Print
Email
Improved Protocols for the Illumina Genome Analyzer Sequencing System
Publication Name:
Current Protocols in Human Genetics
Unit Number:
Unit 18.2
DOI:
10.1002/0471142905.hg1802s62
Online Posting Date:
July, 2009 Abstract
In this unit, we describe a set of improvements we have made to the standard Illumina Genome Analyzer protocols to make the sequencing process more reliable in a high-throughput environment, reduce amplification bias, narrow the distribution of insert sizes, and reliably obtain high yields of data. Curr. Protoc. Hum. Genet. 62:18.2.1-18.2.27. © 2009 by John Wiley & Sons, Inc.
Keywords: Illumina; Next-Generation; sequencer; protocols; Genome Analyzer
Table of Contents
- Introduction
- Basic Protocol 1: Fragmentation
- Basic Protocol 2: Template Preparation
- Basic Protocol 3: PCR Amplification of the Library
- Alternate Protocol 1: Direct Sequencing of Short Amplicons
- Basic Protocol 4: Quantification Using TaqMan Probes
- Alternate Protocol 2: Quantification Using SYBRGreen Probes
- Basic Protocol 5: Denaturation of Templates
- Basic Protocol 6: Amplification Quality Control
- Reagents and Solutions
- Commentary
- Literature Cited
- Figures
- Tables
Materials
Basic Protocol 1: Fragmentation
Materials
- DNA sample
- Qiagen QIAquick PCR purification kit (cat. no. 28104) containing:
- PB buffer
- PE buffer
- EB buffer
- Columns
- Covaris S2 with chiller unit
- Thermo Scientific NanoDrop
- 6-mm × 16-mm AFA fiber vials (100-µl; Covaris, cat. no. 520031)
- Crimp caps (Covaris, cat no. 520028)
Basic Protocol 2: Template Preparation
Materials
- Fragmented DNA sample (see
- Paired-end Sample Prep Kit (for library preparation; Illumina, cat. no. PE-102-1001) containing:
- 10× T4 DNA ligase buffer (+10 mM ATP)
- 10 mM dNTP mix
- T4 DNA polymerase
- Klenow DNA polymerase
- T4 polynucleotide kinase
- 10× Klenow buffer
- dATP
- 2× DNA ligase buffer
- DNA ligase
- Qiagen QIAquick PCR purification kit (cat. no. 28104) containing:
- PB buffer
- PE buffer
- EB buffer
- Column
- Klenow exonuclease (3¢-5¢ exo
– ; Illumina) - Paired-end adapter mix (Illumina):
- PE_t_adapter: 5¢ ACACTCTTTCCCTACACGACGCTCTTCCGATC*T (*indicates phosphorothioate; Bentley et al.,
- PE_b_adapter: 5¢ P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG (P- indicates phosphate; Bentley et al.,
- 2% Invitrogen Ultra-pure agarose (Invitrogen, cat. no. 15510-027)
- 5× TBE buffer (Severn Biotech, cat. no. 20-6005-10)
- 10 mg/ml ethidium bromide solution (Sigma, cat. no. E1510)
- Gel Pilot 5× loading dye (Qiagen, cat. no. 239901)
- Low-molecular-weight size standard ladder (New England Biolabs, cat. no. N3233L)
- Qiagen QIAquick gel extraction kit (cat. no. 28706) containing:
- Chaotropic buffer (QC buffer)
- Spin columns
- 37°C incubator
- QIAquick MinElute column (included with the QIAquick MinElute kit; Qiagen, cat no. 28004)
- Dark reader (Clare Chemical Research, cat. no. DR46)
- Scalpel or razor blade
Basic Protocol 3: PCR Amplification of the Library
Materials
- Agilent DNA 1000 kit (cat. no. 5067-1504) containing:
- DNA dye concentrate (blue-capped vial)
- Gel matrix (red-capped vial)
- DNA marker (green-capped vial)
- DNA ladder (yellow-capped vial)
- Spin filters
- DNA chips
- Syringe
- Extracted DNA library (see
- Platinum Pfx polymerase and supplied 10× buffer (Invitrogen, cat. no 11708-013)
- 50 mM MgSO
4 (supplied with Platinum Pfx polymerase) - 2.5 mM dNTP mix (Invitrogen, cat. no. R72501)
- Paired-end PCR primers:
- PCR_F 5¢-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC*T (*indicates phosphorothioate; Bentley et al.,
