Molecular Biology > Polymerase Chain Reaction

User Ratings

Your rating: None (1 vote)
Your rating: None (1 vote)
Your rating: None (1 vote)
 Add your comments

Molecular Analysis of Gene Rearrangements and Mutations in Acute Leukemias and Myeloproliferative Neoplasms

Lynette M. Sholl1,  Janina Longtine1

1Brigham and Women's Hospital, Boston, Massachusetts

Publication Name: 
Current Protocols in Human Genetics
Unit Number: 
Unit 10.4
DOI: 
10.1002/0471142905.hg1004s67
Online Posting Date: 
October, 2010
GO TO THE FULL TEXT:
PDF or HTML at Wiley Online Library
Are you the author of this protocol? Login or register and return to this page.

Abstract

A large subset of acute leukemias and other myeloproliferative neoplasms contain specific genetic alterations, many of which are associated with unique clinical and pathologic features. These alterations include chromosomal translocations leading to oncogenic fusion genes, as well as mutations leading to aberrant activation of a variety of proteins critical to hematopoietic progenitor cell proliferation and differentiation. Molecular analysis is central to diagnosis and clinical management of leukemias, permitting genetic confirmation of a clinical and histologic impression, providing prognostic and predictive information, and facilitating detection of minimal residual disease. This unit will outline approaches to the molecular diagnosis of the most frequent and clinically relevant genetic alterations in acute leukemias and myeloproliferative neoplasms. Curr. Protoc. Hum. Genet. 67:10.4.1-10.4.35 © 2010 by John Wiley & Sons, Inc.

Keywords: leukemia; translocations; myeloproliferative neoplasms; mutations; prognosis

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Detection of Chromosomal Translocations by Reverse PCR: t(9;22)(q34;q11.2) with BCR-ABL1 Fusion
  • Alternate Protocol 1: Quantitative Reverse Transcriptase PCR (qRT-PCR): t(9;22) (q34;q11.2) with BCR-ABL1 Fusion
  • Alternate Protocol 2: Detection of Chromosomal Translocations by RT- PCR of t(15;17)(q22;q21) with PML-RARA Fusion
  • Basic Protocol 2: Detection of Gene Mutations by PCR: ABL1-Resistance Mutations
  • Alternate Protocol 3: Detection of Point Mutations by PCR: KIT Mutation
  • Alternate Protocol 4: Detection of Mutations by PCR: FLT3-ITD and D835 Mutation
  • Alternate Protocol 5: Detection of Insertions/Deletions by PCR: NPM1 Mutation
  • Alternate Protocol 6: Targeted Mutation Analysis: JAK2 V617F Mutation Detection by ARMS
  • Support Protocol 1: RNA Isolation Using Trizol Reagent
  • Support Protocol 2: Creating Standards for Quantitative PCR: BCR-ABL1
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Detection of Chromosomal Translocations by Reverse PCR: t(9;22)(q34;q11.2) with BCR-ABL1 Fusion

 Materials
  • Bone marrow or blood samples
  • 5× reverse transcriptase buffer (Invitrogen)
  • DEPC–treated water (appendix 2D)
  • 2.5 mM deoxynucleotide triphosphate (dNTP) mix (2.5 mM each dATP, dCTP, dGTP and dTTP; see recipe)
  • 0.1 M dithiothreitol (DTT)
  • Ribonuclease inhibitor (recombinant RNasin; Promega Corp.)
  • 10 µM primer solutions (see Fig. 10.4.1 for primer sequences; see Tables 10.4.1 and 10.4.2 for first- and second-round PCR primers used)
  • 200 U/µl reverse transcriptase( SuperScript, RNase H–; Invitrogen)
  • 10× PCR buffer (Applied Biosystems)
  • 25 mM MgCl2 (Applied Biosystems)
  • 10% (v/v) formamide
  • 5 U/µl Taq DNA polymerase (Applied Biosystems)
  • 2.5% agarose gel containing 0.5 µg/ml of ethidium bromide (prepared with TBE buffer; unit 2.7)
  • PCR tubes
  • 95°C water baths
  • Thermal cycler
  • Additional reagents and equipment for isolating RNA by the TRIzol method (Support Protocol 1) and agarose gel electrophoresis (see, e.g., unit 2.7)

NOTE: Experiments involving PCR and RNA require extremely careful technique to prevent contamination and RNA degradation; see appendix 2D.

CAUTION: DEPC is a suspected carcinogen and should be handled carefully.
 
