Histochemical Analysis of Heme Degradation Enzymes

James F. Ewing1

1 ArQule, Inc., Waltham, Massachusetts
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 9.5
DOI:  10.1002/0471140856.tx0905s02
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Histochemical analysis can be used to study the cellular localization, expression, and regulation of enzymes responsible for catabolism of the heme molecule. This unit describes protocols for assessing the expression and regulation of specific HO‐1 and HO‐2 mRNAs by in situ hybridization using digoxigenin‐tagged probes. Immunohistochemistry is used to visualize specific cellular sites of HO‐1 and HO‐2 protein expression.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Detection of Heme Oxygenase 1 and 2 Transcripts by ISH
  • Basic Protocol 2: Immunohistochemical Analysis of Heme Degradation System in Free‐Floating Sections
  • Alternate Protocol 1: Immunofluorescence Localization of Heme Degradation System Using Free‐Floating Frozen Sections
  • Alternate Protocol 2: Immunohistochemical Localization of Heme Degradation System Using Paraffin‐Embedded Tissue
  • Alternate Protocol 3: Immunofluorescence Localization of Heme Degradation System for Paraffin‐Embedded Sections
  • Support Protocol 1: Preparation of Tissue for ISH and IHC
  • Support Protocol 2: Preparation of Preadsorbed Serum Control
  • Reagents and Solutions
  • Commentary
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Detection of Heme Oxygenase 1 and 2 Transcripts by ISH

  Materials
  • 10× PCR buffer (see recipe)
  • 2 mM dNTP mix (2 mM each of dATP, dGTP, dCTP, and dTTP)
  • 100 mM stocks of HO‐1 or HO‐2 sense and antisense primers (Midland Certified Reagent Co.):
    • HO‐1 primers: 5′‐TGCACATCCGTGCAGAGAAT‐3′ (+71 to +90) and 5′‐AGGAAACTGAGTGTGAGGAC‐3′ (+814 to +833)
    • HO‐2 primers: 5′‐GAAGTGAGGGCAGCACAAAC‐3′ (−32 to −13) and 5′‐CTTCTTCAGCACCTGGCCT‐3′ (+486 to +504)
  • 5 U/µl Taq DNA polymerase (U.S. Biochemical)
  • 10 to 20 µl/ml template plasmid DNA
  • Mineral oil
  • Chloroform
  • 1% (w/v) agarose gel (see recipe)
  • 1× TAE buffer (see recipe) containing 0.5 µg/ml ethidium bromide (added from 5 mg/ml ethidium bromide stock; see recipe)
  • 3 M sodium acetate, pH 5.2 ( appendix 2A)
  • 70% and 100% ethanol
  • TE buffer, pH 8 (see recipe)
  • GeneClean kit (Bio 101)
  • Digoxigen‐dNTP labeling mix (see recipe)
  • Slides containing paraffin‐embedded tissue sections of interest (see Support Protocol 3)
  • Xylene
  • Graded ethanol series: 50%, 60%, 70%, 80%, 90%, and 100% (v/v) ethanol
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 0.2 N HCl
  • 2×, 1×, 0.5×, 0.25×, and 0.05× SSC (see recipe for 20×)
  • 10 µg/ml proteinase K working solution (see recipe; preincubate 45 min at 37°C before use)
  • 4% (w/v) paraformaldehyde
  • Prehybridization buffer (see recipe)
  • Buffer I (see recipe)
  • Blocking solution (see recipe)
  • Anti‐digoxigenin antibody‐alkaline phosphatase conjugate (Fab fragments; Boehringer Mannheim)
  • Buffer II (see recipe)
  • Developer solution (see recipe)
  • Aqueous mounting medium
  • Programmable thermal cycler
  • Coplin jars
  • Humidified chambers: large plastic culture dishes lined with RNase‐free H 2O‐saturated Whatman filter paper
  • Glass coverslips
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.2 & appendix 3A)

Basic Protocol 2: Immunohistochemical Analysis of Heme Degradation System in Free‐Floating Sections