- PCR_R 5¢-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC*T (*indicates phosphorothioate; Bentley et al.,
- Agencourt AMPure beads (cat. no. A29152)
- 70% ethanol
- Vortex (supplied with the Bioanalyzer)
- Agilent Bioanalyzer 2100
- Thermal cycler
- 1.5-ml microcentrifuge tubes
- Magnetic separator (e.g., Qiagen 12-Tube Magnet, cat. no. 36912)
Alternate Protocol 1: Direct Sequencing of Short Amplicons
Materials
- Genomic DNA template
- 2× hybridization buffer (see
- Thermal cycler
Basic Protocol 4: Quantification Using TaqMan Probes
Materials
- TaqMan probe:
- DLP (HPLC purified) [6FAM]CCCTACACGACGCTCTTCCGATCT[TAMRA]
- Concentration standard (e.g., library previously sequenced with known cluster density)
- 10 mM Tris×Cl, pH 8.5 (appendix
- 50 mM MgCl
2 (supplied with Platinum Taq) - Template DNAs of unknown concentration (from
- PCR primers:
- c_qPCR_v2.1 (desalted) AATGATACGGCGACCACCGAGATC
- PE_qPCR_v2.2 (desalted) CAAGCAGAAGACGGCATACGAGATC
- 50× Rox (Invitrogen, cat. no. 12223012)
- 2.5 mM dNTP mix (Invitrogen, cat. no. R72501)
- Platinum Taq and supplied 10× buffer (Invitrogen, cat. no. 10966018)
- Low-bind tubes (Axygen, MCT-175)
- 96-well qPCR plates (Applied Biosystems, cat. no. 4346906)
- Adhesive plate sealers (Applied Biosystems, cat. no. 4311971)
- Applied Biosystems StepOne Quantitative PCR machine (or equivalent)
Alternate Protocol 2: Quantification Using SYBRGreen Probes
Additional Materials (also see Basic Protocol 4 )
- PCR primers:
- Syb_FP5 (desalted) ATGATACGGCGACCACCGAG
- Syb_RP7 (desalted) CAAGCAGAAGACGGCATACGAG
- Template DNAs of unknown concentration (from
- SYBRGreen PCR Master Mix (Applied Biosystems, cat. no. 4309155)
Basic Protocol 5: Denaturation of Templates
Materials
- 2 N NaOH (Illumina)
- Hybridization buffer (Illumina)
- UltraPure water (Illumina)
- Ice
- DNA library (see
- EB buffer (supplied with Qiagen QIAquick PCR purification kit, cat. no. 28104)
- 200-µl tubes
- 1.5-ml microcentrifuge tubes
- Vortex
Basic Protocol 6: Amplification Quality Control
Materials
- 0.1 M Tris×Cl pH 8.0 (appendix
- Sodium ascorbate (Sigma, cat. no. A4034)
- 10,000× SYBRGreen I (Invitrogen, cat. no. 57567)
- Amplified flowcell
- PR2 buffer (Illumina, supplied with sequencing kits)
- 15-ml Falcon tubes
- 0.2-µm syringe filter
- Cluster Station (Illumina)
- Fluorescence microscope, set up to detect SYBRGreen I
Looking for materials? Suppliers Guide
Figures
-
Figure 18.2.1Illumina GAII flowcell. (A) Flowcells are hollow glass slides, with 8 separate lanes, through which reagents and template DNA flow. Lanes have been shaded gray for clarity. (B) Cross-section of a single lane, showing the direction of reagent flow and polyacrylamide coating on the interior surface of the flowcell. -
Figure 18.2.2(A) Template hybridization, extension, and denaturation on the flowcell surface. Templates are prepared so as to possess tails that are complementary to primers on the flowcell surface. This allows one end of a template strand to hybridize to a flowcell primer. Flowcell primers are extended by Taq polymerase, resulting in a reverse complementary copy of the original template strand, which is covalently attached to the flowcell surface. The original template strand is then removed by flushing 0.1 M NaOH though the flowcell. (B) Cluster amplification. The free end of the tethered reverse complementary copy of the original template strand can anneal to the other type of flowcell primer, forming a bridge. The flowcell primer is extended by Bst polymerase, in an isothermal reaction, which generates a double-stranded product. Formamide is used to denature these strands, which can then anneal to other primers on the flowcell surface, which extend in the next cycle. In this way, repeated cycles of extension and denaturation result in a cluster of strands, all of which are derived from a single template strand. -