Table 10.4.1 First-Round PCR Master Mix for t(9;22) and t(15;17) Assays
t(9;22) assayat(15;17) assayb
Reaction componentControl (µl)Fusion (µl)Control (µl)Intron 3 (µl)Intron/exon 6 (µl)
10 µM primer 1221.51.51.5
10 µM primer 22—2——
10 µM primer 32——2
10 µM primer 4—2——2
10 µM primer 5—2———
10× PCR buffer55555
25 mM MgCl233333
Water18.2518.2520.2515.2520.25
10% formamide———5—
5 U/µl Taq polymerase0.250.250.250.250.25
 aSee Figure 10.4.1 for t(9;22) assay primer sequences.
 bSee Figure 10.4.3 for t(15;17) assay primer sequences.
 
Table 10.4.2 Second-Round PCR Master Mix for t(9;22) and t(15;17) Assays
t(9;22) assayat(15;17) assayb
Reaction componentControl (µl)Fusion (µl)Control (µl)Intron 3 (µl)Intron/exon 6 (µl)
10 µM primer 2——2——
10 µM primer 5——2——
10 µM primer 622—22
10 µM primer 72——2—
10 µM primer 8—2——2
10 µM primer 9—2———
10× PCR buffer55555
2.5 mM MgCl233333
2.5 mM dNTP mix44444
Water23.7521.7523.7518.7523.75
10% formamide———5—
5 U/µl Taq polymerase0.250.250.250.250.25
 aSee Figure 10.4.1 for t(9;22) assay primer sequences.
 bSee Figure 10.4.3 for t(15;17) assay primer sequences.

Alternate Protocol 1: Quantitative Reverse Transcriptase PCR (qRT-PCR): t(9;22) (q34;q11.2) with BCR-ABL1 Fusion

 Additional Materials (also see Basic Protocol 1)
  • DEPC-treated H2O
  • 10 µM primers (see primer sequences in Table 10.4.3)
  • TaqMan One-Step RT-PCR Master Mix Reagents kit (Applied Biosystems, cat. no. 4309169) including:
    • 2× Master Mix without UNG
    • 40× MultiScribe and RNase Inhibitor Mix
  • 5 µM TaqMan Minor Groove Binding (MGB) Probe (Applied Biosystems, cat. no. 4316034; see probe sequences in Table 10.4.3)
  • Optical 96-well reaction plates
  • Optical caps or optical adhesive plate covers
  • ABI Sequence Detection System (7000 or 7900)
  • Centrifuge with 96-well plate adaptor
     
    Table 10.4.3 Primer and Probe Sequences for qRT-PCR for the BCR-ABL1 Fusion Transcript
    NameSequence
    BCR-ABL1 qRT-PCR primer sequences
    BCR exon B3Forward primer5¢ CAGCCACTGGATTTAAGCAGAGT 3¢
    BCR exon B2Forward primer5¢ CGCTGACCATCAATAAGGAAGAA 3¢
    ABL1 exon 2Reverse primer5¢ CTGGGACTCCGAGTTTCAGTC 3¢
    GUSForward primer5¢ ATTTTGCCCGATTTCATGACTGA 3¢
    GUSReverse primer5¢ GCTCACTTCTAGGGGAAAAAT AAG 3¢
    BCR-ABL1 qRT-PCR probe sequences
    ABL1 exon 2 (common)5¢ CCTTCAGCGGCCAGTAG 3¢
    GUS5¢ CAGTCACCGACGAGAGT 3¢

Alternate Protocol 2: Detection of Chromosomal Translocations by RT- PCR of t(15;17)(q22;q21) with PML-RARA Fusion

 Additional Materials (also see Basic Protocol 1)
  • 10 µM t(15;17) primers (Fig. 10.4.3)
  • 18 µl sample and control RT products (Basic Protocol 1, steps 1 through 4)

