User Ratings

Your rating: None
Your rating: None
Your rating: None
Add your comments

Comprehensive High‐Throughput Arrays for Relative Methylation (CHARM)

Christine Ladd‐Acosta1,  Martin J. Aryee1,  Jared M. Ordway2,  Andrew P. Feinberg1

1Center for Epigenetics and Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland
2Orion Genomics, LLC, St. Louis, Missouri


Unit Number: 
Unit 20.1
DOI: 
10.1002/0471142905.hg2001s65
Online Posting Date: 
April, 2010
GO TO THE FULL TEXT:
PDF or HTML at Wiley Online Library
Are you the author of this protocol? Login or register and return to this page.

Abstract

DNA methylation (DNAm) is a term used to describe the heritable covalent addition of a methyl group to cytosines at CpG dinucleotides in mammals. While methods for examining DNAm status at specific loci have existed for several years, recent technological advances have begun to enable the examination of DNAm across the genome. In this unit, we describe comprehensive high-throughput arrays for relative methylation (CHARM), a highly sensitive and specific approach to measure DNA methylation across the genome. This method makes no assumptions about where functionally important DNAm occurs, i.e., CpG island or promoter regions, and includes lower-CpG-density regions of the genome. In addition, it uses a novel genome-weighted smoothing algorithm to correct for CpG density and fragment biases present in methyl-enrichment or methyl-depletion DNA-fractionation methods. It can be applied to studying epigenomic changes in DNAm for normal and diseased samples. Curr. Protoc. Hum. Genet. 65:20.0.1-20.0.19. © 2010 by John Wiley & Sons, Inc.

Keywords: DNA methylation; CHARM; epigenome; methylome

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol: CHARM Array Hybridization and Analysis
  • Support Protocol 1: Fractionation of Genomic DNA by Random Shearing
  • Support Protocol 2: Methyl-Dependent Fractionation of Genomic DNA Using McrBC
  • Support Protocol 3: Whole-Genome Amplification
  • Support Protocol 4: Determining McrBC Specificity and Unmethylated DNA Enrichment
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol: CHARM Array Hybridization and Analysis

 Materials

Support Protocol 1: Fractionation of Genomic DNA by Random Shearing

 Materials
  • 5 µg of high-quality, high-molecular-weight, genomic DNA in 1× TE buffer (appendix 3B)
  • 1× TE buffer, pH 7.4 (Quality Biological), filtered prior to use to avoid clogging of the shearing assembly
  • 0.2 M hydrochloric acid (wash solution I), filtered prior to use to avoid clogging of the shearing assembly
  • 0.2 M sodium hydroxide (wash solution II), filtered prior to use to avoid clogging of the shearing assembly
  • 50-ml conical tubes (BD Falcon)
  • HydroShear device, equipped with a standard shearing assembly and syringe (DigiLab; http://www.digilabglobal.com/)

Support Protocol 2: Methyl-Dependent Fractionation of Genomic DNA Using McrBC

 Materials
  • Two 50-µl aliquots of sheared genomic DNA: one labeled UT and the other labeled MD, (Support Protocol 1)
  • 10× NEBuffer2 (NEB2; New England Biolabs)
  • 100 µg/ml (100×) bovine serum albumin (100× BSA)
  • 100 mM (100×) guanosine triphosphate (GTP; store in single-use aliquots at –80°C)
  • 10 U/µL McrBC (New England Biolabs): test each new lot on a standard gDNA sample, using the digestion reaction and conditions provided below, to ensure complete digestion prior to use on any experimental samples
  • 50% (w/v) glycerol
  • 50 mg/ml proteinase K
  • SeaPlaque GTG Agarose (low melting point)
  • 1× Tris-acetate-EDTA (TAE) buffer (see appendix 2D for 50×)
  • 10 mg/ml ethidium bromide stock (appendix 2D)
  • 1 Kb Plus DNA Ladder (Invitrogen)
  • PhiDye (see recipe)
  • Qiagen Gel Extraction Kit including:
    • Isopropanol
    • Buffer QG
    • Buffer PE
    • Buffer EB
  • 50° and 65°C water bath
  • 500-ml Erlenmeyer flask
  • Microwave oven
  • Clean 12-in. × 14-in. gel box with casting tray (USA Scientific)
  • Clean 8-well, 1.5-mm wide-tooth combs for the 12-in. × 14-in. gel box (USA Scientific)
  • Kimwipes
  • Heat-protective glove (“Hotglove”)
  • Gel imager (e.g., AlphaImager HP; Alpha Innotech, http://www.alphainnotech.com)
  • Razor blades
  • Additional reagents and equipment for ethanol precipitation of DNA (appendix 3C; use ammonium acetate as the monovalent cation) and agarose gel electrophoresis (see Ordway et al., 2006, and unit 2.7 in this manual)