Figure 18.2.3SYBRGreen QC. Although the most accurate method to measure cluster density is to perform a first-base incorporation on the flowcell, it is more economical to stain flowcells with SYBRGreen I immediately after amplification, and to examine cluster density qualitatively, using a fluorescence microscope. When coupled with qPCR quantification, this method is usually sufficiently accurate. -
Figure 18.2.4Comparison of sample fragmentation by nebulization with Covaris AFA. 4.5 µg human genomic DNA was fragmented by nebulization (red line) and AFA (blue line). Both were purified using a spin column and eluted in 30 µl EB buffer (Qiagen). 1 µl of each eluate was run on an Agilent Bioanalyzer DNA 2100 chip. Image adapted with permission from Macmillan Publishers Ltd. (Quail et al., -
Figure 18.2.5Comparison of gel extraction with and without heating. The plots show the total area in which reads with a particular G+C content are distributed; the mean and standard deviation are also shown. (A) This plot represents the standard gel extraction protocol, in which gel slices are heated to 50°C. (B) This plot shows the G+C distribution for the optimized gel extraction. The greater width of the shaded area in plot (A) indicates a wider dispersion of coverage for all values of G+C content for which sequences were obtained. Image adapted with permission from Macmillan Publishers Ltd. (Quail et al., -
Figure 18.2.6Size selection and PCR. Agilent Bioanalyzer DNA 1000 traces for three libraries (A) a double-size selected 100-bp insert library that was amplified using optimized PCR conditions, (B) a 200-bp insert library (single size selection) showing a shoulder of smaller fragments, (C) the same double-size selected 100-bp insert library as (A) but using standard PCR conditions. The peaks at 15 and 1500 bases are Agilent-supplied size standards. Image adapted with permission from Macmillan Publishers Ltd. (Quail et al., -
Figure 18.2.7Increased PCR yield using improved conditions. A 500-bp library was prepared, and 1 ng was amplified for 18 cycles of PCR using standard conditions (blue curve) and our optimized conditions (red curve). Image adapted with permission from Macmillan Publishers Ltd. (Quail et al., -
Figure 18.2.8PCR cleanup. We prepared a paired-end PhiX library using conditions that would promote the formation of adapter and primer dimers and unextended PCR primers. After PCR, we divided the library in two: half was purified using a QIAquick spin column, as in the standard Illumina protocol (left), whereas the other half was purified using AMPure SPRI beads (right). Gels are shown after staining and excision of the gel slice corresponding to the desired size range of fragments. Image adapted with permission from Macmillan Publishers Ltd. (Quail et al., -
