User Ratings

Your rating: None
Your rating: None
Your rating: None
Add your comments

Molecular Analysis of Fragile X Syndrome

Monica J. Basehore1,  Michael J. Friez1

1Greenwood Genetic Center, Greenwood, South Carolina

Unit Number: 
Unit 9.5
DOI: 
10.1002/0471142905.hg0905s63
Online Posting Date: 
October, 2009
GO TO THE FULL TEXT:
PDF or HTML at Wiley Online Library
Are you the author of this protocol? Login or register and return to this page.

Abstract

The gene responsible for Fragile X syndrome, fragile X mental retardation-1 (FMR1), contains an unstable sequence of CGG trinucleotide repeats in its promoter region. Expansions of >200 trinucleotide repeats are considered full mutations and typically lead to abnormal methylation of the region resulting in loss of FMR1 expression. Males with loss of FMR1 protein are expected to be affected by Fragile X syndrome while females may or may not clinically manifest features of the condition. The protocols in this unit outline the complementary use of polymerase chain reaction (PCR) and methylation-sensitive Southern blot hybridization to accurately measure trinucleotide repeat size and methylation status. These protocols are also used to evaluate CGG repeat size in two adult-onset conditions known for their association with FMR1 premutation alleles, Fragile X Tremor/Ataxia (FXTAS) syndrome and Premature Ovarian Failure (POF). Curr. Protoc. Hum. Genet. 63:9.5.1-9.5.16. © 2009 by John Wiley & Sons, Inc.

Keywords: Fragile X; molecular; diagnostic; clinical; testing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: FMR1 Trinucleotide Fluorescent PCR Amplification Using Capillary Gel Electrophoresis
  • Basic Protocol 2: FMR1 Trinucleotide PCR Amplification Using Polyacrylamide Gel Electrophoresis
  • Basic Protocol 3: Detection of FMR1 CGG Repeat Amplification and Methylation Status by Southern Blot Hybridization
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: FMR1 Trinucleotide Fluorescent PCR Amplification Using Capillary Gel Electrophoresis

 Materials
  • No-template control (NTC)
  • Positive control with a known CGG repeat length
  • 6 M Betaine (Sigma)
  • 10× PCR Gold Buffer (Applied Biosystems)
  • 25 mM MgCl2 (Applied Biosystems)
  • Deoxynucleotides (dNTPs; 3 mM each dATP and dTTP, 0.75 mM each dCTP and dGTP)
  • 7-deaza-2¢-deoxyguanosine 5¢-triphosphate (5 mM)
  • Forward primer: (100 ng/µl) 5¢GACGGAGGCGCCGCTGCCAGG
  • Reverse primer: (100 ng/µl) 5¢GTGGGCTGCGGGCGCTCGAGG (FAM-labeled)
  • DMSO (Sigma)
  • 5 U/µl AmpliTaq Gold DNA polymerase (Applied Biosystems)
  • Purified DNA sample (appendix 3B) in 10 mM Tris×Cl/pH 7.5 (appendix 2D)/1 mM EDTA
  • Hi-Di Formamide (Applied Biosystems)
  • LIZ fluorescent size standard (Applied Biosystems)
  • 1.5-ml sterile microcentrifuge tube
  • Sterile PCR tubes/plate
  • Thermal cycler
  • Applied Biosystems 3100/3130 or 3730 Genetic Analyzer or other appropriate capillary gel electrophoresis system

Basic Protocol 2: FMR1 Trinucleotide PCR Amplification Using Polyacrylamide Gel Electrophoresis