Basic Protocol 2: Detection of Gene Mutations by PCR: ABL1-Resistance Mutations

 Materials
  • RNA sample and controls
  • 10× PCR buffer (Applied Biosystems)
  • 25 mM MgCl2 (Applied Biosystems)
  • 2.5 mM deoxynucleotide triphosphate (dNTP) mix (2.5 mM each dATP, dCTP, dGTP and dTTP; see recipe)
  • First- and second-round BCR-ABL1 PCR primers (see Table 10.4.5)
  • Taq DNA polymerase
  • 2.5% agarose gel prepared in TBE buffer (see unit 2.7)
  • 10 mM BigDye (v3.1) (ABI)
  • 10 µM primers (Table 10.4.5)
  • DEPC-treated H2O (appendix 2D)
  • 3 M sodium acetate (appendix 2D)
  • 100% ethanol
  • 70% ethanol
  • 100% isopropanol
  • HI DI formamide (ABI)
  • 0.2-ml PCR tubes, individual or strips of 8, or 96 well plate
  • Thermal cycler
  • 3130xl POP7 Genetic Analyzer (ABI) and capillary electrophoresis (CE) tubes
  • Centrifuge with 96-well plate adaptor
  • Additional reagents and equipment for reverse transcription (Basic Protocol 1, steps 1 to 4) and agarose gel electrophoresis (e.g., see unit 2.7)
     
    Table 10.4.5 Nested PCR and Sequencing Primers for BCR-ABL Mutation Analysis
    BCR-ABL1 PCR (1st reaction)
    BCR Exon B2Forward5¢ACAGCATTCCGCTGACCAT 3¢
    ABL1 kinase domain (KD)Reverse5¢TCCACTTCGTCTGAGATACTGGATT 3¢
    Nested ABL1 PCR 1
    ABL1-KD-M13Forward5¢TGTAAAACGACGGCCAGTCGCAACAAGCCCACTGTCT 3¢
    ABL1-KD-M13Reverse5¢CAGGAAACAGCTATGACCGCTGTGTAGGTGTCCCCTGT 3¢
    Nested ABL1 PCR 2
    ABL1-KD-M13-2Forward5¢TGTAAAACGACGGCCAGTGCTGATTTTGGCCTGAGCAG 3¢
    ABL1-KD-M13-2Reverse5¢CAGGAAACAGCTATGACCTCCACTTCGTCTGAGATACTGGATT 3¢
    Sequencing primers
    M13Forward5¢ TGTAAAACGACGGCCAGT 3¢
    M13Reverse5¢ CAGGAAACAGCTATGACC3¢

Alternate Protocol 3: Detection of Point Mutations by PCR: KIT Mutation

 Additional Materials (also see Basic Protocol 2)
  • DNA sample
  • 10 µM KIT primers (see Table 10.4.7)
     
    Table 10.4.7 KIT PCR Primers
    KIT intron 16Forward5¢ GGTTTTCTTTTCTCCTCCAACC 3¢
    KIT intron 17Reverse5¢ TGCAGGACTGTCAAGCAGAG 3¢
    KIT exon 17 mutantForward5¢ GATTTTGGTCTAGCCAGCGT 3¢

Alternate Protocol 4: Detection of Mutations by PCR: FLT3-ITD and D835 Mutation

 Additional Materials (also see Basic Protocol 2)
  • 10 µM FLT3 primers (see Table 10.4.8)
  • Sample DNA
  • NEBuffer 3 (New England Biolabs)
  • 10× BSA (New England Biolabs)
  • EcoRV restriction enzyme (New England Biolabs)
     
    Table 10.4.8 FLT3 PCR Primers
    FLT3-ITD-FAMForward5¢ 6-FAM-GCAATTTAGGTATGAAAGCCAGC-3¢ (light sensitive)
    FLT3-ITD-HEXReverse5¢-HEX-CTTTCAGCATTTTGACGGCAACC-3¢ (light sensitive)
    FLT-D835-TETForward5¢-TET-GTAAAACGACGGCCAGCCGCCAGGAACGTGCTTG-3¢(light sensitive)
    FLT-D835Reverse5¢-CAGGAAACAGCTATGACGATATCAGCCTCACATTGCCCC-3¢

Alternate Protocol 5: Detection of Insertions/Deletions by PCR: NPM1 Mutation

 Additional Materials (also see Basic Protocol 2)
  • NPM1 primers (see Table 10.4.10)
  • Sample DNA
     
    Table 10.4.10 NPM1 PCR primers
    NPM1-M13Forward5¢ CAGGAAACAGCTATGACCAGGGCAGGGACATTCTCATA 3¢
    NPM1-M13Reverse5¢ TGTAAAACGACGGCCAGTCTATGAAGTGTTGTGGTTCC 3¢

Alternate Protocol 6: Targeted Mutation Analysis: JAK2 V617F Mutation Detection by ARMS

 Additional Materials (also see Basic Protocol 2)
  • JAK2 PCR primers (see Table 10.4.11)
     