Support Protocol 3: Whole-Genome Amplification

 Materials
  • 30 ng of excised, purified DNA from step 17 of Support Protocol 2 for both MD and UT fractions
  • GenomePlex Complete Whole Genome Amplification (WGA2) kit (Sigma) including:
    • 10× fragmentation buffer
    • 1× library preparation buffer
    • Library stabilization solution
    • Library preparation enzyme
    • 10× amplification master mix
    • WGA DNA polymerase
    • Nuclease-free water
  • QiaQuick PCR Purification Kit including:
    • Buffer PB
    • Buffer PE
    • Buffer EB
  • Additional reagents and equipment for spectrophotometrically quantitating DNA (appendix 3D)

Support Protocol 4: Determining McrBC Specificity and Unmethylated DNA Enrichment

 Materials
  • For each sample, 60 ng of untreated DNA (UT fraction) obtained after whole-genome amplification (Support Protocol 3), at a concentration of 5 ng/µl
  • For each sample, 60 ng of McrBC-treated DNA (MD fraction) obtained after whole-genome amplification (Support Protocol 3), at a concentration of 5 ng/µl
  • Fast SYBR Green Master Mix (Applied Biosystems)
  • Quantitative real-time PCR primers for the human genome (Ordway et al., 2007):
    • GAPDH forward primer: TCTTGAGGCCTGAGCTACGTG
    • GAPDH reverse primer: CCCGTCCTTGACTCCCTAGTGT
    • GAPDH target sequence (5¢ to 3¢): CCTGCTGCCCACAGTCCAGTCCTGGG- AACCAGCACCGATCACCTCCCATCGGGCCAATCTCAGTCCCTT- CCCCCCTACGTCGGGGCCCACACGCTCGGTGCGTGCCCAGTTGAA- CCAGGCGGCTGCGGAAAAAAAAAAGCGGGGAGAAAGTAGGG- CCCGGCTACTAGCGGTTTTACGGGCG
    • HIST1H2BA forward primer: AGTGCTGTGTAACCCTGGAAAA
    • HIST1H2BA reverse primer: ACTCTCCTTACGGGTCCTCTTG
    • HIST1H2BA target sequence: AGTGCTGTGTAACCCTGGAAAAGAACCGT- GTAACGCTGCAGAAGTGTGTGGTAGCTATGCCGGAGGTGTCAT- CTAAAGGTGCTACCATTTCCAAGAAGGGCTTTAAGAAAGCTGTCG- TTAAGACCCAGAAAAAGGAAGGCAAAAAGCGCAAGAGGACCCGTAAGGAGAGT
  • Milli-Q water
  • 384- or 96-well optical plates
  • Optical plate seals
  • ABI 7900 HT real-time PCR machine
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  • Figure 20.1.1
    Overview of McrBC-based fractionation (Lippman et al., 2005; Ordway et al., 2006) coupled with CHARM analysis (Irizarry et al., 2008). Genomic DNA is sheared to 1.5 to 3.0 kb and divided into two equal parts. The first is digested with McrBC, a methyl-cytosine insensitive enzyme that recognizes PumC(N40-3000)mCPu, and the second is untreated. Both fractions are then resolved side by side on a 1% agarose gel, and fragments between 1.65 kb and 3.0 kb are excised and purified. Next, the untreated fraction, representing total input DNA, is labeled with cyanine-3 (Cy3) and the McrBC-treated fraction, representing unmethylated DNA, is labeled with cyanine-5 (Cy5) followed by cohybridization to a CHARM microarray. Sequences that are methylated will be present in the input fraction (Cy3) and depleted in the methyl-depleted fraction (Cy5). For each probe on the array, a log ratio of the Cy3 to Cy5 intensity is calculated and represents the methylation level (M-value) at each locus, with larger M-values representing more methylation and smaller M-values representing less methylation.

  • Figure 20.1.2
    Tab-delimited sample description file (example).