 Materials
  • 10× PCR amplification buffer: 100 mM Tris×Cl (pH 8.3)/500 mM KCl
  • 25 mM MgCl2
  • 10 mM dNTP mix of dATP, dCTP, dTTP and 7-deaza-2¢-deoxyguanosine-5¢-triphosphate (7-deaza-2¢-dGTP; Roche Diagnostics; also see appendix 2D)
  • 10 µM oligonucleotide primers 1 and 3 in 10 mM Tris×Cl/pH 7.5 (appendix 2D)/1 mM EDTA
    • Primer 1: 5¢-GACGGAGGCGCCGCTGCCAGG-3¢
    • Primer 3: 5¢-GTGGGCTGCGGGCGCTCGAGG-3¢
  • DMSO (Sigma)
  • 5 U/µl Taq DNA polymerase (Applied Biosystems)
  • 0.3 to 1 µg/ml purified sample DNA (appendix 3B) in 10 mM Tris×Cl/pH 7.5 (appendix 2D)/1 mM EDTA
  • 0.67× TBE buffer (appendix 2D)
  • Loading buffer (see recipe)
  • 32P-labeled DNA size markers: pBR322 digested with MspI
  • 0.4 N NaOH
  • Quick Light Hybridization Kit (Orchid Biosciences) containing:
    • Quick Light buffer concentrate
    • Wash I and II solutions
    • Hybridization solution
  • Quick Light Genome Mapping Probe Kit (Orchid Biosciences) containing:
    • Alkaline phosphatase–labeled (CGG)n oligonucleotide probe
    • Lumi-Phos spray
  • 0.2- and 1.5-ml microcentrifuge tubes
  • Thermal cycler
  • 100°C water baths
  • Vertical gel apparatus (e.g., BRL V15.17, Life Technologies)
  • Sequa Gel-6 (optional; National Diagnostics)
  • Positively charged nylon membrane (Biotrans+, ICN Biomedicals, precut to 12 × 16–cm)
  • Whatman 3 MM filter paper
  • Blotting paper (Owl Separation Systems), precut to 12 × 16–cm
  • Electroblot apparatus (Integrated Separation Systems)
  • Additional reagents and equipment for PCR (Kramer and Coen, 2001), denaturing PAGE (appendix 3F), electroblotting from a polyacrylamide gel to a nylon membrane (Brown, 1999), and chemiluminescent detection of nonisotopic probes (see unit 9.6 and Perry-O'Keefe and Kissinger, 1994)

Basic Protocol 3: Detection of FMR1 CGG Repeat Amplification and Methylation Status by Southern Blot Hybridization

 Materials
  • 0.5 to 1 µg/ml genomic DNA (appendix 3B)
  • 5× restriction buffer (see recipe)
  • 0.1 M DTT (Sigma)
  • 3 U/ml RNase A (Sigma)
  • 100 U/µl EcoRI (New England Biolabs)
  • 50 U/µl EagI (New England Biolabs)
  • 10× Ficoll loading buffer (see recipe)
  • 30 to 50 µCi/ml [-32P] StB12.3 probe (3000 mCi/mmol, Amersham; or unlabeled from Dr. J.L. Mandel, Institut de Chimie Biologique; mandeljl@igbmc.u-strasbg.fr)
  • 1× TAE buffer, pH 8.5 (appendix 2D)
  • Denaturing buffer (see recipe)
  • Transfer buffer (see recipe)
  • Neutralizing buffer (see recipe)
  • Hybridization buffer (see recipe)
  • 2× SSPE/0.1% (w/v) SDS (appendix 2D; prepare fresh)
  • 1× SSPE/0.1% (w/v) SDS (appendix 2D; prepare fresh)
  • 0.1× SSPE/1.0% (w/v) SDS, 60°C (appendix 2D; prepare fresh)
  • 20× SSPE (appendix 2D)
  • Whatman 3 MM filter paper
  • Nytran SuPercharge Turboblotter Rapid Downward Transfer System System (Schleicher & Schuell)
  • 60°C hybridization oven
  • 80°C oven
  • UV-transparent plastic wrap
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.7), Southern blotting with alkaline buffer (see unit 2.7 and Brown, 1999), and radiolabeling of DNA (appendix 3E)

CAUTION: 32P is hazardous; see appendix 2A for guidelines on handling, storage, and disposal.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  • Figure 9.5.1
    The fragile X region with normal, premutation, and full mutation CGG repeats. The CGG repeat region is represented by a jagged line. Restriction sites are indicated by solid arrows for EcoRI and a dashed arrow for methylation sensitive EagI. Full mutation alleles are typically methylated and are resistant to digestion at the EagI site.