    Table 10.4.11 JAK2 PCR Primers
    JAK2 outerForward5¢- CAGGCTTACACAGGGGTTTC -3¢
    JAK2 outer-FAMReverse5¢-FAM-ATTGCTTTCCTTTTTCACAAGAT-3¢ (light-sensitive)
    JAK2 WTForward5¢-GCATTTGGTTTTAAATTATGGAGTATATG-3¢
    JAK2 mutant-FAMReverse5¢-FAM-GTTTTACTTACTCTCGTCTCCACAAAA-3¢ (light-sensitive)

Support Protocol 1: RNA Isolation Using Trizol Reagent

 Materials
  • Patient samples: whole blood, bone marrow, CSF, or proficiency testing samples
  • Puregene RBC Lysis Solution (Gentra Systems, cat. no. D-50K1)
  • Phosphate-buffered saline (PBS; appendix 2D)
  • TRIzol Reagent (Invitrogen, cat no. 15596-026; store at 2° to 8°C)
  • Chloroform
  • 100% isopropanol
  • 70% and 80% ethanol (in DEPC-treated water)
  • Nuclease-free (e.g., DEPC-treated) H2O
  • RNase-Free DNase Set (Qiagen, cat. no. 79254) including:
    • Buffer RDD
    • DNase I stock solution
    • Nuclease-free H2O
  • RNeasy MinElute Clean up Kit (Qiagen) including:
    • Buffer RLT
    • Buffer RPE
    • RNeasy MinElute Spin Columns
  • 15- and 50-ml conical centrifuge tubes
  • Beckman Allegra 6R tabletop centrifuge
  • NanoDrop 1000 spectrophotometer (appendix 3D)
  • Additional reagents and equipment for determination of RNA concentration using the NanoDrop spectrophotometer (appendix 3D)

Support Protocol 2: Creating Standards for Quantitative PCR: BCR-ABL1

 Materials
  • 10 mg/ml yeast tRNA (Ambion/Applied Biosystems, cat. no. 7119)
  • DEPC-treated water (appendix 2D)
  • 400 ng/µl negative RNA (InVivoScribe, cat. no. 4-089-3070
  • 400 ng/µl B3A2 RNA (InVivoScribe, cat. no. 4-089-0910)
  • 400 ng/µl B2A2 RNA (InVivoScribe, cat. no. 4-089-0190)
  • Additional reagents and equipment for spectrophotometric determination of RNA concentration (appendix 3D)


Looking for materials?  Suppliers Guide
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  • Figure 10.4.1
    Diagram of the rearrangements in t(9;22). (A) Gene structure in translocated and control chromosomes. The BCR gene on chromosome 22 contains 20 exons. Exons 12 to 16, which comprise the major breakpoint region, are also called exons b1 to b5, respectively. The ABL1 gene contains two alternative first exons, 1b and 1a. Whether or not the chromosome 9 breakpoint is 5¢ to either of these exons, neither one has been detected in a fusion BCR-ABL1 mRNA. In almost all reported cases, the ABL1 portion of the fusion mRNA begins with the 5¢ end of exon 2 (a2). The three possible BCR-ABL1 PCR products, e1/a2, e14a2(b3/a2) and e13a2(b2/a2), are shown across the bottom of the diagram with their respective sizes. (B) Sequences of oligonucleotide primers for first- and second-round PCR for t(9;22) (modified from Maurer et al., 1990). First-round PCR antisense primer 1 is paired with sense primers 2 and 3 (control), 4 (major breakpoint), or 5 (minor breakpoint). Second-round PCR antisense primer 6 is paired with sense primers 7 (control), 8 (major breakpoint), or 9 (minor breakpoint). In this assay ABL1 is used for the control. Primers 2 and 3 are necessary because ABL1 has two alternative first exons. Primers 4 and 8 hybridize to exons in the major breakpoint region of BCR. Primers 5 and 9 will hybridize to exon 1 of BCR, which is upstream of the minor breakpoint region in intron 1 of BCR.

