Genetics and Genomics > Clinical Molecular Genetics

User Ratings

Your rating: None
Your rating: None
Your rating: None
 Add your comments

Single‐Cell DNA and FISH Analysis for Application to Preimplantation Genetic Diagnosis

Samuel S. Chong1,  Robert E. Gore‐Langton1,  Mark R. Hughes1,  Stanislawa Weremowicz2

1Georgetown University Medical Center, Washington, D.C.
2Harvard Medical School and Brigham and Women's Hospital, Boston, Massachusetts


Publication Name: 
Current Protocols in Human Genetics
Unit Number: 
Unit 9.10
DOI: 
10.1002/0471142905.hg0910s64
Online Posting Date: 
January, 2010
GO TO THE FULL TEXT:
PDF or HTML at Wiley Online Library
Are you the author of this protocol? Login or register and return to this page.

Abstract

Preimplantation genetic testing, which includes preimplantation genetic diagnosis (PGD) and preimplantation genetic screening (PGS), is a form of a very early prenatal testing. The goal of this method is to avoid transfer of embryos affected with a specific genetic disease or condition. This unit describes the steps involved in amplifying DNA from a single blastomere and specific assays for detecting a variety of DNA mutations. For some assays, whole-genome amplification by primer-extension preamplification (PEP) is performed prior to analysis. Support protocols describe the biopsy of one or two blastomeres from the developing preimplantation embryo, isolation for further investigation of all blastomeres from embryos shown to have the mutant allele, and isolation of single lymphocytes or lymphoblastoid cells as models for single-cell DNA analysis. A procedure for FISH analysis on single interphase blastomeres is provided along with support protocols for probe preparation and probe validation, which is recommended as a preliminary step before performing any PGD or PGS FISH analysis. Curr. Protoc. Hum. Genet. 64:9.10.1-9.10.39. © 2010 by John Wiley & Sons, Inc.

Keywords: PGD; PGS; blastomere biopsy; mutation detection; FISH; probe validation

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Analysis of Specific Gene Loci in Single Diploid Cells
  • Support Protocol 1: Whole-Genome Amplification of Single Diploid Cells by Primer-Extension Preamplification (PEP)
  • Support Protocol 2: Preimplantation Embryo Biopsy
  • Support Protocol 3: Isolation of Blastomeres from Affected Embryos for Further Investigation
  • Support Protocol 4: Isolation of Single Lymphocytes/Lymphoblastoid Cells
  • Basic Protocol 2: FISH Analysis of Single Blastomeres
  • Support Protocol 5: Preparation of DNA Probes for FISH
  • Support Protocol 6: Probe Validation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Analysis of Specific Gene Loci in Single Diploid Cells

 Materials
  • Single cells or blastomeres in 0.5-ml tubes, lysed and neutralized with oil or wax overlay (see Support Protocols 2, 3, and 4) and corresponding control tubes
  • 10× potassium-free amplification buffer (unit 1.6)
  • 25 mM 4dNTP mix (Boehringer Mannheim; appendix 2D)
  • 20 µM forward and reverse primers (Table 9.10.1)
  • 5 U/µl Taq DNA polymerase (AmpliTaq from Perkin-Elmer)
  • 10× PCR amplification buffer containing 15 mM MgCl2 (appendix 2D)
  • Light mineral oil (Perkin-Elmer)
  • 20 µM forward and reverse inner (nested) primers for secondary PCR (Table 9.10.2)
  • DNA fragments from known homozygous CFTR F508 mutant genomic DNA or HEXA exon 11 +TATC mutant genomic DNA and from homozygous normal DNA, PCR-amplified using the inner primers for the appropriate locus (see Table 9.10.2)
  • 10× TBE buffer (appendix 2D)
  • DNA gel loading buffer (appendix 2D)
  • Size marker: X-174 plasmid digested with HaeIII
  • 0.1 µg/ml ethidium bromide (appendix 2D)
  • 5× DdeI digestion buffer (see recipe)
  • Restriction enzymes: DdeI, BclI, and HaeIII
  • 10× One-Phor-All Buffer Plus (Pharmacia Biotech)
  • 0.5-ml clarified polypropylene PCR reaction tubes (Out Patient Services)
  • Thermal cycler (PTC-100 or -200 from MJ Research; DNA Thermal Cycler or DNA Thermal Cycler 480 from Perkin-Elmer)
  • PAGE minigel casting and electrophoresis apparatus (MiniProtean II, Bio-Rad)
  • Additional reagents and equipment for primer-extension preamplification (PEP; Support Protocol 1 and unit 1.6; optional), heteroduplex analysis (unit 7.3), nondenaturing PAGE (unit 7.4), ethidium bromide staining (appendix 2D), and agarose gel electrophoresis (unit 2.7)
     