  Materials
  • Frozen tissue sections ( protocol 6)
  • 0.1 M sodium phosphate buffer, pH 7.3 ( appendix 2A)
  • PBTX: 0.3% (v/v) Triton X‐100 in 0.1 M sodium phosphate buffer, pH 7.3 (store up to 1 month at 4°C)
  • Antibody buffer: PBTX (see above) containing 10% (v/v) normal goat serum (NGS)—filter through 0.45‐µm filter fitted to a syringe; prepare fresh
  • Primary antibody: HO‐1, HO‐2, or BVR antibody (StressGen)
  • Secondary antibody: goat anti‐rabbit γ‐globulin (Organon Teknika Cappel)
  • Tertiary antibody: peroxidase‐anti‐peroxidase antibody (Organon Teknika Cappel)
  • 0.05 M Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 0.5% (w/v) 3,3‐diaminobenzidine tetrahydrochloride dihydrate (DAB) in 0.05 M Tris⋅Cl, pH 7.5 (prepare fresh; filter through Whatman filter paper)
  • 3% (v/v) hydrogen peroxide (prepare fresh from 30% hydrogen peroxide)
  • Graded ethanol series: 50%, 60%, 70%, 80%, 95%, and 100% (v/v) ethanol
  • Xylene
  • Cytoseal 60 mounting medium
  • Small paint brushes
  • Netted compartments (Brain Research)
  • Tabletop shaker
  • 60 × 15–mm tissue culture dishes (Falcon)
  • Superfrost Plus slides (Fisher)
  • Slide warmer
  • Glass coverslips
  • Large crystallization dishes

Alternate Protocol 1: Immunofluorescence Localization of Heme Degradation System Using Free‐Floating Frozen Sections

  • Secondary antibody: fluorescein (FITC)‐conjugated goat anti‐rabbit γ‐globulin (Organon Teknika Cappel)
  • 70% (v/v) glycerol
  • Fluorescence microscope

Alternate Protocol 2: Immunohistochemical Localization of Heme Degradation System Using Paraffin‐Embedded Tissue

  • Paraffin‐embedded sections on slides ( protocol 6)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • Endogenous peroxidase inhibitor (see recipe)
  • PBS containing 0.3% (v/v) Triton X‐100
  • PBS containing 0.3% (v/v) Triton X‐100 and 10% (v/v) normal goat serum (NGS)
  • HO‐1, HO‐2, or BVR antibody (StressGen)
  • Zymed histological staining kit containing biotinylated goat anti‐rabbit antiserum (secondary antibody) peroxidase‐streptavidin conjugate, and development solution (Zymed)
  • Humidified chambers: large plastic culture dishes lined with H 2O‐saturated Whatman filter paper
  • Glass coverslips

Alternate Protocol 3: Immunofluorescence Localization of Heme Degradation System for Paraffin‐Embedded Sections

  • Secondary antibody: fluorescein isothiocyanate (FITC)–conjugated goat anti‐rabbit γ‐globulin (Organon Teknika Cappel)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • 70% (v/v) glycerol
  • Humidified chambers: large plastic culture dishes lined with H 2O‐saturated Whatman filter paper
  • Glass coverslips
  • Fluorescence microscope

Support Protocol 1: Preparation of Tissue for ISH and IHC

  Materials
  • Adult or neonatal rat
  • Sodium pentobarbital
  • 0.9% (w/v) NaCl
  • Perfusion fixative (see recipe)
  • Graded sucrose solutions: 0.1 M sodium phosphate buffer ( appendix 2A) containing 10%, 20%, and 30% (w/v) sucrose (store up to 1 week at 4°C)
  • Cryoprotectant (see recipe)
  • Dissecting instruments
  • Intravenous catheter (18‐G for adult rat; 22‐G for 14‐ to 28‐day neonate; Becton Dickinson) or 30‐ml syringe with 25‐G needle (for 7‐day neonate)
  • Superfrost Plus slides (Fisher)
  • Perfusion apparatus including peristaltic pump
  • Microtomes (Reichert‐Jung)
  • Compartmentalized boxes