    View Image
  • Figure 10.4.2
    Plate setup for the three probe/primer mixes. This setup permits the user to run up to nine samples per plate (here designated as #1 to #9)

    View Image
  • Figure 10.4.3
    Diagram of the rearrangements of t(15;17) in APL. (A) Gene structure in translocated chromosomes. Breakpoints in PML either occur in intron 3, leading to the short type of fusion product known as bcr3, in intron 6, leading to the long (bcr1) fusion product, or in exon 6, leading to the variable (bcr2) types of fusion products. RARA breakpoints occur consistently in intron 2. (B) Primer sequences for first- and second- round PCR for t(15;17). First-round antisense primer 1 binds RARA exon 3 and pairs with sense primers 3 (PML exon 3) or 4 (PML exon 5) in two separate reactions. Second-round antisense primer 6 binds RARA exon 3 and pairs with sense primers 7 (PML exon 3) or 8 (PML exon 5), also in two separate reactions. A third primer set (primers 1 and 2 in the first round; primers 5 and 2 in the second round) is utilized to amplify normal RARA transcript across its intron 2 breakpoint as a control for RNA quality. The reaction containing the PML exon 3 primer will detect all three possible products, whereas the reaction containing the PML exon 5 primer will detect only bcr1 and bcr2 products.

    View Image

Literature Cited

Literature Cited
    Akin, C. 2006. Molecular diagnosis of mast cell disorders: A paper from the 2005 William Beaumont Hospital Symposium on Molecular Pathology. J. Mol. Diagn. 8:412-419.
    Bassan, R., Spinelli, O., Oldani, E., Intermesoli, T., Tosi, M., Peruta, B., Rossi, G., Borlenghi, E., Pogliani, E.M., Terruzzi, E., Fabris, P., Cassibba, V., Lambertenghi-Deliliers, G., Cortelezzi, A., Bosi, A., Gianfaldoni, G., Ciceri, F., Bernardi, M., Gallamini, A., Mattei, D., Di Bona, E., Romani, C., Scattolin, A.M., Barbui, T., and Rambaldi, A. 2009. Improved risk classification for risk-specific therapy based on the molecular study of minimal residual disease (MRD) in adult acute lymphoblastic leukemia (ALL). Blood 113:4153-4162.
    Brisco, M.J., Latham, S., Sutton, R., Hughes, E., Wilczek, V., van Zanten, K., Budgen, B., Bahar, A.Y., Malec, M., Sykes, P.J., Kuss, B.J., Waters, K., Venn, N.C., Giles, J.E., Haber, M., Norris, M.D., Marshall, G.M., and Morley, A.A. 2009. Determining the repertoire of IGH gene rearrangements to develop molecular markers for minimal residual disease in B-lineage acute lymphoblastic leukemia. J. Mol. Diagn. 11:194-200.
    Cavé, H., van der Werff ten Bosch, J., Suciu, S., Guidal, C., Waterkeyn, C., Otten, J., Bakkus, M., Thielemans, K., Grandchamp, B., and Vilmer, E. 1998. Clinical significance of minimal residual disease in childhood acute lymphoblastic leukemia. European Organization for Research and Treatment of Cancer–Childhood Leukemia Cooperative Group. N. Engl. J. Med. 339:591-598.
    Chronic Myeloid Leukemia Trialists' Collaborative Group. 1997. Interferon alfa versus chemotherapy for chronic myeloid leukemia: A meta-analysis of seven randomized trials: Chronic Myeloid Leukemia Trialists' Collaborative Group. J. Natl. Cancer Inst. 89:1616-1620.
    Coustan-Smith, E., Ribeiro, R.C., Stow, P., Zhou, Y., Pui, C.H., Rivera, G.K., Pedrosa, F., and Campana, D. 2006. A simplified flow cytometric assay identifies children with acute lymphoblastic leukemia who have a superior clinical outcome. Blood 108:97-102.
    Druker, B.J., Sawyers, C.L., Kantarjian, H., Resta, D.J., Reese, S.F., Ford, J.M., Capdeville, R., and Talpaz, M. 2001a. Activity of a specific inhibitor of the BCR-ABL tyrosine kinase in the blast crisis of chronic myeloid leukemia and acute lymphoblastic leukemia with the Philadelphia chromosome. N. Engl. J. Med. 344:1038-1042.