  • Figure 9.5.2
    Restriction map of the fragile X region. Probes used in Southern analysis of the region are shown.

  • Figure 9.5.3
    Top: Fluorescent PCR (Basic Protocol 1) electropherogram traces for (A) a normal male with 31 repeats, (B) a normal female with 25 and 31 repeats, (C) a normal female with 30 and 31 repeats, and (D) a male with a premutation-sized allele of 75 repeats. (E) PCR analysis (Basic Protocol 2) of the FMR1 CGG repeat in the general population and in families with Fragile X. Lane 1: premutation male with 115 repeats. Lane 2: normal male with 29 repeats. Lane 3: normal male with 30 repeats. Lanes 4 to 6: family with Fragile X including premutation mother with 30 and 95 repeats (lane 4); full mutation female fetus with 31 and >200 repeats (lane 5); and normal father with 31 repeats (lane 6). Lanes 7 to 9: family with Fragile X: normal father with 30 repeats (lane 7); prenatal sample of normal female fetus with 27 and 30 repeats (lane 8); and premutation mother with 27 and 145 repeats (lane 9). Lane 10: normal male with 33 repeats. Lane 11: full mutation male with >200 repeats. Lane 12: negative control with no DNA. Lane 13: size standard (pBR322 digested with MspI) with corresponding CGG repeat numbers shown.

  • Figure 9.5.4
    Fragile X Southern analysis of genomic DNA digested with EcoRI and EagI, and hybridized with probe StB12.3. Lane 1: full mutation male with methylation mosaicism. Lane 2: premutation male. Lane 3: premutation female. Lane 4: full mutation male. Lane 5: full mutation female. Lane 6: Full mutation male. Lanes 7 to 9: normal females. Lane 10: full mutation male. DNA size markers are indicated on the right.

