage pool thiols in mice: Effect of superoxide dismutase. J. Appl. Physiol. 74:989‐997.
   Sekhar, K.R., Long, M., Long, J., Xu, Z.Q., Summar, M.L., and Freeman, M.L. 1997a. Alteration of transcriptional and post‐transcriptional expression of gamma‐glutamylcysteine synthetase by diethyl maleate. Radiat. Res. 147:592‐597.
   Sekhar, K.R., Meredith, M.J., Kerr, L.D., Soltaninassab, S.R., Spitz, D.R., Xu, Z.Q., and Freeman, M.L. 1997b. Expression of glutathione and gamma‐glutamylcysteine synthetase mRNA is Jun dependent. Biochem. Biophys. Res. Commun. 234:588‐593.
   Shi, M.M., Iwamoto, T., and Forman, H.J. 1994. Gamma‐glutamylcysteine synthetase and GSH increase in quinone‐induced oxidative stress in BPAEC. Am. J. Physiol. 267:L414‐L421.
   Smith, G.D., Ding, J.L., and Peters, T.J. 1979. A sensitive fluorometric assay for γ‐glutamyl transferase. Anal. Biochem. 100:136‐139.
   Sun, Y. 1997. Induction of glutathione synthetase by 1,10‐phenanthroline. FEBS Lett 408:16‐20.
   Sun, W.M., Huang, Z.Z., and Lu, S.C. 1996. Regulation of gamma‐glutamylcysteine synthetase by protein phosphorylation. Biochem. J. 320:321‐328.
   Suzuki, H., Hashimoto, W., and Kumagai, H. 1993. Escherichia coli k‐12 can utilize an exogenous γ‐glutamyl peptide as an amino acid source, for which γ‐glutamyltranspeptidase is essential. J. Bacteriol. 175:6038‐6040.
   Takahashi, Y., Oakes, S.M., Williams, M.C., Takahashi, S., Miura, T., and Joyce‐Brady, M. 1997. Nitrogen dioxide exposure activates γ‐glutamyl transferase gene expression in rat lung. Toxicol. Appl. Pharmacol. 143:388‐396.
   Tian, L., Shi, M.M., and Forman, H.J. 1997. Increased transcription of the regulatory subunit of gamma‐ glutamylcysteine synthetase in rat lung epithelial L2 cells exposed to oxidative stress or glutathione depletion. Arch. Biochem. Biophys 342:126‐133.
   Tomonari, A., Nishio, K., Kurokawa, H., Arioka, H., Ishida, T., Fukumoto, H., Fukuoka, K., Nomoto, T., Iwamoto, Y., Heike, Y., Itakura, M., and Saijo, N. 1997a. Identification of cis‐acting DNA elements of the human γ‐glutamylcysteine synthetase heavy subunit gene. Biochem. Biophys. Res. Commun. 232:522‐527.
   Tomonari, A., Nishio, K., Kurokawa, H., Fukumoto, H., Fukuoka, K., Iwamoto, Y., Usuda, J., Suzuki, T., Itakura, M., and Saijo, N. 1997b1997b. Proximal 5′‐flanking sequence of the human gamma‐glutamylcysteine synthetase heavy subunit gene is involved in cisplatin‐induced transcriptional up‐regulation in a lung cancer cell line SBC‐3. Biochem. Biophys. Res. Commun. 236:616‐621.
   Urata, Y., Yamamoto, H., Goto, S., Tsushima, H., Akazawa, S., Yamashita, S., Nagataki, S., and Kondo, T. 1996. Long exposure to high glucose concentration impairs the responsive expression of γ‐glutamylcysteine synthetase by interleukin‐1beta and tumor necrosis factor‐alpha in mouse endothelial cells. J. Biol. Chem. 271:15146‐15152.
   Wallig, M.A., Kore, A.M., Cshaw, J., and Jeffery, E.H. 1992. Separation of the toxic and glutathione‐enhancing effects of the naturally occurring nitrile,cyanohydroxybutene. Fundam. Appl. Toxicol. 19:598‐606.
   Yao, K.S., Godwin, A.K., Johnson, S.W., Ozols, R.F., O'Dwyer, P.J., and Hamilton, T.C. 1995. Evidence for altered regulation of gamma‐glutamylcysteine synthetase gene expression among cisplatin‐sensitive and cisplatin‐resistant human ovarian cancer cell lines. Cancer Res. 55:4367‐4374.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library