    Druker, B.J., Talpaz, M., Resta, D.J., Peng, B., Buchdunger, E., Ford, J.M., Lydon, N.B., Kantarjian, H., Capdeville, R., Ohno-Jones, S., and Sawyers, C.L. 2001b. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med. 344:1031-1037.
    Falini, B., Martelli, M.P., Bolli, N., Bonasso, R., Ghia, E., Pallotta, M.T., Diverio, D., Nicoletti, I., Pacini, R., Tabarrini, A., Galletti, B.V., Mannucci, R., Roti, G., Rosati, R., Specchia, G., Liso, A., Tiacci, E., Alcalay, M., Luzi, L., Volorio, S., Bernard, L., Guarini, A., Amadori, S., Mandelli, F., Pane, F., Lo-Coco, F., Saglio, G., Pelicci, P.G., Martelli, M.F., and Mecucci, C. 2006. Immunohistochemistry predicts nucleophosmin (NPM) mutations in acute myeloid leukemia. Blood 108:1999-2005.
    Falini, B., Bolli, N., Liso, A., Martelli, M.P., Mannucci, R., Pileri, S., and Nicoletti, I. 2009. Altered nucleophosmin transport in acute myeloid leukaemia with mutated NPM1: Molecular basis and clinical implications. Leukemia 23:1731-1743.
    Hirt, C., Schuler, F., Kiefer, T., Schwenke, C., Haas, A., Niederwieser, D., Neser, S., Assmann, M., Srock, S., Rohrberg, R., Dachselt, K., Leithäuser, M., Rabkin, C.S., Herold, M., and Dölken, G. 2008. Rapid and sustained clearance of circulating lymphoma cells after chemotherapy plus rituximab: Clinical significance of quantitative t(14;18) PCR monitoring in advanced stage follicular lymphoma patients. Br. J. Haematol. 141:631-640.
    Hochhaus, A., O'Brien, S.G., Guilhot, F., Druker, B.J., Branford, S., Foroni, L., Goldman, J.M., Müller, M.C., Radich, J.P., Rudoltz, M., Mone, M., Gathmann, I., Hughes, T.P., Larson, R.A., and IRIS Investigators. 2009. Six-year follow-up of patients receiving imatinib for the first-line treatment of chronic myeloid leukemia. Leukemia 23:1054-1061.
    Jeha, S., Pei, D., Raimondi, S.C., Onciu, M., Campana, D., Cheng, C., Sandlund, J.T., Ribeiro, R.C., Rubnitz, J.E., Howard, S.C., Downing, J.R., Evans, W.E., Relling, M.V., and Pui, C.H. 2009. Increased risk for CNS relapse in pre-B cell leukemia with the t(1;19)/TCF3-PBX1. Leukemia 23:1406-1409.
    Jones, A.V., Kreil, S., Zoi, K., Waghorn, K., Curtis, C., Zhang, L., Score, J., Seear, R., Chase, A.J., Grand, F.H., White, H., Zoi, C., Loukopoulos, D., Terpos, E., Vervessou, E.C., Schultheis, B., Emig, M., Ernst, T., Lengfelder, E., Hehlmann, R., Hochhaus, A., Oscier, D., Silver, R.T., Reiter, A., and Cross, N.C. 2005. Widespread occurrence of the JAK2 V617F mutation in chronic myeloproliferative disorders. Blood 106:2162-2168.
    Leroy, H., Roumier, C., Huyghe, P., Biggio, V., Fenaux, P., and Preudhomme, C. 2005. CEBPA point mutations in hematological malignancies. Leukemia 19:329-334.
    Levis, M. and Small, D. 2003. FLT3: ITDoes matter in leukemia. Leukemia 17:1738-1752.
    Maurer, J., Kinzel, H., Nentwig, T., and Thiel, E. 1990. Molecular diagnosis of the Philadelphia chromosome in chronic myelogenous and acute lymphoblastic leukemias by PCR. Dis. Markers 8:211-218.
    Mauro, M.J. and Deininger, M.W. 2006. Chronic myeloid leukemia in 2006: A perspective. Haematologica 91:152.
    Melnick, A. and Licht, J.D. 1999. Deconstructing a disease: RARalpha, its fusion partners, and their roles in the pathogenesis of acute promyelocytic leukemia. Blood 93:3167-3215.
    Moorman, A.V., Richards, S.M., Robinson, H.M., Strefford, J.C., Gibson, B.E., Kinsey, S.E., Eden, T.O., Vora, A.J., Mitchell, C.D., Harrison, C.J.; UK Medical Research Council (MRC)/National Cancer Research Institute (NCRI) Childhood Leukaemia Working Party (CLWP). 2007. Prognosis of children with acute lymphoblastic leukemia (ALL) and intrachromosomal amplification of chromosome 21 (iAMP21). Blood 109:2327-2330.