  • Figure 20.1.3
    Table listing DMRs (example of output generated using commands in step 9).

  • Figure 20.1.4
    The expected size distribution, from 1.5 kb to 3.0 kb, of genomic DNA after shearing with a HydroShear device. We ran 500 ng of DNA on a 1% agarose gel in 1× TAE buffer for 60 min at 110 volts. Lane 1 contains a 1 Kb Plus DNA Ladder with the upper and lower arrows denoting 3.0 kb and 1.65 kb, respectively. Lane 2 contains unsheared, high-quality, high-molecular-weight genomic DNA as a reference. Lane 3 contains genomic DNA that was sheared using a standard shearing assembly on a HydroShear device. The two straight horizontal lines denote the expected size distribution of DNA.

  • Figure 20.1.5
    Genomic DNA is size fractionated using a high-molecular-weight agarose gel. Mock (UT) and McrBC (MD) digestions were run side by side for 3.5 hr at 30 V. Lanes 1, 4, 5, 8, 9, 12, 13, and 16 contain a 1 Kb Plus DNA Ladder. Lanes 2 and 3 contain sheared gDNA from sample 1 that was mock digested (UT) and McrBC-treated (MD), respectively. Lanes 6 and 7 contain sheared gDNA from sample 2 that was mock digested (UT) and McrBC-treated (MD), respectively. Lanes 10 and 11 contain sheared gDNA from sample 3 that was mock digested (UT) and McrBC-treated (MD), respectively. Lanes 14 and 15 contain sheared gDNA from sample 4 that was mock digested (UT) and McrBC-treated (MD), respectively. Images on the left represent the agarose gel prior to extracting DNA and the images on the right show the agarose gel image after extracting DNA ranging in size from 1.65 to 3.0 kb. Well 1, 1 Kb Plus DNA Ladder (1 µg); Well 2, Sample 1–UT; Well 3, Sample 1–MD; Well 4, 1 Kb Plus DNA Ladder (1 µg); Well 5, 1 Kb Plus DNA Ladder (1 µg); Well 6, Sample 2–UT; Well 7, Sample 2–MD; Well 8, 1 Kb Plus DNA Ladder (1 µg); Well 9, 1 Kb Plus DNA Ladder (1 µg); Well 10, Sample 3–UT; Well 11, Sample 3–MD; Well 12, 1 Kb Plus DNA Ladder (1 µg); Well 13, 1 Kb Plus DNA Ladder (1 µg); Well 14, Sample 4–UT; Well 15, Sample 4–MD; Well 16, 1 Kb Plus DNA Ladder (1 µg).

  • Figure 20.1.6
    Suggested timeline for CHARM analysis of DNA methylation.