    Table 9.10.1 Primer Sequences and Concentrations for Primary PCR
    LocusPrimerSequence (5¢ to 3¢)aFinal concentrationb (µM)Volumeb for 10 reactions (µl)Product size (bp)
    CFTRF5081FGACTTCACTTCTAATGATGAT0.820193/190
    1RCTCTTCTAGTTGGCATGC0.820
    DMD exon 41FTTGTCGGTCTCCTGCTGGTCAGTG0.256.25196
    1RCAAAGCCCTCACTCAAACATGAAGC0.256.25
    DMD exon 81FGTCCTTTACACACTTTACCTGTTGAG0.256.25360
    1RGGCCTCATTCTCATGTTCTAATTAG0.256.25
    DMD exon 121FGATAGTGGGCTTTACTTACATCCTTC0.256.25331
    1RGAAAGCACGCAACATAAGATACACCT0.256.25
    DMD exon 451FAAACATGGAACATCCTTGTGGGGAC0.256.25547
    1RCATTCCTATTAGATCTGTCGCCCTAC0.256.25
    DMD exon 481FTTGAATACATTGGTTAAATCCCAACATG0.256.25506
    1RCCTGAATAAAGTCTTCCTTACCACAC0.256.25
    FVIII intron 18HA1FCTACCTGGCTTAGTAATGGCTC0.820429
    HA1RAAAGGAATAAATTCCTTTTCCC0.820
    HEXA exons 11 & 12TS-FGGTGTGGCGAGAGGATATTCCA0.820580/584
    TS-RTCTCTCAGGCCTGAAAGAAGGG0.820
    ZFX & ZFYZ868FACCRCTGTACTGACTGTGATTACAC0.410495
    Z1338RGCACYTCTTTGGTATCYGAGAAAGT0.410
     aR = A or G; Y = C or T.
     bAlso see Basic Protocol 1, steps 2a and 2b.
     
    Table 9.10.2 Primer Sequences for Secondary (Nested or Hemi-Nested) PCR
    LocusPrimerSequence (5¢ to 3¢)aFinal concentration (µM)bVolume for 10 reactions (µl)bProduct size (bp)
    CFTRF5082FTGGGAGAACTGGAGCCTT0.820154/151c
    2RGCTTTGATGACGCTTCTGTAT0.820
    DMD exon 41FTTGTCGGTCTCCTGCTGGTCAGTG0.256.25168
    2RCTGTGTCACAGCATCCAGACCTTGT0.256.25
    DMD exon 82FTCATGGACAATTCACTGTTCATTAA0.256.25321
    1RGGCCTCATTCTCATGTTCTAATTAG0.256.25
    DMD exon 121FGATAGTGGGCTTTACTTACATCCTTC0.256.25301
    2RTATGTTGTTGTACTTGGCGTTTTAG0.256.25
    DMD exon 452FGCTCTTGAAAAGGTTTCCAACTAAT0.256.25506
    1RCATTCCTATTAGATCTGTCGCCCTAC0.256.25
    DMD exon 481FTTGAATACATTGGTTAAATCCCAACATG0.256.25444
    2RAATGAGAAAATTCAGTGATATTGCC0.256.25
    FVIII intron 18HA2FATCAAAGGATTCGATGGTATCT0.820339
    HA2RTTTCCTTTTTAGCAATTTTTCT0.820
    HEXA exon 11TS11FAACTGGTCACCAAGGCCGGCTT0.820118/122d
    TS11RCCTTCAAATGCCAGGGGTTCCA0.820
    HEXA exon 12TS12FCAGGTACCCCTGAGCAGAAGGC0.820176
    TS12RGGTGGCTAGATGGGATTGGGTC0.820
    ZFX & ZFYZ916FAYAACCACCTGGAGAGCCACAAGCT0.410344
    Z1233RTGCAGACCTATATTCRCAGTACTGGCA0.410
     aR = A or G; Y = C or T.
     bAlso see Basic Protocol 1, step 5.
     cFragment with F508 deletion mutation is 3 bp shorter.
     dFragment with +TATC insertion mutation is 4 bp longer.

Support Protocol 2: Preimplantation Embryo Biopsy

 Materials
  • Calcium- and magnesium-free medium (EB-10, Vitrolife)
  • Acid Tyrodes solution (see recipe)
  • Embryo culture and wash medium (see recipe for culture and micromanipulation media)
  • Light paraffin oil for cultures (EM Science), filter sterilized, then washed and equilibrated with culture medium
  • Biopsy medium (see recipe for culture and micromanipulation media)
  • Blastomere wash medium (see recipe for culture and micromanipulation media)
  • Human embryos
  • Cell lysis buffer: 200 mM KOH/50 mM DTT (prepare fresh)
  • Light mineral oil for PCR (Perkin-Elmer) or Chill-Out 14 liquid wax (MJ Research)
  • Neutralization buffer (unit 1.6)
  • Micropipet puller (Sutter Instruments P-97 or Narishige PB-7)
  • Microforge (Narishige MF-9 or Research Instruments MF42)
  • Glass microcapillaries (0.7-mm i.d. × 0.87-mm o.d., Pyrex glass from Vitrocom or 0.75-mm i.d. × 1.0-mm o.d., borosilicate glass from Sutter Instruments), dry-sterilized 3 hr at 120°C
  • Tissue culture plates (Falcon):
    • 60 × 15–mm
    • 50 × 9–mm
    • 35 × 10–mm
  • Humidified 37°C, 5% CO2 incubator (e.g., Forma)
  • 37°C warm plate
  • Olympus IX70 inverted microscope with Hoffman modulation contrast condenser (40-mm WD) and objectives (HMC EF10×, HMC 20× LWD), mechanical X-Y stage and Brook stage warmer (video camera, monitor, and videocassette recorder are optional)
  • Diamond pen
  • Antivibration table (Newport)
  • Two dual instrument holders (Narishige)
  • Drilling and biopsy micropipet controllers consisting of:
    • Micrometer drive
    • Gastight syringe (Hamilton)
    • Support base (base, micrometer drive and syringe are available preassembled from Stoelting)
    • Luer adapters
    • Polyethylene tubing (PE90, Intramedic)
  • Holding micropipet controller consisting of:
    • Gastight threaded-plunger syringe (Hamilton)
    • Luer adapters
    • Polyethylene tubing (PE90, Intramedic)
    • Stand clamp
  • Two upright joystick-type micromanipulators (Narishige; electronic coarse control and hydraulic fine control)
  • Two stereoscopic zoom microscopes with transmitted-light base and (preferably) wide-field oculars
  • 0.5-ml clarified polypropylene PCR reaction tubes (Out Patient Services), irradiated 15 min in a UV cross-linker at maximum energy
  • Micropipet controller consisting of mouthpiece (Fisher) connected through a 0.22-µm Millex-GV filter (Millipore) or equivalent to one end of a 60-cm length of Tygon tubing with the other end fitted to either a microinstrument holder (Leica) or microcapillary pipet holder (Microcap, Drummond)
  • Laminar-flow hood
  • Heating block