    Murphy, K.M., Levis, M., Hafez, M.J., Geiger, T., Cooper, L.C., Smith, B.D., Small, D., and Berg, K.D. 2003. Detection of FLT3 internal tandem duplication and D835 mutations by a multiplex polymerase chain reaction and capillary electrophoresis assay. J. Mol. Diagn. 5:96-102.
    Pabst, T., Mueller, B.U., Zhang, P., Radomska, H.S., Narravula, S., Schnittger, S., Behre, G., Hiddemann, W., and Tenen, D.G. 2001. Dominant-negative mutations of CEBPA, encoding CCAAT/enhancer binding protein-alpha (C/EBPalpha), in acute myeloid leukemia. Nat. Genet. 27:263-270.
    Pandolfi, P.P., Alcalay, M., Fagioli, M., Zangrilli, D., Mencarelli, A., Diverio, D., Biondi, A., Lo Coco, F., Rambaldi, A., and Grignani, F. 1992. Genomic variability and alternative splicing generate multiple PML/RAR alpha transcripts that encode aberrant PML proteins and PML/RAR alpha isoforms in acute promyelocytic leukaemia. EMBO J 11:1397-1407.
    Pasqualucci, L., Liso, A., Martelli, M.P., Bolli, N., Pacini, R., Tabarrini, A., Carini, M., Bigerna, B., Pucciarini, A., Mannucci, R., Nicoletti, I., Tiacci, E., Meloni, G., Specchia, G., Cantore, N., Di Raimondo, F., Pileri, S., Mecucci, C., Mandelli, F., Martelli, M.F., and Falini, B. 2006. Mutated nucleophosmin detects clonal multilineage involvement in acute myeloid leukemia: Impact on WHO classification. Blood 108:4146-4155.
    Ponziani, V., Gianfaldoni, G., Mannelli, F., Leoni, F., Ciolli, S., Guglielmelli, P., Antonioli, E., Longo, G., Bosi, A., and Vannucchi, A.M. 2006. The size of duplication does not add to the prognostic significance of FLT3 internal tandem duplication in acute myeloid leukemia patients. Leukemia 20:2074-2076.
    Preudhomme, C., Revillion, F., Merlat, A., Hornez, L., Roumier, C., Duflos-Grardel, N., Jouet, J.P., Cosson, A., Peyrat, J.P., and Fenaux, P. 1999. Detection of BCR-ABL transcripts in chronic myeloid leukemia (CML) using a ‘real time’ quantitative RT-PCR assay. Leukemia 13:957-964.
    Renneville, A., Roumier, C., Biggio, V., Nibourel, O., Boissel, N., Fenaux, P., and Preudhomme, C. 2008. Cooperating gene mutations in acute myeloid leukemia: A review of the literature. Leukemia 22:915-931.
    Schlenk, R.F., Dohner, K., Krauter, J., Fröhling, S., Corbacioglu, A., Bullinger, L., Habdank, M., Späth, D., Morgan, M., Benner, A., Schlegelberger, B., Heil, G., Ganser, A., Döhner, H., and German-Austrian Acute Myeloid Leukemia Study Group. 2008. Mutations and treatment outcome in cytogenetically normal acute myeloid leukemia. N. Engl. J. Med. 358:1909-1918.
    Schnittger, S., Schoch, C., Kern, W., Mecucci, C., Tschulik, C., Martelli, M.F., Haferlach, T., Hiddemann, W., and Falini, B. 2005. Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal karyotype. Blood 106:3733-3739.
    Schnittger, S., Kohl, T.M., Haferlach, T., Kern, W., Hiddemann, W., Spiekermann, K., and Schoch, C. 2006. KIT-D816 mutations in AML1-ETO-positive AML are associated with impaired event-free and overall survival. Blood 107:1791-1799.
    Schumacher, J.A., Elenitoba-Johnson, K.S., and Lim, M.S. 2008. Detection of the c-kit D816V mutation in systemic mastocytosis by allele-specific PCR. J. Clin. Pathol. 61:109-114.
    Shah, N.P., Kasap, C., Weier, C., Balbas, M., Nicoll, J.M., Bleickardt, E., Nicaise, C., and Sawyers, C.L. 2008. Transient potent BCR-ABL inhibition is sufficient to commit chronic myeloid leukemia cells irreversibly to apoptosis. Cancer Cell 14:485-493.
    Soverini, S., Iacobucci, I., Baccarani, M., and Martinelli, G. 2007. Targeted therapy and the T315I mutation in Philadelphia-positive leukemias. Haematologica 92:437-439.
    Steensma, D.P. 2005. Polycythemia vera: Plethora, from prehistory to present. Curr. Hematol. Rep. 4:230-234.