Literature Cited

Literature Cited
    Amir, R.E., Van den Veyver, I.B., Wan, M., Tran, C.Q., Francke, U., and Zoghbi, H.Y. 1999. Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat. Genet. 23:185-188.
    Barker, D.L., Hansen, M.S., Faruqi, A.F., Giannola, D., Irsula, O.R., Lasken, R.S., Latterich, M., Makarov, V., Oliphant, A., Pinter, J.H., Shen, R., Sleptsova, I., Ziehler, W., and Lai, E. 2004. Two methods of whole-genome amplification enable accurate genotyping across a 2320-SNP linkage panel. Genome Res. 14:901-907.
    Buffart, T.E., van Grieken, N.C., Tijssen, M., Coffa, J., Ylstra, B., Grabsch, H.I., van de Velde, C.J., Carvalho, B., and Meijer, G.A. 2009. High resolution analysis of DNA copy-number aberrations of chromosomes 8, 13, and 20 in gastric cancers. Virchows Arch. 455:213-223.
    Callinan, P.A. and Feinberg, A.P. 2006. The emerging science of epigenomics. Hum. Mol. Genet. 15:R95-R101.
    Choi, Y.C. and Chae, C.B. 1991. DNA hypomethylation and germ cell-specific expression of testis-specific H2B histone gene. J. Biol. Chem. 266:20504-20511.
    Feinberg, A.P. 2009. Genome-scale approaches to the epigenetics of common human disease. Virchows Arch. 456:13-21.
    Feinberg, A.P. and Tycko, B. 2004. The history of cancer epigenetics. Nat. Rev. Cancer 4:143-153.
    Gentleman, R.C., Carey, V.J., Bates, D.M., Bolstad, B., Dettling, M., Dudoit, S., Ellis, B., Gautier, L., Ge, Y., Gentry, J., Hornik, K., Hothorn, T., Huber, W., Iacus, S., Irizarry, R., Leisch, F., Li, C., Maechler, M., Rossini, A.J., Sawitzki, G., Smith, C., Smyth, G., Tierney, L., Yang, J.Y., and Zhang, J. 2004. Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 5:R80.
    Gribble, S., Ng, B.L., Prigmore, E., Burford, D.C., and Carter, N.P. 2004. Chromosome paints from single copies of chromosomes. Chromosome Res. 12:143-151.
    Irizarry, R.A., Ladd-Acosta, C., Carvalho, B., Wu, H., Brandenburg, S.A., Jeddeloh, J.A., Wen, B., and Feinberg, A.P. 2008. Comprehensive high-throughput arrays for relative methylation (CHARM). Genome Res. 18:780-790.
    Irizarry, R.A., Ladd-Acosta, C., Wen, B., Wu, Z., Montano, C., Onyango, P., Cui, H., Gabo, K., Rongione, M., Webster, M., Ji, H., Potash, J.B., Sabunciyan, S., and Feinberg, A.P. 2009. The human colon cancer methylome shows similar hypo- and hypermethylation at conserved tissue-specific CpG island shores. Nat. Genet. 41:178-186.
    Lippman, Z., Gendrel, A.V., Colot, V., and Martienssen, R. 2005. Profiling DNA methylation patterns using genomic tiling microarrays. Nat. Methods 2:219-224.
    Livak, K.J. and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25:402-408.
    Mill, J., Tang, T., Kaminsky, Z., Khare, T., Yazdanpanah, S., Bouchard, L., Jia, P., Assadzadeh, A., Flanagan, J., Schumacher, A., Wang, S.C., and Petronis, A. 2008. Epigenomic profiling reveals DNA-methylation changes associated with major psychosis. Am. J. Hum. Genet. 82:696-711.
    Oefner, P.J., Hunicke-Smith, S.P., Chiang, L., Dietrich, F., Mulligan, J., and Davis, R.W. 1996. Efficient random subcloning of DNA sheared in a recirculating point-sink flow system. Nucleic Acids Res. 24:3879-3886.
    Ordway, J.M., Bedell, J.A., Citek, R.W., Nunberg, A., Garrido, A., Kendall, R., Stevens, J.R., Cao, D., Doerge, R.W., Korshunova, Y., Holemon, H., McPherson, J.D., Lakey, N., Leon, J., Martienssen, R.A., and Jeddeloh, J.A. 2006. Comprehensive DNA methylation profiling in a human cancer genome identifies novel epigenetic targets. Carcinogenesis 27:2409-2423.
    Ordway, J.M., Budiman, M.A., Korshunova, Y., Maloney, R.K., Bedell, J.A., Citek, R.W., Bacher, B., Peterson, S., Rohlfing, T., Hall, J., Brown, R., Lakey, N., Doerge, R.W., Martienssen, R.A., Leon, J., McPherson, J.D., and Jeddeloh, J.A. 2007. Identification of novel high-frequency DNA methylation changes in breast cancer. PLoS One 2:e1314.
    Storey, J.D. 2003. The positive false discovery rate: A Bayesian interpretation and the q-value. Ann. Stat. 31:2013-2035.
    Sutherland, E., Coe, L., and Raleigh, E.A. 1992. McrBC: A multisubunit GTP-dependent restriction endonuclease. J. Mol. Biol. 225:327-348.
    Thorstenson, Y.R., Hunicke-Smith, S.P., Oefner, P.J., and Davis, R.W. 1998. An automated hydrodynamic process for controlled, unbiased DNA shearing. Genome Res. 8:848-855.
    Yang, Y.H., Dudoit, S., Luu, P., Lin, D.M., Peng, V., Ngai, J., and Speed, T.P. 2002. Normalization for cDNA microarray data: A robust composite method addressing single and multiple slide systematic variation. Nucleic Acids Res. 30:e15.
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library
Looking for Answers?
Do you have tips, tricks, or improvements to share?

Join the Conversation

Post new comment

The content of this field is kept private and will not be shown publicly.
CAPTCHA
This question is for testing whether you are a human visitor and to prevent automated spam submissions.