Support Protocol 3: Isolation of Blastomeres from Affected Embryos for Further Investigation

 Materials
  • Human embryos (affected with a genetic disease of interest; see Basic Protocol 1) in drops of culture medium (see Support Protocol 2)
  • Acid Tyrodes solution (see recipe)
  • Embryo culture and wash medium (see recipe for culture and micromanipulation media)
  • Blastomere wash medium (see recipe for culture and micromanipulation media)
  • Cell lysis buffer: 200 mM KOH/50 mM DTT (prepare fresh)
  • Light mineral oil for PCR (Perkins-Elmer) or Chill-Out 14 liquid wax (MJ Research)
  • Embryo handling pipets (see Support Protocol 2, step 2)
  • Two stereoscopic zoom microscopes with transmitted-light base and (preferably) wide-field oculars
  • 35 × 10–mm tissue culture plates (Falcon)
  • Cell transfer pipets (50- to 60-µm o.d.; see Support Protocol 2, step 1)
  • Micropipet controller consisting of a mouthpiece (Fisher) connected through a 0.22-µm Millex-GV filter (Millipore) or equivalent to one end of a 60-cm length of Tygon tubing with the other end fitted to either a microinstrument holder (Leica) or microcapillary pipet holder (Microcap, Drummond)
  • 0.5-ml clarified polypropylene PCR reaction tubes (Out Patient Services), irradiated 15 min in a UV cross-linker at maximum energy

Support Protocol 4: Isolation of Single Lymphocytes/Lymphoblastoid Cells

 Materials
  • Primary lymphocytes or EBV-transformed lymphoblastoid cell lines prepared from male and female gamete donors of each case under investigation
  • RPMI 1640 medium with HEPES (Sigma), without serum or protein supplement
  • Cell lysis buffer: 200 mM KOH/50 mM DTT (prepare fresh)
  • Light mineral oil for PCR (Perkin-Elmer) or Chill-Out 14 liquid wax (MJ Research)
  • Neutralization buffer (unit 1.6)
  • Micropipet puller (Sutter Instruments P-97 or Narishige PB-7)
  • Microforge (Narishige MF-9 or Research Instruments MF42)
  • Glass microcapillaries (0.7-mm i.d. × 0.87-mm o.d., Pyrex glass from Vitrocom or 0.75-mm i.d. × 1.0-mm o.d., borosilicate glass from Sutter Instruments).
  • IEC Clinical centrifuge or equivalent
  • 0.5-ml clarified polypropylene PCR reaction tubes (Out Patient Services), irradiated 15 min in a UV cross-linker at maximum energy
  • 35 × 10–mm tissue culture plates (Falcon)
  • Two stereoscopic zoom microscopes with transmitted-light base and (preferably) wide-field oculars (dark-field illumination may also be used)
  • Micropipet controller consisting of a mouthpiece (Fisher) connected through a 0.22-µm Millex-GV filter (Millipore) or equivalent to one end of a 60-cm length of Tygon tubing with the other end fitted to either a microinstrument holder (Leica) or microcapillary pipet holder (Microcap, Drummond)
  • Laminar-flow hood
  • Heating block
  • Additional reagents and equipment for determining cell viability by trypan blue dye exclusion (appendix 3G)

CAUTION: Universal precautions should be observed in handling all biological materials of human origin. Caution should be exercised when pipetting cells potentially contaminated with Epstein-Barr virus (EBV) or other pathogenic viruses.