Literature Cited

Literature Cited
    Allingham-Hawkins, D.J., Babul-Hirji, R., Chitayat, D., Holden, J.J., Yang, K.T., Lee, C., Hudson, R., Gorwill, H., Nolin, S.L., Glicksman, A., Jenkins, E.C., Brown, W.T., Howard-Peebles, P.N., Becchi, C., Cummings, E., Fallon, L., Seitz, S., Black, S.H., Vianna-Morgante, A.M., Costa, S.S., Otto, P.A., Mingroni-Netto, R.C., Murray, A., Webb, J., MacSwinney, F., Dennis, N., Jacobs, P.A., Syrrou, M., Georgiou, I., Patsalis, P.C., Giovannucci Uzielli, M.L., Guarducci, S., Lapi, E., Cecconi, A., Ricci, U., Ricotti, G., Biondi, C., Scarselli, B., and Vieri, F. 1999. Fragile X premutation is a significant risk factor for premature ovarian failure: The International Collaborative POF in Fragile X study- preliminary data. Am. J. Med. Genet. 83:322-325.
    Brown, T. 1999. Southern blotting. Curr. Protoc. Mol. Biol. 68:2.9.1-2.9.20.
    Brown, W.T., Houck, G.E. Jr., Jeziorowska, A., Levinson, F.N., Ding, X., Dobkin, C., Zhong, N., Henderson, J., Brooks, S., and Jenkins, E.C. 1993. Rapid fragile X carrier screening and prenatal diagnosis using a nonradioactive PCR test. J. Am. Med. Assoc. 270:1569-1575.
    Crawford, D.C., Acuña, J.M., and Sherman, S.L. 2001. FMR1 and the fragile X syndrome: Human genome epidemiology review. Genet. Med. 3:359-371.
    Cummins, J.H. 1997. The unique alteration of electrophoretic mobility of fragile-X-expanded fragments in the presence of ethidium bromide. Elsevier Trends Journals Technical Tips Online T01054, May 14, 1997.
    Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Pieretti, M., Sutcliffe, J.S., Richards, R., Verkerk, A., Holden, J.J.A., Fenwick, R.G. Jr., Warren, S.T., Oostra, B.A., Nelson, D.L., and Caskey, C.T. 1991. Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell 67:1047-1058.
    Hagerman, R.J., Leehey, M., Heinrichs, W., Tassone, F., Wilson, R., Hills, J., Grigsby, J., Gage, B., and Hagerman, P.J. 2001. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology 57:127-130.
    Houdayer, C., Lourdaux, J., Billette de Villemeur, T., Royer-Legrain, G., Bahuau, M., Bonnefont, J.P., Feldman, D., and Courderc, R. 2002. Simple fluorescent PCR assay for discriminating FRAXA fully mutated females from normal homozygotes. Genet. Test. 6:135-139.
    Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1-15.1.14.
    Nolin, S.L., Lewis, F.A., Ye, L.L., Houck, G.E. Jr., Glicksman, A.E., Limprasert, P., Li, S.Y., Zhong, N., Ashley, A.E., Feingold, E., Sherman, S.L., and Brown, W.T. 1996. Familial transmission of the FMR1 CGG repeat. Am. J. Hum. Genet. 59:1252-1261.
    Nolin, S.L., Brown, W.T., Glicksman, A., Houck, G.E. Jr., Gargano, A.D., Sullivan, A., Biancalana, V., Brondum-Nielsen, K., Hjalgrim, H., Holinski-Feder, E., Kooy, F., Longshore, J., Macpherson, J., Mandel, J.L., von Koskull, H., and Sherman, S.L. 2003. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. Am. J. Hum. Genet. 72:454-464.
    Orrico, A., Galli, L., Plewnia, K., Dotti, M.T., Censini, S., and Federico, A. 1998. Mosaicism for full mutation and normal sized allele of the FMR1 gene: A new case report. Am. J. Med. Genet. 78:431-434.
    Pergolizzi, R.G., Erster, S.H., Goonewardena, P., and Brown, W.T. 1992. Detection of full fragile X mutations by polymerase chain reaction. Lancet 339:271-272.
    Perry-O'Keefe, H. and Kissinger, C.M. 1994. Chemiluminescent detection of nonisotopic probes. Curr. Protoc. Mol. Biol. 26:3.19.1-3.19.8.
    Rousseau, F., Heitz, D., Biancalana, V., Blumenfeld, S., Kretz, C., Bou, J., Tommerup, N., Van Der Hagen, C., DeLozier-Blanchet, C., Croquette, M.-F., Gilgenkrantz, S., Jalbert, P., Voelckel, M.-A., Oberl, I., and Mandel, J.-L. 1991. Direct diagnosis by DNA analysis of the fragile X syndrome of mental retardation. New Engl. J. Med. 325:1673-1681.
    Sherman, S., Pletcher, B.A., and Driscoll, D.A. 2005. Fragile X syndrome: Diagnostic and carrier testing. Genet. Med. 7:584-587.
    Spector, E.B. and Kronquist, K.E. 2005. ACMG standards and guidelines for clinical genetics laboratories, 2005. Available at: http://www.acmg.net.
    Verkerk, A.J.M.H., Pieretti, M., Sutcliffe, J.S., Fu, Y.H., Kuhl, D.P.A., Pizzuti, A., Reiner, O., Richards, S., Victoria, M.F., Zhang, F., Eussen, B.E., van Ommen, G.J.B., Blonden, L.A.J., Riggins, G.J., Chastain, J.L., Kunst, C.B., Galjaard, H., Caskey, C.T., Nelson, D.L., Oostra, B.A., and Warren, S.T. 1991. Identification of a gene (FMR1) containing a CGG repeat coincident with a breakpoint cluster region exhibiting length variation in fragile X syndrome. Cell 65:905-914.
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

genevieve (not verified)
Very good post. I figure out that one learns something new everyday. Informative website by the way. Keep up the good work. genevieve www.skilch.com
Nazli (not verified)

I looking for a PCR protocol for amplification and determination the repeat number of CGG.

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.