Determining the Ability of Xenobiotic Metals to Bind a Specific Protein Domain by Electrophoresis

N.H. Zawia1, Md. Riyaz Basha1, M. Razmiafshari1

1 University of Rhode Island, Kingston, Rhode Island
Publication Name:  Current Protocols in Toxicology
Unit Number:  Unit 12.11
DOI:  10.1002/0471140856.tx1211s18
Online Posting Date:  February, 2004
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Environmental metals are potentially toxic and can interfere with the metal‐binding motifs of various critical proteins. This unit describes an electrophoretic method that can be used to measure the ability of a xenobiotic metal to bind a zinc‐finger motif. Information gained using this protocol can lead to the identification of protein targets of metals and shed better light on their mechanisms of action.

Keywords: metal binding; zinc‐finger peptide; mobility shift

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • 1.75 pmol/µl Sp1 consensus oligonucleotide (annealed before use):
    • 5′‐ATTCGATCGGGGCGGGGCGAGC‐3′
    • 3′‐TAAGCTAGCCCCGCCCCGCTCG‐5′
  • 3000 Ci/mmol [γ‐32P]ATP
  • 10× kinase buffer (see recipe)
  • 10 U/µl T4 polynucleotide kinase
  • TE buffer ( appendix 2A)
  • Synthetic zinc‐finger apopeptide stock solution (see recipe)
  • Divalent metal solutions (see recipe)
  • Gel‐shift binding buffer (see recipe)
  • Gel loading buffer (Sigma)
  • Sephadex G‐25 spin column (Sigma)
  • Additional reagents and equipment for preparing and running polyacrylamide gels ( appendix 3F) and autoradiography ( appendix 3D)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Dynan, W. and Tijian, R. 1983. The promoter‐specific transcription factor Sp1 binds to upstream sequences in the SV40 promoter. Cell 35:70‐87.
   Lee, M.S., Gottesfeld, J.M., and Wright, P.E. 1991. Zinc is required for folding and binding of a single zinc finger to DNA. FEBS Lett. 279:289‐294.
   Krizek, B.A., Amann, B.T., Kilfoil, V.J., Merkle, D.L., and Berg, J.M. 1991. A consensus zinc finger peptide: Design, high‐affinity metal binding, a pH‐dependent structure, and a His to Cys sequence variant. J. Am. Chem. Soc. 113:4518‐4523.
   Nekludova, L. and Pabo, C.O. 1994. Distinctive DNA conformation with enlarged major groove is found in Zn‐finger‐DNA and other protein‐DNA complexes. Proc. Natl. Acad. Sci. U.S.A. 91:6948‐6952.
   Pavletich, N.P. and Pabo, C.O. 1991. Zinc finger‐DNA recognition: Crystal structure of a Zif268‐DNA complex at 2.1 Å. Science 252:809‐816.
   Razmiafshari, M. and Zawia, N.H. 2000. Utilization of a synthetic peptide as a tool to study the interaction of heavy metals with the zinc finger domain of proteins critical for gene expression in the developing brain. Toxicol. Appl. Pharmacol. 166:1‐12.
   Razmiafshari, M. and Zawia, N.H. 2001. Nuclear magnetic resonance (NMR) analysis of the interaction of exogenous divalent metals with zinc finger motifs in the synthetic zinc finger model. Toxicol. Appl. Pharmacol. 172:1‐10.
   Shi, Y., and Berg, J.M. 1996. DNA unwinding induced by zinc finger protein binding. Biochemistry 35:3845‐3848.
   Zawia, N.H., Sharan, R., Brydie, M., Oyama, T., and Crumpton, T. 1998. Sp1 as a target site for Pb‐induced perturbations of transcriptional regulation of developmental brain gene expression. Devel. Brain Res. 107:291‐298.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library