Basic Protocol 2: FISH Analysis of Single Blastomeres

 Materials
  • Biopsy medium (see recipe for culture and micromanipulation media)
  • Embryo culture and wash medium (see recipe for culture and micromanipulation media)
  • Hypotonic/partial fixative solution (see recipe)
  • 3:1 fixative solution (see recipe)
  • Hybridization and probe mixture for PGD FISH (Support Protocol 5)
  • 70%, 80%, 90%, and 100% (v/v) ethanol
  • Rubber cement
  • Wash solutions (0.4× SSC, pH 7.0/0.3%Tween 20 and 2× SSC, pH 7.0/0.1% Tween 20; see recipes)
  • 1× PBD buffer (MC Biomedicals)
  • DAPI II (Abbott Molecular)
  • MultiVysion probe mixture for PGS FISH (Support Protocol 5)
  • Antifade (Abbott Molecular)
  • D15Z4, DXZ1, and DYZ1 probe mixture for PGS FISH (Support Protocol 5)
  • Hybridization buffer for PGS or PGD (e.g., LSI and CEP hybridization buffer; Abbott Molecular)
  • 2× SSC, pH 7.0 (appendix 2D)
  • 70% formamide solution (see recipe), 73°C
  • 20-µl, 200-µl, and 1-ml pipettors (Gilson)
  • Micropipettor (Eppendorf)
  • Micropipet (80-µm bore size)
  • 37°C warm plate
  • 2-well Nunc dishes
  • Clay Adams glass slides with etched rings
  • Phase-contrast microscope
  • Pencil
  • 37°C and 73°C water baths
  • Coplin jars
  • Microcentrifuge (e.g., Accu-Tech-Optical)
  • Microcentrifuge tubes (USA/Scientific Plastics)
  • 18-mm2 glass coverslips (Fisher)
  • HyBrite hot plate (Abbott Molecular)
  • Moist chamber (Fig. 4.3.3)
  • 24 × 50–mm no. 1 glass coverslips (Corning)
  • Paper towels
  • Fluorescence microscope
  • Filter set (e.g., FITC, set no. 41001; TRITC, set no. 31002; DAPI, set no. 31000v2 from Chroma Technology, and single bandpass filters: Yellow, Blue, and Aqua from Abbott Molecular)
  • Field finder (Fisher)
  • 12-mm2 glass coverslips (Fisher)
  • Parafilm
  • Additional reagents and equipment for embryo biopsy (see Support Protocol 2)

CAUTION: Formamide and DAPI are hazardous; see appendix 2A for guidelines on handling, storage, and disposal.

Support Protocol 6: Probe Validation

 Materials
  • Peripheral blood lymphocytes from each member of couple
  • Probes (Abbott Molecular) used in Basic Protocol 2
  • Chorionic villus cells (unit 8.3) from control specimen
  • Additional reagents and equipment for culture and metaphase harvest of peripheral blood (unit 4.1), in situ hybridization of probes to metaphase and interphase chromosomes (unit 4.3), and chromosome banding (unit 4.2)
Looking for materials?  Suppliers Guide
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  • Figure 9.10.1
    Schematic representation of steps in preimplantation genetic diagnosis. (A) Following suppression of the woman's natural secretion of gonadotrophic hormones with gonadotrophin-releasing hormone (GnRH) agonist, controlled ovarian stimulation with gonadotrophins produces a number of developing follicles, each containing an oocyte. Follicles may be visualized by ultrasound and oocytes retrieved by transvaginal ultrasound-guided follicular aspiration. One of the ovaries with developing follicles and its closely associated Fallopian tube is depicted. (B) In several individual steps, retrieved oocytes are fertilized in the laboratory by in vitro fertilization (IVF) or intracytoplasmic sperm injection (ICSI), and then cultured through three cleavage divisions to the 8-cell stage. Shown are embryos being selected for removal from the culture dish using a fine glass pipet. (C) Each 8-cell-stage embryo is biopsied to remove one, or preferably two, single blastomeres by a process that involves first dissolving an opening in the zona pellucida, which surrounds the embryo and then aspirating the blastomeres one at a time. The first blastomere to be isolated is shown attached to the biopsy micropipet. (D) Single blastomeres are either prepared and fixed on a microscope slide for FISH analysis or washed and transferred to a reaction tube for cell lysis and DNA amplification. As suggested by the diagram, the double-helical DNA is released from the cell and nucleus into solution, where it is accessible to the Taq DNA polymerase, oligonucleotide primers, and other components of the polymerase chain reaction (PCR). (E) On the basis of the genetic diagnostic results, unaffected embryos are selected for transfer into the woman's uterus.

    View Image
  • Figure 9.10.2
    Preimplantation embryo biopsy of an 8-cell-stage embryo, from video recordings of a clinical case. Embryo shown had an intermediate morphological grade with variation in the sizes of blastomeres. (A) An opening is being dissolved in the zona pellucida surrounding the embryo by application of acidic Tyrodes solution from the smaller glass “drilling” micropipet. The larger micropipet serves to hold the embryo during micromanipulation. (B) and (C) A single blastomere is shown being aspirated into the biopsy micropipet. At the same time, the biopsy micropipet is maneuvered to help free the blastomere from within the zona pellucida. (D) The embryo is shown still attached to the holding micropipet and the isolated blastomere is being released from the biopsy micropipet. The procedure shown in panels B, C, and D is repeated to isolate a second blastomere.