Figure 18.2.9Cluster throughput as a function of total clusters. The graph shows analyzable purity filtered (PF) clusters in one tile (imaged area) versus total raw clusters per tile. The data was obtained from GAII flowcells using two different versions of the analysis pipeline, 1.3.2 and 1.3.4. For version 1.3.2, it can be seen that above the optimal cluster density, the number of clusters obtained after purify filtering begins to decrease as more and more clusters overlap, and so are discarded by the image analysis software. With pipeline version 1.3.4, the relationship between total and PF clusters is more linear. In both cases, accurate library quantification is essential for the sequencing run to generate the maximum yield of data. -
Figure 18.2.10Improvement of cluster density reproducibility with qPCR quantification. Runs were grouped into 25-run bins, and a boxplot was generated. After some initial problems with degradation of standards, cluster number leveled out at ~35,000 to 40,000 per tile for GAI flowcells. Image adapted with permission from Macmillan Publishers Ltd. (Quail et al.,
Literature Cited
| Literature Cited | |
| Albert, T.J., Molla, M.N., Muzny, D.M., Nazareth, L., Wheeler, D., Song, X., Richmond, T.A., Middle, C.M., Rodesch, M.J., Packard, C.J., Weinstock, G.M., and Gibbs, R.A. 2007. Direct selection of human genomic loci by microarray hybridization. Nat. Methods 4:903-905. | |
| Bentley, D.R., Balasubramanian, S., Swerdlow, H.P., Smith, G.P., Milton, J., Brown, C.G., Hall, K.P., Evers, D.J., Barnes, C.L., Bignell, H.R., Boutell, J.M., Bryant, J., Carter, R.J., Keira, Cheetham, R., Cox, A.J., Ellis, D.J., Flatbush, M.R., Gormley, N.A., Humphray, S.J., Irving, L.J., Karbelashvili, M.S., Kirk, S.M., Li, H., Liu, X., Maisinger, K.S., Murray, L.J., Obradovic, B., Ost, T., Parkinson, M.L., Pratt, M.R., Rasolonjatovo, I.M., Reed, M.T., Rigatti, R., Rodighiero, C., Ross, M.T., Sabot, A., Sankar, S.V., Scally, A., Schroth, G.P., Smith, M.E., Smith, V.P., Spiridou, A., Torrance, P.E., Tzonev, S.S., Vermaas, E.H., Walter, K., Wu, X., Zhang, L., Alam, M.D., Anastasi, C., Aniebo, I.C., Bailey, D.M., Bancarz, I.R., Banerjee, S., Barbour, S.G., Baybayan, P.A., Benoit, V.A., Benson, K.F., Bevis, C., Black, P.J., Boodhun, A., Brennan, J.S., Bridgham, J.A., Brown, R.C., Brown, A.A., Buermann, D.H., Bundu, A.A., Burrows, J.C., Carter, N.P., Castillo, N., Chiara, E.C.M., Chang, S., Neil Cooley, R., Crake, N.R., Dada, O.O., Diakoumakos, K.D., Dominguez-Fernandez, B., Earnshaw, D.J., Egbujor, U.C., Elmore, D.W., Etchin, S.S., Ewan, M.R., Fedurco, M., Fraser, L.J., Fuentes Fajardo, K.V., Scott Furey, W., George, D., Gietzen, K.J., Goddard, C.P., Golda, G.S., Granieri, P.A., Green, D.E., Gustafson, D.L., Hansen, N.F., Harnish, K., Haudenschild, C.D., Heyer, N.I., Hims, M.M., Ho, J.T., Horgan, A.M., Hoschler, K., Hurwitz, S., Ivanov, D.V., Johnson, M.Q., James, T., Huw Jones, T.A., Kang, G.D., Kerelska, T.H., Kersey, A.D., Khrebtukova, I., Kindwall, A.P., Kingsbury, Z., Kokko-Gonzales, P.I., Kumar, A., Laurent, M.A., Lawley, C.T., Lee, S.E., Lee, X., Liao, A.K., Loch, J.A., Lok, M., Luo, S., Mammen, R.M., Martin, J.W., McCauley, P.G., McNitt, P., Mehta, P., Moon, K.W., Mullens, J.W., Newington, T., Ning, Z., Ling, Ng, B., Novo, S.M., O'Neill, M.J., Osborne, M.A., Osnowski, A., Ostadan, O., Paraschos, L.L., Pickering, L., Pike, A.C., Pike, A.C., Chris Pinkard, D., Pliskin, D.P., Podhasky, J., Quijano, V.J., Raczy, C., Rae, V.H., Rawlings, S.R., Chiva Rodriguez, A., Roe, P.M., Rogers, J., Rogert Bacigalupo, M.C., Romanov, N., Romieu, A., Roth, R.K., Rourke, N.J., Ruediger, S.T., Rusman, E., Sanches-Kuiper, R.M., Schenker, M.R., Seoane, J.M., Shaw, R.J., Shiver, M.K., Short, S.W., Sizto, N.L., Sluis, J.P., Smith, M.A., Ernest Sohna Sohna, J., Spence, E.J., Stevens, K., Sutton, N., Szajkowski, L., Tregidgo, C.L., Turcatti, G., Vandevondele, S., Verhovsky, Y., Virk, S.M., Wakelin, S., Walcott, G.C., Wang, J., Worsley, G.J., Yan, J., Yau, L., Zuerlein, M., Rogers, J., Mullikin, J.C., Hurles, M.E., McCooke, N.J., West, J.S., Oaks, F.L., Lundberg, P.L., Klenerman, D., Durbin, R. and Smith, A.J. 2008. Accurate whole-human genome sequencing using reversible terminator chemistry. Nature 456:53-59. | |