    Steensma, D.P. 2006. JAK2 V617F in myeloid disorders: Molecular diagnostic techniques and their clinical utility: A paper from the 2005 William Beaumont Hospital Symposium on Molecular Pathology. J. Mol. Diagn. 8:397-411.
    Swerdlow, S.H., Campo, E., Harris, N.L., Jaffe, E.S., Pileri, S.A., Stein, H., Thiele, J., Vardiman, J.W. (eds.). 2008. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues. World Health Organization Classification of Tumours. International Agency for Research on Cancer, Lyon, France.
    Tagata, Y., Yoshida, H., Nguyen, L.A., Kato, H., Ichikawa, H., Tashiro, F., and Kitabayashi, I. 2008. Phosphorylation of PML is essential for activation of C/EBP epsilon and PU.1 to accelerate granulocytic differentiation. Leukemia 22:273-280.
    Thiede, C., Koch, S., Creutzig, E., Steudel, C., Illmer, T., Schaich, M., and Ehninger, G. 2006. Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood 107:4011-4020.
    Ustun, C., Corless, C.L., Savage, N., Fiskus, W., Manaloor, E., Heinrich, M.C., Lewis, G., Ramalingam, P., Kepten, I., Jillella, A., and Bhalla, K. 2009. Chemotherapy and dasatinib induce long-term hematologic and molecular remission in systemic mastocytosis with acute myeloid leukemia with KIT D816V. Leuk. Res. 33:735-741.
    van der Velden, V.H., Cazzaniga, G., Schrauder, A., Hancock, J., Bader, P., Panzer-Grumayer, E.R., Flohr, T., Sutton, R., Cave, H., Madsen, H.O., Cayuela, J.M., Trka, J., Eckert, C., Foroni, L., Zur Stadt, U., Beldjord, K., Raff, T., van der Schoot, C.E., van Dongen, J.J.; European Study Group on MRD detection in ALL (ESG-MRD-ALL). 2007a. Analysis of minimal residual disease by Ig/TCR gene rearrangements: Guidelines for interpretation of real-time quantitative PCR data. Leukemia 21:604-611.
    van der Velden, V.H., Panzer-Grumayer, E.R., Cazzaniga, G., Flohr, T., Sutton, R., Schrauder, A., Basso, G., Schrappe, M., Wijkhuijs, J.M., Konrad, M., Bartram, C.R., Masera, G., Biondi, A., and van Dongen, J.J. 2007b. Optimization of PCR-based minimal residual disease diagnostics for childhood acute lymphoblastic leukemia in a multi-center setting. Leukemia 21:706-713.
    van der Velden, V.H., Wijkhuijs, J.M., and van Dongen, JJ. 2008. Non-specific amplification of patient-specific Ig/TCR gene rearrangements depends on the time point during therapy: Implications for minimal residual disease monitoring. Leukemia 22:641-644.
    van Dongen, J.J., Macintyre, E.A., Gabert, J.A., Delabesse, E., Rossi, V., Saglio, G., Gottardi, E., Rambaldi, A., Dotti, G., Griesinger, F., Parreira, A., Gameiro, P., Diáz, M.G., Malec, M., Langerak, A.W., San Miguel, J.F., and Biondi, A. 1999. Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease. Report of the BIOMED-1 Concerted Action: Investigation of minimal residual disease in acute leukemia. Leukemia 13:1901-1928.
    Zhou, J., Goldwasser, M.A., Li, A., Dahlberg, S.E., Neuberg, D., Wang, H., Dalton, V., McBride, K.D., Sallan, S.E., Silverman, L.B., and Gribben, J.G., Dana-Farber Cancer Institute ALL Consortium. 2007. Quantitative analysis of minimal residual disease predicts relapse in children with B-lineage acute lymphoblastic leukemia in DFCI ALL Consortium Protocol 95-01. Blood 110:1607-1611.
 Key References
    Mauro and Deininger, 2006. See above.

A comprehensive review of CML biology and testing.

    Melnick and Licht, 1999. See above.

A review of the molecular biology of acute promyelocytic leukemia and the role of its associated fusion proteins.

    Renneville et al., 2008. See above.

A review of some of the mutations known to impact on prognosis in AML.

    Steensma, 2006. See above.

A review of the biology of JAK2 mutations with an emphasis on molecular diagnosis.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.