    View Image

Literature Cited

Literature Cited
    Arpaia, E., Dumbrille-Ross, A., Maler, T., Neote, K., Tropak, M., Troxel, C., Stirling, J.L., Pitts, J.S., Bapat, B., Lamhonwah, A.M., Mahuran, D.J., Schuster, S.M., Clarke, J.T.R., Lowden, J.A., and Gravel, R.A. 1988. Identification of an altered splice site in Ashkenazi Tay-Sachs disease. Nature 333:85-86.
    Baart, E.B., Van Opstal, D., los, F.J., Fauser, B.C.J.M., and Martini, E. 2004. Fluorescence in situ hybridization analysis of two blastomeres from day 3 frozen-thawed embryos followed by analysis of the remaining embryo on day 5. Hum. Reprod. 19:685-693.
    Baart, E.B., Martini, E., van den Berg, I., Macklon, N.S., Galjaard, R-J.H., Fauser, B.C.J.M., and Van Opstal, D. 2006. Preimplantation genetic screening reveals a high incidence of aneuploidy and mosaicism in embryos from young women undergoing IVF. Hum. Reprod. 21:223-233.
    Baylis, F. 1990. The ethics of ex utero research on spare “non-viable” IVF human embryos. Bioethics 4:311-329.
    Benadiva, C. and Orris, J.J. 2002. Preimplantation genetic diagnosis and assisted reproduction. Infert. Reprod. Med. Clin. N. Am. 13:489-505.
    Cassel, M.J., Munne, S., Fung, J., and Weier, H.U.G. 1997. Carrier-specific breakpoint-spanning DNA probes: An approach to preimplantation genetic diagnosis in interphase cells. Hum. Reprod. 12:2019-2027.
    Chamberlain, J.S., Gibbs, R.A., Ranier, J.E., Ngugen, P.N., and Caskey, C.T. 1988. Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucl. Acids Res. 16:11141-11156.
    Chong, S.S., Kristjansson, K., Cota, J., Handyside, A.H., and Hughes, M.R. 1993. Preimplantation prevention of X-linked disease: Reliable and rapid sex determination of single human cells by restriction analysis of simultaneously amplified ZFX and ZFY sequences. Hum. Mol. Genet. 2:1187-1191.
    Conn, C.M., Harper, J.C., Winston, R.M.L., and Delhanty, J.D.A. 1998. Infertile couples with Robertsonian translocations: preimplantation genetic analysis of embryos reveals chaotic cleavage divisions. Hum. Genet. 102:117-123.
    Coonen, E., Dumoulin, J.C., Ramaekers, F.C., and Hopman, A.H. 1994. Optimal preparation of preimplantation embryo interphase nuclei for analysis by fluorescence in situ hybridization. Hum. Reprod. 9:533-577.
    Donoso, P., Staessen, C., Fauser, B.C.J.M., and Devroey, P. 2007. Current value of preimplantation genetic aneuploidy screening in IVF. Hum. Reprod. Update 13:15-25.
    Dozortsev, D.I. and McGinnis, K.T. 2001. An improved fixation technique for fluorescence in-situ hybridization for preimplantation genetic diagnosis. Fertil. Steril. 76:186-188.
    ESHRE PGD Consortium Steering Committee. 1999. ESHRE Preimplantation Genetic Diagnosis (PGD) Consortium: preliminary assessment of data from January 1997-September 1998. Europ. Soc. Hum. Reprod. Embryol. 14:3138-3148.
    Germond, M., Nocera, D., Senn, A., Rink, K., Delacretaz, G., and Fa Kan, S. 1995. Microdissection of mouse and human zona pellucida using a 1.48-µm diode laser beam: efficacy and safety of the procedure. Fertil. Steril. 64:604-611.
    Gitschier, J., Drayna, D., Tuddenham, E.G.D., White, R.L., and Lawn, R.M. 1985. Genetic mapping and diagnosis of hemophilia A achieved through a BclI polymorphism in factor VIII gene. Nature 315:738-740.
    Gleicher, N., Weghofer, A., and Barad, D. 2008. Preimplantation genetic screening: “Established” and ready for prime time. Fertil. Steril. 89:780-788.
    Gordon, J.W. and Gang, I. 1990. Use of zona drilling for safe and effective biopsy of murine oocytes and embryos. Biol. Reprod. 42:869-876.
    Griffin, D.K., Handyside, A.H., and Harper, J.C., Wilton, L.J., Atkinson, G., Soussis, I., Wells, D., Kontogianni, E., Tarin, J., and Geber, S. 1994. Clinical experience with preimplantation diagnosis of sex by dual fluorescent in situ hybridization. J. Assist. Reprod. Genet. 11:132-143.
    Grifo, J.A., Tang, Y.X., Munne, S., Alikani, M., Cohen, J., and Rosenwaks, Z. 1994. Health deliveries from biopsied human embryos. Hum. Reprod. 9:912-916.
    Handyside, A.H. 1991. "Biopsy of human cleavage stage embryos and sexing by DNA amplification". In Preimplantation Genetics. Proceedings of the First International Symposium on Preimplantation Genetics (Y. Verlinsky and A. Kuliev, eds.) pp. 75-83. Plenum Press, New York.
    Handyside, A.H., Penketh, R.J.A., Winston, R.M.L., Pattinson, J.K., Delhanty, J.D.A., and Tuddenham, E.G.D. 1989. Biopsy of human preimplantation embryos and sexing by DNA amplification. Lancet i:347-349.