| Hawkins, T.L., O'Connor-Morin, T., Roy, A., and Santillan, C. 1994. DNA purification and isolation using a solid-phase. Nucleic Acids Res. 22:4543-4544. | |
| Hodges, E., Xuan, Z., Balija, V., Kramer, M., Molla, M.N., Smith, S.W., Middle, C.M., Rodesch, M.J., Albert, T.J., Hannon, G.J., and McCombie, W.R. 2007. Genome-wide in situ exon capture for selective resequencing. Nat. Genet. 39:1522-1527. | |
| International Human Genome Sequencing Consortium. 2004. Finishing the euchromatic sequence of the human genome. Nature 431:931-945. | |
| Mandel, M. and Marmur, J. 1968. Use of ultraviolet absorbance-temperature profile for determining the guanine plus cytosine content of DNA. Methods Enzymol. 12:195-206. | |
| Mardis, E.R. 2008. The impact of next-generation sequencing technology on genetics. Trends Genet. 24:133-141. | |
| Margulies, M., Egholm, M., Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka, J., Braverman, M.S., Chen, Y.J., Chen, Z., Dewell, S.B., Du, L., Fierro, J.M., Gomes, X.V., Godwin, B.C., He, W., Helgesen, S., Ho, C.H., Irzyk, G.P., Jando, S.C., Alenquer, M.L., Jarvie, T.P., Jirage, K.B., Kim, J.B., Knight, J.R., Lanza, J.R., Leamon, J.H., Lefkowitz, S.M., Lei, M., Li, J., Lohman, K.L., Lu, H., Makhijani, V.B., McDade, K.E., McKenna, M.P., Myers, E.W., Nickerson, E., Nobile, J.R., Plant, R., Puc, B.P., Ronan, M.T., Roth, G.T., Sarkis, G.J., Simons, J.F., Simpson, J.W., Srinivasan, M., Tartaro, K.R., Tomasz, A., Vogt, K.A., Volkmer, G.A., Wang, S.H., Wang, Y., Weiner, M.P., Yu, P., Begley, R.F., and Rothberg, J.M. 2005. Genome sequencing in microfabricated high-density picolitre reactors. Nature 437:376-380. | |
| Maxam, A.M. and Gilbert, W. 1977. A new method for sequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74:560-564. | |
| Meyer, M., Briggs, A.W., Maricic, T., Hober, B., Hoffner, B., Krause, J., Weihmann, A., Paabo, S., and Hofreiter, M. 2008. From micrograms to picograms: Quantitative PCR reduces the material demands of high-throughput sequencing. Nucleic Acids Res. 36:e5. | |
| Quail, M.A., Kozarewa, I., Smith, F., Scally, A., Stephens, P.J., Durbin, R., Swerdlow, H., and Turner, D.J. 2008. A large genome center's improvements to the Illumina sequencing system. Nat. Methods 5:1005-1010. | |
| Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J.C., and Markham, A.F. 1990. A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18:2887-2890. | |
| Ronaghi, M., Uhlen, M., and Nyren, P. 1998. A sequencing method based on real-time pyrophosphate. Science 281:363-365. | |
| Sambrook, J., Fritsch, E., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. | |
| Sanger, F. and Coulson, A.R. 1975. A rapid method for determining sequences in DNA by primed synthesis with DNA polymerase. J. Mol. Biol. 94:441-448. | |
| Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463-5467. | |
| Smith, D. and Malek, J. 2007. Asymmetrical adapters and methods of use thereof. USPTO Application no. 20070172839. | |
| Surzycki, S. 2000. Basic Techniques in Molecular Biology. Springer-Verlag, Berlin. | |
Editorial announcements
Troubleshooting Tips
|
TOOLS & CALCULATORS |
Join the Conversation
Post new comment