Support Protocol 2: Preparation of Preadsorbed Serum Control

  Materials
  • Primary antibody (see appropriate protocol)
  • Purified HO‐1, HO‐2, or BVR protein (StressGen)
  • Antibody buffer (see protocol 2)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ewing, J.F. 1996. Methods for detection of heme oxygenase‐1 and 2 transcripts: Northern blot and in situ hybridization. In Nitric Oxide Synthase Characterization and Functional Analysis, (M.D. Maines, Ed.), pp.112‐115. Academic Press, San Diego.
   Ewing, J.F. and Maines, M.D. 1991. Rapid induction of heme oxygenase ‐1 mRNA and protein by hyperthermia in rat brain: Heme oxygenase‐2 is not a heat shock protein. Proc. Natl. Acad. Sci. U.S.A. 88:5364‐5368.
   Ewing, J.F. and Maines, M.D. 1992. In situ hybridization and immunohistochemical localization of heme oxygenase ‐2 mRNA and protein in normal rat brain: Differential distribution of isozyme 1 and 2. Mol. Cell. Neurosci. 3:4559‐4570.
   Ewing, J.F. and Maines, M.D. 1995. Distribution of constitutive (HO‐2) and heat‐inducible (HO‐1) heme oxygenase isozymes in testes: HO‐2 displays stage‐specific expression in germ cells. Endocrinology 136:2294‐2302.
   Ewing, J.F., Weber, C.M., and Maines, M.D. 1993. Biliverdin reductase is heat resistant and coexpressed with constitutive and heat shock form of heme oxygenase in brain. J. Neurochem. 61:1015‐1023.
   Ewing, J.F., Raju, V.S., and Maines, M.D. 1994. Induction of heart heme oxygenase‐1 (HSP32) by hyperthermia: Possible role in stress‐mediated elevation of cyclic 3′:5′‐guanosine monophosphate. J. Pharmacol. Exp. Ther. 271:408‐414.
   Iwamura, M., Wu, G., Abrahamsson, P., Di Sant'Agnese, P.A., Cockett, A.T.K., and Deftos, L.J. 1994. Parathyroid hormone–related protein is expressed by prostatic neuroendocrine cells. J. Urol. 43:667‐674.
   Keyse, S.M. and Tyrrell, A.M. 1989. Heme oxygenase is the major 32‐kDa stress protein induced in human skin fibroblasts of UVA radiation, hydrogen peroxide and sodium arsenite. Proc. Natl Acad. Sci. U.S.A. 86:99‐103.
   Maines, M.D. 1992. Heme Oxygenase:Clinical Applications and Functions. CRC Press, Boca Raton, Fla.
   Maines, M.D. 1997. The heme oxygenase system:A regulator of second messenger gases. Annu. Rev. Pharmacol. Toxicol. 37:317‐354.
   Maines, M.D. and Ewing, J.F. 1996. Stress response of the rat testis:In situ hybridization and immunohistochemical analysis of heme oxygenase‐1 (HSP32) induction by hyperthermia. Biol. Reprod. 54:1070‐1079.
   Maines, M.D., Eke, B.C., and Zhao, X. 1996. Corticosterone promotes increased heme oxygenase‐2 protein and transcript expression in the newborn rat brain. Brain Res. 722:83‐94.
   McCoubrey, W.K., Jr., Huang, T.J., and Maines, M.D. 1997. Isolation and characterization of a cDNA from the rat brain that encodes hemoprotein heme oxygenase‐3. Eur. J. Biochem. 247:725‐732.
   Raju, V.S., McCoubrey, W.K., Jr., and Maines, M.D. 1997. Regulation of heme oxygenase‐2 by glucocorticoids in neonatal rat brain: Characterization of a functional glucocorticoid response element. Biochim. Biophys. Acta. 1351:89‐104.
   Rotenberg, M.O. and Maines, M.D. 1990. Isolation, characterization, and expression in Escherichia coli of a cDNA encoding rat heme oxygenase‐2. J. Biol. Chem. 265:7501‐7506.
   Shibahara, S., Müller, R., Taguchi, H., and Yoshida, T. 1985. Cloning and expression of cDNA for rat heme oxygenase. Proc. Natl. Acad. Sci. U.S.A. 82:7865‐7869.
   Stocker, P., Yamamoto, Y., McDonaugh, A.F., Glazer, A.N., and Ames, B.N. 1987. Bilirubin is an antioxidant of possible physiological importance. Science 235:1043‐1047.
   Tappel, A.L. 1961. Biocatalysts: Lipoxidase and hematin compounds. In Autooxidation and Antioxidants, vol. 1 (W.O. Lundberg, ed.). pp 325‐366. John Wiley & Sons, New York.
   Trakshel, G.M., Kutty, R.K., and Maines, M.D. 1986. Purification and characterization of the major constitutive form of testicular heme oxygenase: The non‐inducible isoform. J. Biol. Chem. 261:11131‐11137.
   Verma, A., Hirsch, D.J., Glatt, C.E., Ronnett, G.V., and Snyder, S.H. 1993. Carbon monoxide: A putative neural messenger. Science 259:381‐384.
   Weiss, G., Werner‐Felmayer, G., Werner, E.R., Grunewald, K., Wachter, H. and Hentze, M.W. 1994. Iron regulates nitric oxide synthase activity by controlling nuclear transcription. J. Exp. Med. 180:969‐976.
Key References
   Ewing and Maines, 1991. See above.
  The first reported immunohistochemical localization of heme degradation system.
   Ewing et al., 1993. See above.
  First full comparison of pattern of expression of HO‐1,HO‐2, and BVR protein.
   Maines, 1997. See above.
  Eloquent review on the current status of the heme oxygenase field.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library