    Handyside, A.H., Kontogianni, E.H., Hardy, K., and Winston, R.M.L. 1990. Pregnancies from biopsied human preimplantation embryos sexed by Y-specific DNA amplification. Nature 344:768-770.
    Handyside, A.H., Lesko, J.G., Tarin, J.J., Winston, R.M.L., and Hughes, M.R. 1992. Birth of a normal girl after in vitro fertilization and preimplantation diagnostic testing for cystic fibrosis. New Engl. J. Med. 327:905-909.
    Hardy, K., Handyside, A.H., and Winston, R.M.L. 1989. The human blastocyst: Cell number, death and allocation during late preimplantation development in vitro. Development 107:597-604.
    Hardy, K., Martin, K.L., Leese, H.J., Winston, R.M.L., and Handyside, A.H. 1990. Human preimplantation development in vitro is not adversely affected by biopsy at the 8-cell stage. Hum. Reprod. 5:708-714.
    Harper, J.C., Coonen, E., Ramaekers, F.C.S., Delhanty, J.D.A., Handyside, A.H., Winston, R.M.L., and Hopman, A.H.N. 1994. Identification of the sex of human preimplantation embryos in two hours using an improved spreading method and fluorescent in situ hybridization (FISH) using directly labeled probes. Hum. Reprod. 9:721-724.
    Iwarsson, E., Malmgren, H., Inzunza, J., Ahrlund-Richter, L., Sjoblom, P., Rosenlund, B., Fridstrom, M., Hovatta, O., Nordenskjold, M., and Blennow, E. 2000. Highly abnormal cleavage divisions in preimplantation embryos from translocation carriers. Pren. Diagn. 20:1038-1047.
    Jobanputra, V., Sobrino, A., Kinney, A., Kline, J., and Warburton, D. 2002. Multiplex interphase FISH as a screen for common aneuploidies in spontaneous abortions. Hum. Reprod. 17:1166-1170.
    Kerem, B., Rommens, J.M., Buchanan, J.A., Markiewicz, D., Cox, T.K., Chakravarti, A., Buchwald, M., and Tsui, L.-C. 1989. Identification of the cystic fibrosis gene: Genetic analysis. Science 245:1073-1080.
    Kristjansson, K., Chong, S.S., Van den Veyver, I.B., Snabes, M.C., and Hughes, M.R. 1994. Preimplantation analyses for dystrophin gene deletions after single cell whole genome amplification. Nature Genet. 6:19-24.
    Krzyminska, U.B., Jutjen, J., and O'Neill, C. 1990. Assessment of the viability and pregnancy potential of mouse embryos biopsied at different preimplantation stages of development. Hum. Reprod. 5:203-208.
    Kuliev, A. and Verlinsky, Y. 2008. Symposium: Genetic and epigenetic aspects of assisted reproduction. Preimplantation genetic diagnosis: technological advances to improve accuracy and range of applications. RBM Online 4:532-538.
    Mackie Ogilvie, C., and Scriven, P.N. 2004. Preimplantation genetic diagnosis (PGD) for reciprocal translocation. Prenat. Diagn. 24:553-555.
    Mastenbroek, S., Twisk Moniek, van Echten-Arends J., Sikkema-Raddatz, B., Korevaar, J.C., Verhoeve, H.R., Vogel, N.E.A., Arts, E.G.J.M., de Vries, J.W.A., Bossuyt, P.M., Buys, C.H.C.M., Heineman, M.J., Repping, S., and van der Veen, F. 2007. In vitro fertilization with preimplantation genetic screening. N. Engl. J. Med. 357:9-19.
    Meyer, L.R., Hazlett, D., Nasta, T., Mangan, P., Klipstein, S., and Karande, V. 2006. Does preimplantation genetic diagnosis (PGD) improve cycle outcome in the “good prognosis” patient Fertil. Steril. 8:S72.
    Michiels, A., Van Assche, E., Liebaers, I., Van Steirteghem, A., and Staessen, C. 2006. The analysis of one or two blastomeres for PGD using fluorescence in-situ hybridization. Hum. Reprod. 21:2396-2402.
    Munne, S., Fung, J., Cassel, M.J., Marquez, C., and Weier, H-U.G. 1998a. Preimplantation genetic analysis of translocations: case-specific probes for interphase cell analysis. Hum. Genet. 102:664-674.
    Munne, S., Morrison, L., Fung, J., Marquez, C., Weier, U., Bahce, M., Sable, D., Grunfeld, L., Schoolcraft, B., Scott, R., and Cohen, J. 1998b. Spontaneous abortions are reduced after preconception diagnosis of translocations. J. Asst. Reprod. Genet. 15:290-296.
    Munne, S., Magli C., Bahce, M., Fung, J., Legator, M., Morrison, L., Cohert, J., and Gianaroli, L. 1998c. Preimplantation diagnosis of the aneuploidies most commonly found in spontaneous abortions and live births: XY, 13, 14, 16, 18, 21, 22. Pren. Diagn. 18:1459-1466.
    Munne, S., Magli, C., Cohen, J., Morton, P., Sadowy, S., Gianoroli, L., Tucker, M., Marquez, C., Sable, D., Ferraretti, A.P., Massey, J.B., and Scott, R. 1999. Positive outcome after preimplantation diagnosis of aneuploidy in human embryos. Hum. Reprod. 14:2191-2199.
    Munne, S., Sandalinas, M., Escudero, T., Fung, J., Gianoroli, L., Cohen, J., and the Saint Barnabas Medical Center PGD Network. 2000. Outcome of preimplantation genetic diagnosis of translocations. Fertil. Steril. 73:1209-1218.
    Munne, S. 2001. Preimplantation genetic diagnosis of structural abnormalities. Mol. Cell. Endocrinol. 183:S55-S58.
    Munne, S. 2003. Preimplantation genetic diagnosis and human implantation - A review. Placenta 24:S70-S76.
    Munne, S., Chen, S., Fischer, J., Colls, P., Zeng, X., Stevens, J., Escudero, T., Oter, M., Schoolcraft, B., Simpson, J.L., and Cohen, J. 2005. Preimplantation genetic diagnosis reduces loss in women aged 35 years and older with a history of recurrent miscarriages. Fertil. Steril. 84:331-335.
    Munne, S., Fischer, J., Warner, A., Chen, S., Zouves, C., Cohen, J., and the Referring centers PGD Group. 2006. Preimplantation genetic diagnosis significantly reduces pregnancy loss in infertile couples: a multicenter study. Fertil. Steril. 85:326-332.
    Munne, S., Gianaroli, L., Tur-Kaspa, I., Magli, C., Sandalinas, M., Grifo, J., Cram, D., Kahraman, S., Verlinsky, Y., and Simpson, J.L. 2007. Substandard application of preimplantation screening may interfere with its clinical success. Fertil. Steril. 88:781-784.
    Myerowitz, R. 1988. Splice junction mutation in some Ashkenazi Jews with Tay-Sachs disease: Evidence against a single defect within this ethnic group. Proc. Natl. Acad. Sci. U.S.A. 85:3955-3959.
    Myerowitz, R. and Costigan, F.C. 1988. The major defect in Ashkenazi Jews with Tay-Sachs disease is an insertion in the gene for the -chain of -hexosaminidase. J. Biol. Chem. 263:18587-18589.
    Nisker, J.A. and Gore-Langton, R.E. 1995. Pre-implantation genetic diagnosis: a model of progress and concern. J. SOGC 17:247-262.
    Ohno, K. and Suzuki, K. 1988. A splicing defect due to an exon-intron junctional mutation results in abnormal -hexosaminidase chain mRNAs in Ashkenazi Jewish patients with Tay-Sachs disease. Biochem. Biophys. Res. Commun. 153:363-369.
    Pellicer, A., Rubio, C., Vidal, F., Minguez, Y., Gimenez, C., Egozcue, J., Remohï, J., and Simón, C. 1999. In vitro fertilization plus preimplantation genetic diagnosis in patients with recurrent miscarriage: An analysis of chromosome abnormalities in human preimplantation embryos. Fertil. Steril. 71:1033-1039.
    Pickering, S.J., Mc Connell, J.M., Johnson, M.H., and Braude, P.R. 1994. Use of a polymorphic dinucleotide sequence to detect nonblastomeric contamination of the polymerase chain reaction in biopsy samples for preimplantation diagnosis. Hum. Reprod. 9:1539-1545.
    Preimplantation genetic testing: A practice committee opinion. 2007. Fertil. Steril. 88:1497-1504.
    Sarkar, G. and Sommer, S.S. 1990. Shedding light on PCR contamination. Nature 343:27.
    Schneider-Gadicke, A., Beer-Romero, P., Brown, L.G., Nausbaum, R., and Page, D.C. 1989. ZFX has a gene structure similar to ZFY, the putative human sex determinant, and escapes X inactivation. Cell 57:1247-1258.
    Scriven, P.N., Handyside, A.H., and Mackie Ogilvie, C. 1998. Chromosome Translocations: segregation modes and strategies for preimplantation genetic diagnosis. Prenat. Diagn. 18:1437-1449.
    Scriven, P.N., O'Mahony, F., Bickerstaff, H., Yeong, C-T., Braude, P., and Mackie Ogilvie, C. 2000. Clinical pregnancy following blastomere biopsy and PGD for a reciprocal translocation carrier: analysis of meiotic outcomes and embryo quality in two IVF cycles. Prenat. Diagn. 20:587-592.
    Scriven, P.N. 2003. Preimplantation genetic diagnosis for carriers of reciprocal translocations. J. Asst. Genet. Tech. 29:49-59.
    Sermon, K., Mouton, C., Harper, J., Geraedts, J., Scriven, P., Wilton, C., Magli, M.C., Michiels, A., Viville, S., and De Die, C. 2005. ESHRE PGD Consortium data collection IV: May-December 2001. Hum. Reprod. 20:19-34.
    Snabes, M.C., Chong, S.S., Subramanian, S., Kristjansson, K., DiSepio, D., and Hughes, M.R. 1994. Preimplantation single cell analysis of multiple genetic loci using whole genome amplification. Proc. Natl. Acad. Sci. U.S.A. 91:6181-6185.
    Staessen, C., Platteau, P., Van Assche, E., Michiels, A., Tournaye, H., and Camus, M. 2004. Comparison of blastocyst transfer with or without preimplantation genetic diagnosis for aneuploidy screening in couples with advanced maternal age: A prospective randomized controlled trial. Hum. Reprod. 19:2849-2858.
    Takeuchi, K., Sandow, B.A., Morsey, M., Kaufman, R.A., Beebe, S.J., and Hodgen, G.D. 1992. Preclinical models for human pre-embryo biopsy and genetic diagnosis. I. Efficiency and normalcy of mouse pre-embryo development after different biopsy techniques. Fertil. Steril. 57:425-430.
    Tarin, J.J. and Handyside, A.H. 1993. Embryo biopsy strategies for preimplantation diagnosis. Fertil. Steril. 5:943-952.
    Tarin, J.J., Conaghan, J., Winston, R.M.L., and Handyside, A.H. 1992. Human embryo biopsy on the 2nd day after insemination for preimplantation diagnosis: Removal of quarter of embryo retards cleavage. Fertil. Steril. 58:970-976.
    Tarkowski, A.K. 1996. An air-drying method for chromosome preparation from mouse eggs. Cytogenet. 5:394-400.
    The Preimplantation Genetic Diagnosis Society (PGDIS). 2008. Guidelines for good practice in PGD: Programme requirements and laboratory quality assurance. RBM Online 16:134-147.
    Thornhill, A.R., deDie-Smulders, C.E., Geraedts, J.P., Harper, J.C., Harton, G.L., Lavery, S.A., Moutou, C., Robinson, M.D., Schutzler, A.G., Scriver, P.N., Sermon, K.D., and Wilton, L. 2005. ESHRE PGD Consortium “Best practice guidelines for clinical preimplantation genetic diagnosis (PGD) and preimplantation genetic screening (PGS)”. Hum. Reprod. 20:35-48.
    Van Blerkom, J. 1993. "Normal and abnormal patterns of human preimplantation embryogenesis I and II". In Course XI. Contemporary Methods of Sperm, Oocyte and Embryo Morphology Assessment, pp. 135-154. American Society for Reproductive Medicine, Birmingham, Ala.
    Verlinsky, Y. 1991. "Biopsy of human gametes". In Preimplantation Genetics. Proceedings of the First International Symposium on Preimplantation Genetics (Y. Verlinsky and A. Kuliev, eds.) pp. 39-47. Plenum Press, New York.
    Verlinsky, Y. and Cieslak, J. 1993. "Embryological and technical aspects of preimplantation genetic diagnosis". In Preimplantation Diagnosis of Genetic Diseases. A New Technique in Assisted Reproduction (Y. Verlinsky and A.M. Kuliev, eds.) pp. 49-67. Wiley-Liss, New York.
    Verlinsky, Y., Handyside, A., Grifo, J., Munné, S., Cohen, J., Liebers, I., Levinson, G., Arnheim, N., Hughes, M., and Delhanty, J. 1994. Preimplantation diagnosis of genetic and chromosomal disorders. J. Assist. Reprod. Genet. 11:236-243.
    Verlinsky, Y., Cieslak, J., Ivakhnenko, L., Evsikov, S., Wolf, G., White, M., Lifchez, A., Kaplan, B., Moise, J., Valle, J., Ginsberg, N., Strom, C., and Kuliev, A. 1998. Prepregnancy genetic testing for age-related aneuploidies by polar body analysis. Genet. Testing 1:231-235.
    Weier, H.U.G., Munne, S., and Fung, J. 1999. Patient-specific probes for preimplantation genetic diagnosis (PGD) of structural and numerical aberrations in interphase cells. J. Assist. Reprod. Genet. 16:182-191.
    Weremowicz, S., Sandstrom, J.D., Morton, C.C., and Miron, P.M. 2006. Validation of DNA probes for preimplantation genetic diagnosis (PGD) by fluorescence in situ hybridization (FISH). Prenat. Diagn. 26:1042-1050.
    Wiktor, A.E., Van Dyke, D.L., Stupca, P.J., Ketterling, R.T., Thorland, E.C., Shearer, B.N., Fink, S.R., Stockero, K.J., Mjorowicz, J.R., and Dewald, G.W. 2006. Preclinical validation of fluorescence in situ hybridization assays for clinical practice. Genet. Med. 8:16-23.
    Zhang, L., Cui, X., Schmitt, K., Hubert, R., Navidi, W., and Arnheim, N. 1992. Whole genome amplification from a single cell: Implications for genetic analysis. Proc. Natl. Acad. Sci. U.S.A. 89:5847-5851.
 Key References
    ESHRE, 1999. See above.

Presents the largest dataset to date compiled from multiple centers performing PGD. The data presented is comprehensive and includes information on clinical indications, reproductive histories, genetic analyses, pregnancies, and liveborn children.

    Scriven et al., 1998. See above.

Provides a thorough review of meiotic segregation of reciprocal translocations and describes practical strategies for choosing probes to detect the possible unbalanced products of conception in a preimplantation setting.

 Internet Resources
    http://www.acmg.net

American College of Medical Genetics. Standard and Guidelines for Clinical Genetic Laboratories.

    http://www.phppo.cdc.gov/clia/regs/toc.aspx.

Clinical Laboratory Improvement Amendments. CLIA:42 CFR Part 493-1253.

    http://www.cap.org

College of American Pathologists Laboratory Accreditation Checklist.

    www.fda.gov/cder/guidance/pv.htm

Food and Drug Administration. Guidelines on General Principle of Process Validation.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.